Starting /dee2/code/volunteer_pipeline.sh SRR7169968 current disk space = 3049683296256 free memory = 1493319128 SRR7169968 SRAfilesize 78559460ef1ab1e9f6afc735680e1745 SRR7169968.sra SRR7169968.sra file validated SRR7169968 is paired end SRR7169968 is conventional basespace SRR7169968 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169968_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9645 34.0 34.0 34.0 33.0 34.0 2 33.48575 34.0 34.0 34.0 33.0 34.0 3 33.4685 34.0 34.0 34.0 33.0 34.0 4 33.57975 34.0 34.0 34.0 33.0 34.0 5 33.518 34.0 34.0 34.0 33.0 34.0 6 37.337 38.0 38.0 38.0 36.0 38.0 7 37.496 38.0 38.0 38.0 37.0 38.0 8 37.61225 38.0 38.0 38.0 38.0 38.0 9 37.577 38.0 38.0 38.0 38.0 38.0 10-14 37.6201 38.0 38.0 38.0 38.0 38.0 15-19 37.6165 38.0 38.0 38.0 38.0 38.0 20-24 37.56855 38.0 38.0 38.0 38.0 38.0 25-29 37.513549999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.489200000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.4568 38.0 38.0 38.0 37.8 38.0 40-44 37.3315 38.0 38.0 38.0 37.0 38.0 45-49 37.26565 38.0 38.0 38.0 37.0 38.0 50-54 37.2534 38.0 38.0 38.0 37.0 38.0 55-59 37.146750000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.1217 38.0 38.0 38.0 36.2 38.0 65-69 37.067899999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.99535 38.0 38.0 38.0 36.0 38.0 75-79 36.82935 38.0 38.0 38.0 35.8 38.0 80-84 36.723400000000005 38.0 38.0 38.0 35.2 38.0 85-89 36.6027 38.0 38.0 38.0 34.8 38.0 90-94 36.6477 38.0 38.0 38.0 35.2 38.0 95-99 36.52915 38.0 38.0 38.0 34.4 38.0 100-104 36.33505 38.0 38.0 38.0 34.0 38.0 105-109 36.212599999999995 38.0 38.0 38.0 34.0 38.0 110-114 35.9403 38.0 37.4 38.0 33.0 38.0 115-119 35.86295 38.0 37.2 38.0 32.8 38.0 120-124 35.7255 38.0 37.0 38.0 32.6 38.0 125-129 35.400549999999996 38.0 36.2 38.0 30.4 38.0 130-134 35.06055 38.0 36.0 38.0 28.8 38.0 135-139 34.57785 38.0 35.2 38.0 26.4 38.0 140-144 34.46795 38.0 35.0 38.0 26.6 38.0 145-149 33.609049999999996 38.0 35.0 38.0 20.6 38.0 150-151 30.000500000000002 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 4.0 14 2.0 15 0.0 16 2.0 17 3.0 18 4.0 19 13.0 20 5.0 21 5.0 22 5.0 23 9.0 24 17.0 25 17.0 26 18.0 27 12.0 28 24.0 29 36.0 30 52.0 31 40.0 32 54.0 33 80.0 34 114.0 35 232.0 36 526.0 37 2721.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.01910828025478 13.8343949044586 11.031847133757962 34.11464968152866 2 23.400000000000002 16.1 31.900000000000002 28.599999999999998 3 19.25 21.55 26.224999999999998 32.975 4 21.925 27.825 23.925 26.325 5 22.975 31.674999999999997 23.525 21.825 6 21.425 34.599999999999994 24.0 19.975 7 15.2 27.025 39.725 18.05 8 16.975 28.125 29.349999999999998 25.55 9 18.099999999999998 24.4 33.725 23.775 10-14 20.31 30.53 26.68 22.48 15-19 19.595000000000002 28.965000000000003 27.505000000000003 23.935000000000002 20-24 20.115 28.765 27.474999999999998 23.645 25-29 19.77 28.910000000000004 27.034999999999997 24.285 30-34 20.544999999999998 29.595 26.369999999999997 23.49 35-39 20.669999999999998 28.04 27.41 23.880000000000003 40-44 19.830000000000002 28.794999999999998 27.215 24.16 45-49 20.275000000000002 28.084999999999997 27.37 24.27 50-54 19.93 28.475 27.05 24.545 55-59 20.84 27.815 27.47 23.875 60-64 20.075000000000003 28.904999999999998 27.185 23.835 65-69 19.564999999999998 28.634999999999998 27.38 24.42 70-74 20.07 28.199999999999996 27.860000000000003 23.87 75-79 20.555 28.335 26.695 24.415 80-84 20.18 27.87 27.229999999999997 24.72 85-89 20.595 28.425 26.855 24.125 90-94 20.835 27.88 27.185 24.099999999999998 95-99 20.52 27.825 27.49 24.165 100-104 20.119999999999997 28.549999999999997 27.575 23.755000000000003 105-109 20.669999999999998 28.18 27.13 24.02 110-114 21.165 28.005000000000003 26.82 24.01 115-119 21.12 28.299999999999997 26.424999999999997 24.154999999999998 120-124 20.605 28.455000000000002 26.724999999999998 24.215 125-129 21.365000000000002 27.860000000000003 26.43 24.345 130-134 21.375 28.360000000000003 26.41 23.855 135-139 21.095 27.805000000000003 26.384999999999998 24.715 140-144 20.705000000000002 28.165000000000003 26.455000000000002 24.675 145-149 21.005 28.810000000000002 25.97 24.215 150-151 20.95 28.499999999999996 26.8375 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.5 25 3.5 26 6.5 27 7.5 28 7.5 29 12.5 30 19.5 31 32.0 32 39.5 33 38.5 34 53.0 35 75.5 36 84.5 37 97.0 38 114.0 39 147.0 40 174.5 41 196.0 42 229.5 43 250.5 44 254.0 45 248.0 46 250.5 47 241.5 48 214.5 49 191.5 50 187.5 51 169.5 52 144.0 53 125.5 54 98.0 55 77.5 56 61.0 57 40.5 58 24.5 59 17.5 60 14.5 61 10.5 62 9.0 63 6.5 64 4.0 65 5.5 66 3.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57254211717374 99.0 2 0.4023133014835303 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025144581342720643 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAAAAGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 7 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.5125000000000002 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 1.9249999999999998 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.9 0.0 0.0 0.0 0.0 110-111 3.225 0.0 0.0 0.0 0.0 112-113 3.7125000000000004 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.449999999999999 0.0 0.0 0.0 0.0 118-119 5.0875 0.0 0.0 0.0 0.0 120-121 5.6375 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.575 0.0 0.0 0.0 0.0 126-127 6.9625 0.0 0.0 0.0 0.0 128-129 7.4125 0.0 0.0 0.0 0.0 130-131 7.975 0.0 0.0 0.0 0.0 132-133 8.3875 0.0 0.0 0.0 0.0 134-135 8.925 0.0 0.0 0.0 0.0 136-137 9.712499999999999 0.0 0.0 0.0 0.0 138-139 10.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169968 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169968_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83625 33.0 33.0 34.0 32.0 34.0 2 32.25 34.0 33.0 34.0 31.0 34.0 3 32.32275 34.0 33.0 34.0 32.0 34.0 4 32.257 34.0 33.0 34.0 32.0 34.0 5 32.18 34.0 33.0 34.0 32.0 34.0 6 36.384 38.0 38.0 38.0 36.0 38.0 7 36.4415 38.0 38.0 38.0 36.0 38.0 8 36.42625 38.0 38.0 38.0 36.0 38.0 9 36.4385 38.0 38.0 38.0 36.0 38.0 10-14 36.41185 38.0 38.0 38.0 36.4 38.0 15-19 36.181400000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.3312 38.0 38.0 38.0 36.4 38.0 25-29 36.34045 38.0 38.0 38.0 36.2 38.0 30-34 36.403499999999994 38.0 38.0 38.0 36.8 38.0 35-39 36.33944999999999 38.0 38.0 38.0 36.4 38.0 40-44 36.194900000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.01665 38.0 38.0 38.0 35.6 38.0 50-54 36.19355 38.0 38.0 38.0 36.0 38.0 55-59 36.2359 38.0 38.0 38.0 36.0 38.0 60-64 36.1525 38.0 38.0 38.0 36.0 38.0 65-69 36.15465 38.0 38.0 38.0 35.8 38.0 70-74 36.06045 38.0 38.0 38.0 35.6 38.0 75-79 35.999649999999995 38.0 38.0 38.0 35.0 38.0 80-84 35.944599999999994 38.0 38.0 38.0 34.8 38.0 85-89 35.61295 38.0 38.0 38.0 34.0 38.0 90-94 35.1517 38.0 38.0 38.0 31.0 38.0 95-99 35.5368 38.0 38.0 38.0 32.2 38.0 100-104 35.6072 38.0 38.0 38.0 33.4 38.0 105-109 35.57595 38.0 38.0 38.0 33.6 38.0 110-114 35.28830000000001 38.0 38.0 38.0 31.6 38.0 115-119 35.034400000000005 38.0 37.8 38.0 29.2 38.0 120-124 34.817899999999995 38.0 37.2 38.0 27.8 38.0 125-129 34.4144 38.0 36.4 38.0 25.6 38.0 130-134 33.31205 38.0 35.6 38.0 14.0 38.0 135-139 32.35785 38.0 34.8 38.0 4.2 38.0 140-144 31.410149999999998 38.0 34.0 38.0 2.0 38.0 145-149 30.944100000000002 38.0 33.0 38.0 2.0 38.0 150-151 27.355625 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 85.0 3 14.0 4 2.0 5 2.0 6 3.0 7 1.0 8 3.0 9 1.0 10 1.0 11 2.0 12 4.0 13 2.0 14 2.0 15 6.0 16 5.0 17 12.0 18 5.0 19 7.0 20 10.0 21 9.0 22 14.0 23 16.0 24 9.0 25 19.0 26 25.0 27 23.0 28 38.0 29 45.0 30 59.0 31 45.0 32 78.0 33 149.0 34 116.0 35 170.0 36 429.0 37 2589.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.4559585492228 21.917098445595855 14.32642487046632 24.300518134715027 2 27.842052313883297 27.062374245472835 28.470824949698187 16.624748490945674 3 22.10126582278481 29.34177215189873 28.607594936708864 19.949367088607595 4 24.06226078081143 33.50344475631539 24.138810921153357 18.295483541719825 5 25.634452704434764 34.47833888746475 22.25070494744937 17.636503460651117 6 22.477064220183486 36.64627930682977 22.426095820591232 18.450560652395513 7 20.499745028046913 22.36104028556859 37.04742478327384 20.09178990311066 8 23.014256619144604 24.770875763747455 25.94195519348269 26.272912423625254 9 22.45676500508647 25.81383519837233 27.568667344862664 24.160732451678534 10-14 23.847644299408525 28.56924332041607 25.657760554762387 21.92535182541301 15-19 24.266475497977368 27.328588253366785 27.169849966716164 21.23508628193968 20-24 24.02776360110238 27.860569562110847 26.86536694906604 21.24629988772073 25-29 23.460246360582307 28.372187722691645 27.196375852590858 20.971190064135193 30-34 24.063708528394056 28.38896804396499 26.959088133523306 20.588235294117645 35-39 24.434804797142128 27.15488645062516 27.047716254146465 21.362592498086247 40-44 24.183140428147084 27.96271637816245 26.46215302673359 21.39199016695688 45-49 24.09688013136289 26.924261083743843 27.509236453201968 21.469622331691298 50-54 24.102590250866815 27.304711401182953 27.31490923924128 21.27778910870895 55-59 24.20037749324083 27.582512880681527 27.715145640973322 20.50196398510432 60-64 24.355374010722493 27.61807505744192 27.32193004850651 20.704620883329078 65-69 24.16692143075512 27.54509324365638 27.346377254662187 20.941608070926325 70-74 24.157902758725804 27.536452776507648 27.72951277752375 20.5761316872428 75-79 24.022487844408428 27.31969205834684 28.064222042139384 20.593598055105346 80-84 24.169338014552487 27.497074238029818 27.40548516765888 20.928102579758814 85-89 24.415076875610634 27.52095438885175 27.145575152979895 20.91839358255772 90-94 24.19747964528341 27.303842763055542 27.82243426852668 20.676243323134365 95-99 24.44319861373019 27.46037408898629 27.56230569288008 20.534121604403445 100-104 24.379198046000408 27.69183798086709 27.111744351719924 20.817219621412576 105-109 24.301732925586137 27.80835881753313 27.110091743119263 20.779816513761467 110-114 24.277249974461128 27.142711206456227 27.510470936765756 21.069567882316885 115-119 24.728343657966896 27.866355235096986 26.647709962425104 20.757591144511018 120-124 24.859642911334785 27.96520155783724 26.87269232714582 20.302463203682162 125-129 25.737553779963125 27.750460971112478 26.710715017414465 19.80127023150994 130-134 25.90170850031639 27.209449483231385 27.135625395486183 19.75321662096604 135-139 25.325513827612184 28.440761863768426 26.09491014742279 20.1388141611966 140-144 26.227369107812752 27.575708149839613 26.743869950524658 19.453052791822977 145-149 25.646018630598387 28.303773485606023 26.4670280511552 19.583179832640386 150-151 26.16114960225815 28.496279189119832 25.622273543751607 19.72029766487041 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 36.0 1 26.0 2 10.5 3 4.0 4 3.0 5 2.5 6 1.5 7 1.0 8 0.5 9 0.0 10 1.0 11 2.5 12 1.5 13 0.5 14 0.5 15 0.5 16 2.0 17 1.5 18 1.0 19 2.0 20 1.0 21 1.0 22 1.5 23 2.0 24 2.0 25 2.5 26 3.5 27 3.0 28 3.0 29 5.0 30 7.5 31 13.0 32 16.5 33 18.0 34 30.0 35 44.0 36 65.5 37 86.0 38 106.5 39 137.5 40 167.5 41 197.5 42 227.0 43 263.0 44 289.5 45 272.5 46 268.5 47 281.0 48 255.0 49 218.5 50 187.5 51 158.0 52 125.0 53 106.5 54 93.0 55 66.0 56 46.0 57 35.5 58 27.5 59 25.5 60 21.0 61 10.5 62 6.5 63 6.5 64 4.5 65 2.5 66 3.0 67 2.0 68 0.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.5000000000000004 2 0.6 3 1.25 4 2.025 5 2.475 6 1.9 7 1.95 8 1.7999999999999998 9 1.7000000000000002 10-14 1.94 15-19 2.355 20-24 2.03 25-29 1.77 30-34 1.7399999999999998 35-39 2.025 40-44 2.37 45-49 2.56 50-54 1.94 55-59 1.9849999999999999 60-64 2.075 65-69 1.87 70-74 1.585 75-79 1.28 80-84 1.735 85-89 2.765 90-94 3.585 95-99 1.8950000000000002 100-104 1.7399999999999998 105-109 1.9 110-114 2.11 115-119 1.53 120-124 1.145 125-129 2.3800000000000003 130-134 5.18 135-139 7.07 140-144 8.035 145-149 4.995 150-151 2.5749999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13132345426673 97.0 2 0.6642820643842616 1.3 3 0.0 0.0 4 0.02554931016862545 0.1 5 0.07664793050587634 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0510986203372509 0.4 9 0.02554931016862545 0.22499999999999998 >10 0.02554931016862545 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.4375 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.9 0.0 0.0 0.0 0.0 110-111 3.275 0.0 0.0 0.0 0.0 112-113 3.7125000000000004 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.475 0.0 0.0 0.0 0.0 118-119 5.15 0.0 0.0 0.0 0.0 120-121 5.65 0.0 0.0 0.0 0.0 122-123 6.075 0.0 0.0 0.0 0.0 124-125 6.4875 0.0 0.0 0.0 0.0 126-127 6.875 0.0 0.0 0.0 0.0 128-129 7.3125 0.0 0.0 0.0 0.0 130-131 7.800000000000001 0.0 0.0 0.0 0.0 132-133 8.25 0.0 0.0 0.0 0.0 134-135 8.7625 0.0 0.0 0.0 0.0 136-137 9.4375 0.0 0.0 0.0 0.0 138-139 10.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740490 spots for SRR7169968.sra Written 740490 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra Read 740475 spots for SRR7169968.sra Written 740475 spots for SRR7169968.sra SRR ids: ['SRR7169968.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6vddldwb SRR7169968.sra spots: 14809515 blocks: [[1, 740475], [740476, 1480950], [1480951, 2221425], [2221426, 2961900], [2961901, 3702375], [3702376, 4442850], [4442851, 5183325], [5183326, 5923800], [5923801, 6664275], [6664276, 7404750], [7404751, 8145225], [8145226, 8885700], [8885701, 9626175], [9626176, 10366650], [10366651, 11107125], [11107126, 11847600], [11847601, 12588075], [12588076, 13328550], [13328551, 14069025], [14069026, 14809515]] SRR7169968 file size 4996758 SRR7169968 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169968 SRR7169968_1.fastq SRR7169968_2.fastq Input file: SRR7169968_1.fastq Paired file: SRR7169968_2.fastq trimmed: SRR7169968-trimmed-pair1.fastq, SRR7169968-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:51:56 2025 >> started Wed Feb 12 05:52:12 2025 >> done (16.342s) 14809515 read pairs processed; of these: 25480 ( 0.17%) short read pairs filtered out after trimming by size control 81708 ( 0.55%) empty read pairs filtered out after trimming by size control 14702327 (99.28%) read pairs available; of these: 7048204 (47.94%) trimmed read pairs available after processing 7654123 (52.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 7 0.00% 21 10 0.00% 22 8 0.00% 23 9 0.00% 24 13 0.00% 25 11 0.00% 26 13 0.00% 27 20 0.00% 28 18 0.00% 29 14 0.00% 30 19 0.00% 31 21 0.00% 32 29 0.00% 33 29 0.00% 34 29 0.00% 35 32 0.00% 36 29 0.00% 37 27 0.00% 38 36 0.00% 39 38 0.00% 40 50 0.00% 41 44 0.00% 42 54 0.00% 43 59 0.00% 44 60 0.00% 45 66 0.00% 46 85 0.00% 47 91 0.00% 48 123 0.00% 49 122 0.00% 50 131 0.00% 51 160 0.00% 52 167 0.00% 53 189 0.00% 54 189 0.00% 55 200 0.00% 56 197 0.00% 57 263 0.00% 58 307 0.00% 59 366 0.00% 60 406 0.00% 61 526 0.00% 62 520 0.00% 63 637 0.00% 64 627 0.00% 65 702 0.00% 66 784 0.01% 67 921 0.01% 68 924 0.01% 69 1223 0.01% 70 2039 0.01% 71 2120 0.01% 72 1977 0.01% 73 1954 0.01% 74 2107 0.01% 75 2343 0.02% 76 2462 0.02% 77 2788 0.02% 78 3025 0.02% 79 3210 0.02% 80 3588 0.02% 81 4252 0.03% 82 4821 0.03% 83 5587 0.04% 84 7181 0.05% 85 8382 0.06% 86 8683 0.06% 87 9331 0.06% 88 9820 0.07% 89 10349 0.07% 90 10872 0.07% 91 11753 0.08% 92 12850 0.09% 93 13916 0.09% 94 15167 0.10% 95 16029 0.11% 96 17171 0.12% 97 17618 0.12% 98 17917 0.12% 99 18788 0.13% 100 19631 0.13% 101 20899 0.14% 102 22447 0.15% 103 23872 0.16% 104 25160 0.17% 105 26536 0.18% 106 27885 0.19% 107 28356 0.19% 108 29022 0.20% 109 30080 0.20% 110 30689 0.21% 111 32512 0.22% 112 33205 0.23% 113 35629 0.24% 114 37344 0.25% 115 39052 0.27% 116 39959 0.27% 117 40838 0.28% 118 41378 0.28% 119 41774 0.28% 120 42803 0.29% 121 44043 0.30% 122 45734 0.31% 123 47335 0.32% 124 49975 0.34% 125 51902 0.35% 126 54066 0.37% 127 54979 0.37% 128 56058 0.38% 129 57132 0.39% 130 58262 0.40% 131 60160 0.41% 132 62136 0.42% 133 65447 0.45% 134 69142 0.47% 135 72471 0.49% 136 76016 0.52% 137 79002 0.54% 138 83662 0.57% 139 87642 0.60% 140 91772 0.62% 141 97796 0.67% 142 104550 0.71% 143 112986 0.77% 144 123632 0.84% 145 140591 0.96% 146 165032 1.12% 147 207450 1.41% 148 291433 1.98% 149 543965 3.70% 150 3066052 20.85% 151 7654123 52.06% 14702327 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=14.14 fanout-score-rank=15 prefix-density=0.40 prefix-fanout=6.4 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=219.06 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=19.21 fanout-score-rank=6 prefix-density=0.45 prefix-fanout=8.1 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=148.57 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169968 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:52:57 Started mapping on | Feb 12 05:52:57 Finished on | Feb 12 05:54:43 Mapping speed, Million of reads per hour | 499.32 Number of input reads | 14702327 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13605834 Uniquely mapped reads % | 92.54% Average mapped length | 291.02 Number of splices: Total | 11770692 Number of splices: Annotated (sjdb) | 11546813 Number of splices: GT/AG | 11598676 Number of splices: GC/AG | 133869 Number of splices: AT/AC | 9702 Number of splices: Non-canonical | 28445 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266802 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 43223 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.29% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 850370 850370 850370 N_multimapping 266802 266802 266802 N_noFeature 292516 13423005 382770 N_ambiguous 149533 948 56277 UnstrandedReadsAssigned:13163785 PositiveStrandReadsAssigned:181881 NegativeStrandReadsAssigned:13166787 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169968 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169968-trimmed-pair1.fastq SRR7169968-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,702,327 reads, 13,139,979 reads pseudoaligned [quant] estimated average fragment length: 222.508 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7169968.ke.tsv 34699 SRR7169968.se.tsv 87100 total ==> SRR7169968.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.49 254 10.3554 Potri.005G024800.1.v4.1 1035 813.492 37 3.33124 Potri.004G059700.1.v4.1 961 739.502 7 0.693292 Potri.007G009000.2.v4.1 1416 1194.49 0 0 Potri.003G141000.2.v4.1 2943 2721.49 208.032 5.59861 Potri.016G087400.1.v4.1 270 89.2315 1329 1090.85 Potri.015G069301.1.v4.1 564 345.844 0 0 Potri.010G195200.1.v4.1 1773 1551.49 34 1.60504 Potri.012G127500.1.v4.1 977 755.497 4039 391.56 ==> SRR7169968.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1791 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7169968 completed mapping pipeline successfully