Starting /dee2/code/volunteer_pipeline.sh SRR7169969 current disk space = 3049933836288 free memory = 1481114664 SRR7169969 SRAfilesize d9ae6372c5d818a3dbe44d5f377cbff0 SRR7169969.sra SRR7169969.sra file validated SRR7169969 is paired end SRR7169969 is conventional basespace SRR7169969 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169969_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78425 34.0 33.0 34.0 33.0 34.0 2 33.4005 34.0 34.0 34.0 33.0 34.0 3 33.51275 34.0 34.0 34.0 33.0 34.0 4 33.55275 34.0 34.0 34.0 33.0 34.0 5 33.41625 34.0 34.0 34.0 33.0 34.0 6 37.17725 38.0 38.0 38.0 36.0 38.0 7 37.4445 38.0 38.0 38.0 37.0 38.0 8 37.5435 38.0 38.0 38.0 38.0 38.0 9 37.66025 38.0 38.0 38.0 38.0 38.0 10-14 37.5763 38.0 38.0 38.0 38.0 38.0 15-19 37.549099999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.4726 38.0 38.0 38.0 38.0 38.0 25-29 37.372400000000006 38.0 38.0 38.0 37.6 38.0 30-34 37.341449999999995 38.0 38.0 38.0 37.2 38.0 35-39 37.2374 38.0 38.0 38.0 37.2 38.0 40-44 37.08059999999999 38.0 38.0 38.0 36.4 38.0 45-49 36.8866 38.0 38.0 38.0 36.0 38.0 50-54 36.92385 38.0 38.0 38.0 36.0 38.0 55-59 36.8005 38.0 38.0 38.0 35.4 38.0 60-64 36.8238 38.0 38.0 38.0 35.8 38.0 65-69 36.7521 38.0 38.0 38.0 35.2 38.0 70-74 36.633750000000006 38.0 38.0 38.0 34.8 38.0 75-79 36.3615 38.0 38.0 38.0 34.0 38.0 80-84 36.16074999999999 38.0 38.0 38.0 33.2 38.0 85-89 36.1141 38.0 38.0 38.0 33.4 38.0 90-94 35.9985 38.0 38.0 38.0 33.4 38.0 95-99 35.78465 38.0 37.6 38.0 32.6 38.0 100-104 35.5092 38.0 37.0 38.0 30.2 38.0 105-109 35.356500000000004 38.0 37.0 38.0 29.4 38.0 110-114 35.21995 38.0 37.0 38.0 28.6 38.0 115-119 34.9461 38.0 36.0 38.0 27.8 38.0 120-124 35.079600000000006 38.0 36.0 38.0 28.8 38.0 125-129 34.731899999999996 38.0 35.8 38.0 27.0 38.0 130-134 34.1347 38.0 35.0 38.0 23.2 38.0 135-139 33.43275 38.0 34.2 38.0 16.2 38.0 140-144 33.3376 38.0 34.4 38.0 17.4 38.0 145-149 32.666900000000005 38.0 33.6 38.0 11.4 38.0 150-151 28.232 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 2.0 9 3.0 10 2.0 11 4.0 12 1.0 13 0.0 14 3.0 15 2.0 16 9.0 17 4.0 18 10.0 19 10.0 20 18.0 21 7.0 22 15.0 23 15.0 24 19.0 25 23.0 26 15.0 27 36.0 28 38.0 29 43.0 30 46.0 31 53.0 32 92.0 33 111.0 34 138.0 35 258.0 36 661.0 37 2360.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.492712861160825 12.937867553055485 10.099718742009717 33.46970084377397 2 22.75 16.875 30.675 29.7 3 18.9 21.75 26.05 33.300000000000004 4 22.275 28.749999999999996 22.475 26.5 5 22.225 32.0 23.625 22.15 6 20.1 32.300000000000004 26.275 21.325 7 14.549999999999999 29.775000000000002 37.45 18.224999999999998 8 17.349999999999998 29.15 29.525000000000002 23.974999999999998 9 17.599999999999998 27.075 32.375 22.95 10-14 19.275000000000002 31.165 26.36 23.200000000000003 15-19 18.884999999999998 29.93 27.750000000000004 23.435 20-24 19.43 30.0 27.08 23.49 25-29 19.509999999999998 30.445 26.575 23.47 30-34 19.6 29.635 26.75 24.015 35-39 19.505 29.78 26.965 23.75 40-44 19.545 29.78 27.525 23.150000000000002 45-49 19.946981443505226 29.980493172610412 26.194167958785574 23.878357425098784 50-54 19.865 29.354999999999997 26.825 23.955000000000002 55-59 19.945 29.49 26.369999999999997 24.195 60-64 19.675 28.854999999999997 27.825 23.645 65-69 19.805 28.425 27.49 24.279999999999998 70-74 20.095 28.854999999999997 27.22 23.830000000000002 75-79 19.975 28.88 26.895000000000003 24.25 80-84 20.044999999999998 29.360000000000003 27.005000000000003 23.59 85-89 20.040030022516888 29.221916437327994 26.539904928696522 24.198148611458596 90-94 19.88048609018781 29.260821532590136 27.20196846439691 23.656723912825147 95-99 20.522350577599198 27.840281265695634 27.32295328980412 24.314414866901053 100-104 20.86856456696853 28.243358182818834 27.35778255866313 23.530294691549507 105-109 20.385 28.599999999999998 27.52 23.494999999999997 110-114 20.765 28.37 26.72 24.145 115-119 20.61 28.585 26.8 24.005000000000003 120-124 20.41 28.925 26.295 24.37 125-129 20.09801470220533 28.159223883582534 27.149072360854127 24.593689053358002 130-134 21.031567362049127 28.43563960178098 26.70468757816799 23.8281054580019 135-139 20.559622906428643 28.42242503259452 26.476782669742256 24.54116939123458 140-144 20.67240344206524 28.61717030218131 26.120672403442065 24.589753852311386 145-149 20.04703998398639 28.79947955762398 26.557573937847167 24.59590652054246 150-151 19.9375 28.5625 26.687499999999996 24.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.5 11 1.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 2.5 20 3.0 21 2.0 22 2.0 23 2.5 24 4.0 25 4.0 26 4.5 27 10.5 28 15.5 29 17.0 30 27.0 31 37.0 32 42.0 33 47.5 34 59.5 35 82.5 36 102.5 37 117.5 38 131.0 39 144.5 40 166.0 41 191.0 42 227.0 43 260.5 44 264.5 45 238.0 46 252.0 47 257.5 48 226.5 49 204.0 50 167.5 51 144.0 52 122.0 53 101.5 54 81.0 55 58.0 56 42.0 57 30.5 58 21.5 59 20.5 60 15.0 61 10.5 62 9.0 63 5.0 64 5.0 65 4.0 66 3.0 67 1.0 68 1.5 69 1.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.034999999999999996 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.075 90-94 0.43 95-99 0.44999999999999996 100-104 0.065 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.055 135-139 0.29 140-144 0.06 145-149 0.08499999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78296146044624 97.39999999999999 2 1.1663286004056794 2.3 3 0.02535496957403651 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02535496957403651 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.2249999999999996 0.0 0.0 0.0 0.0 114-115 3.6125 0.0 0.0 0.0 0.0 116-117 3.925 0.0 0.0 0.0 0.0 118-119 4.199999999999999 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.2875 0.0 0.0 0.0 0.0 124-125 5.6625 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.525 0.0 0.0 0.0 0.0 130-131 6.9625 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 7.862500000000001 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169969 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169969_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65025 33.0 33.0 34.0 31.0 34.0 2 31.9605 34.0 33.0 34.0 31.0 34.0 3 31.96175 34.0 33.0 34.0 31.0 34.0 4 31.702 34.0 33.0 34.0 31.0 34.0 5 31.6515 34.0 33.0 34.0 31.0 34.0 6 35.68225 38.0 38.0 38.0 34.0 38.0 7 35.68425 38.0 38.0 38.0 34.0 38.0 8 35.76925 38.0 38.0 38.0 34.0 38.0 9 35.76225 38.0 38.0 38.0 35.0 38.0 10-14 35.688700000000004 38.0 38.0 38.0 34.4 38.0 15-19 35.57485 38.0 38.0 38.0 34.0 38.0 20-24 35.582800000000006 38.0 38.0 38.0 34.0 38.0 25-29 35.67425 38.0 38.0 38.0 34.6 38.0 30-34 35.729 38.0 38.0 38.0 35.0 38.0 35-39 35.623799999999996 38.0 38.0 38.0 34.4 38.0 40-44 35.528200000000005 38.0 38.0 38.0 34.4 38.0 45-49 35.4082 38.0 38.0 38.0 33.2 38.0 50-54 35.5741 38.0 38.0 38.0 34.0 38.0 55-59 35.4847 38.0 38.0 38.0 33.6 38.0 60-64 35.47775 38.0 38.0 38.0 34.0 38.0 65-69 35.45635 38.0 38.0 38.0 33.8 38.0 70-74 35.38945 38.0 38.0 38.0 33.6 38.0 75-79 35.25635 38.0 38.0 38.0 33.0 38.0 80-84 35.1823 38.0 38.0 38.0 31.8 38.0 85-89 34.883 38.0 38.0 38.0 29.4 38.0 90-94 34.59115 38.0 38.0 38.0 27.4 38.0 95-99 34.8357 38.0 38.0 38.0 28.4 38.0 100-104 34.887499999999996 38.0 38.0 38.0 29.2 38.0 105-109 34.8145 38.0 38.0 38.0 28.6 38.0 110-114 34.68435 38.0 38.0 38.0 28.0 38.0 115-119 34.40215 38.0 37.0 38.0 25.8 38.0 120-124 34.17345 38.0 36.8 38.0 22.6 38.0 125-129 33.74165000000001 38.0 36.2 38.0 18.2 38.0 130-134 32.6922 38.0 35.0 38.0 8.6 38.0 135-139 31.821649999999998 38.0 34.0 38.0 2.0 38.0 140-144 31.07175 38.0 33.6 38.0 2.0 38.0 145-149 30.4132 38.0 32.2 38.0 2.0 38.0 150-151 26.888375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 142.0 3 11.0 4 6.0 5 6.0 6 3.0 7 2.0 8 2.0 9 2.0 10 4.0 11 2.0 12 6.0 13 1.0 14 6.0 15 6.0 16 11.0 17 20.0 18 7.0 19 9.0 20 12.0 21 8.0 22 20.0 23 5.0 24 18.0 25 19.0 26 14.0 27 26.0 28 21.0 29 39.0 30 45.0 31 67.0 32 106.0 33 115.0 34 137.0 35 144.0 36 408.0 37 2550.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.29503105590062 20.39337474120083 16.097308488612835 23.214285714285715 2 26.884996191926884 27.95125666412795 26.453414572226453 18.71033257171871 3 22.137014314928425 30.62372188139059 28.55316973415133 18.686094069529652 4 25.27103768714507 33.402168301497156 22.431595250387197 18.895198760970572 5 23.985525975704316 35.22874127681572 23.365210648746444 17.420522098733525 6 22.04439855446567 35.41559112028911 24.057821373257614 18.48218895198761 7 21.76485721636223 22.61384100848984 35.605865706200156 20.015436068947775 8 22.202212503215847 25.418060200668897 27.347568819140726 25.03215847697453 9 22.960492560287328 25.269368907131863 29.502308876346845 22.267829656233967 10-14 24.25632829819044 28.81373408259009 26.004021240398 20.92591637882147 15-19 23.49326034188917 28.31689304343335 27.02577079997934 21.164075814698137 20-24 24.43688469666512 28.40575228081027 26.307922272047833 20.84944075047678 25-29 25.030819806862542 27.470721183480585 26.859461680706804 20.63899732895007 30-34 23.986451811557018 28.476855178076566 26.850046187006054 20.68664682336036 35-39 23.824967824967825 27.876447876447873 27.232947232947236 21.065637065637066 40-44 24.159653018020343 27.748231527856664 27.299013786337582 20.793101667785407 45-49 23.57618629627717 27.44875303351061 27.48489698972479 21.490163680487427 50-54 23.18139726309291 28.197345405905956 27.168432966354562 21.45282436464657 55-59 24.362271137626003 27.041760954536105 27.62291709524789 20.973050812590003 60-64 23.917408990268267 27.835847793625458 28.283816487307554 19.96292672879872 65-69 24.203985209531634 27.465078060805258 27.8759244042728 20.455012325390303 70-74 24.273880139087748 27.377786868480264 27.526078952751078 20.822254039680914 75-79 23.558307322314896 27.6160261986389 27.91792457657473 20.907741902471475 80-84 23.929961089494164 27.411427401187794 27.49334425558059 21.165267253737458 85-89 24.371663989221123 27.636420168938177 27.58978079494222 20.402135046898483 90-94 24.265165728580364 26.938711694809253 28.267667292057535 20.528455284552845 95-99 24.334190231362467 27.203084832904885 27.92287917737789 20.539845758354755 100-104 25.002564365575957 27.23356241665812 27.74643553184942 20.0174376859165 105-109 24.73924883111545 26.82012022812516 28.263885320865235 20.176745619894156 110-114 24.7607778578043 27.492540384813253 27.590287066570635 20.156394690811812 115-119 24.82860943415533 27.182032129335926 27.913639619359458 20.075718817149287 120-124 24.79473711051048 27.50267734203682 27.844357182926206 19.858228364526493 125-129 24.86450214215661 27.651886646363494 27.89449233469261 19.589118876787282 130-134 25.624074465834568 27.385233763486355 27.533319229955573 19.4573725407235 135-139 25.356508636926222 27.256094279718024 28.117096270785126 19.27030081257063 140-144 25.772858622757756 27.58846300637915 27.021427403085983 19.61725096777711 145-149 24.945804473113732 27.827420292920213 27.578913974514883 19.647861259451172 150-151 25.846471956577926 26.9320237787542 27.95295942103903 19.268544843628845 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 72.0 1 40.0 2 7.5 3 5.0 4 1.5 5 1.0 6 2.5 7 3.0 8 2.0 9 0.5 10 1.5 11 2.0 12 1.5 13 2.0 14 1.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 2.5 26 1.5 27 2.0 28 5.0 29 7.0 30 11.5 31 17.0 32 22.0 33 24.5 34 31.5 35 47.5 36 63.0 37 82.5 38 109.5 39 133.5 40 172.5 41 213.0 42 235.5 43 256.0 44 278.0 45 287.0 46 293.0 47 276.5 48 243.5 49 210.0 50 178.5 51 150.5 52 114.5 53 100.0 54 82.5 55 57.5 56 39.0 57 33.5 58 30.0 59 19.5 60 12.5 61 6.5 62 4.0 63 5.5 64 5.0 65 4.0 66 4.0 67 3.0 68 3.0 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.4000000000000004 2 1.525 3 2.1999999999999997 4 3.15 5 3.2750000000000004 6 3.15 7 2.825 8 2.825 9 2.55 10-14 3.015 15-19 3.1850000000000005 20-24 2.995 25-29 2.6599999999999997 30-34 2.5700000000000003 35-39 2.875 40-44 3.1649999999999996 45-49 3.1649999999999996 50-54 2.81 55-59 2.78 60-64 2.895 65-69 2.64 70-74 2.22 75-79 2.2849999999999997 80-84 2.34 85-89 3.515 90-94 4.06 95-99 2.75 100-104 2.5100000000000002 105-109 2.685 110-114 2.81 115-119 2.27 120-124 1.955 125-129 3.1350000000000002 130-134 5.46 135-139 7.085 140-144 8.295 145-149 5.4350000000000005 150-151 3.2750000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83600620796689 95.525 2 0.9829280910501811 1.9 3 0.02586652871184687 0.075 4 0.02586652871184687 0.1 5 0.0 0.0 6 0.02586652871184687 0.15 7 0.0 0.0 8 0.02586652871184687 0.2 9 0.0 0.0 >10 0.05173305742369374 0.525 >50 0.02586652871184687 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 61 1.525 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 11 0.27499999999999997 Illumina Single End PCR Primer 1 (100% over 50bp) NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.95 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.6625 0.0 0.0 0.0 0.0 116-117 3.95 0.0 0.0 0.0 0.0 118-119 4.199999999999999 0.0 0.0 0.0 0.0 120-121 4.7 0.0 0.0 0.0 0.0 122-123 5.199999999999999 0.0 0.0 0.0 0.0 124-125 5.6125 0.0 0.0 0.0 0.0 126-127 5.9125 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 6.7375 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 7.7 0.0 0.0 0.0 0.0 136-137 8.05 0.0 0.0 0.0 0.0 138-139 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658701 spots for SRR7169969.sra Written 658701 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra Read 658684 spots for SRR7169969.sra Written 658684 spots for SRR7169969.sra SRR ids: ['SRR7169969.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ubjg5um SRR7169969.sra spots: 13173697 blocks: [[1, 658684], [658685, 1317368], [1317369, 1976052], [1976053, 2634736], [2634737, 3293420], [3293421, 3952104], [3952105, 4610788], [4610789, 5269472], [5269473, 5928156], [5928157, 6586840], [6586841, 7245524], [7245525, 7904208], [7904209, 8562892], [8562893, 9221576], [9221577, 9880260], [9880261, 10538944], [10538945, 11197628], [11197629, 11856312], [11856313, 12514996], [12514997, 13173697]] SRR7169969 file size 4442433 SRR7169969 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169969 SRR7169969_1.fastq SRR7169969_2.fastq Input file: SRR7169969_1.fastq Paired file: SRR7169969_2.fastq trimmed: SRR7169969-trimmed-pair1.fastq, SRR7169969-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:03:37 2025 >> started Wed Feb 12 06:03:51 2025 >> done (13.721s) 13173697 read pairs processed; of these: 46502 ( 0.35%) short read pairs filtered out after trimming by size control 91903 ( 0.70%) empty read pairs filtered out after trimming by size control 13035292 (98.95%) read pairs available; of these: 6460437 (49.56%) trimmed read pairs available after processing 6574855 (50.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 7 0.00% 22 6 0.00% 23 13 0.00% 24 10 0.00% 25 13 0.00% 26 17 0.00% 27 14 0.00% 28 19 0.00% 29 13 0.00% 30 16 0.00% 31 13 0.00% 32 20 0.00% 33 25 0.00% 34 32 0.00% 35 31 0.00% 36 28 0.00% 37 31 0.00% 38 37 0.00% 39 35 0.00% 40 32 0.00% 41 50 0.00% 42 49 0.00% 43 108 0.00% 44 63 0.00% 45 77 0.00% 46 75 0.00% 47 86 0.00% 48 117 0.00% 49 114 0.00% 50 113 0.00% 51 133 0.00% 52 158 0.00% 53 233 0.00% 54 198 0.00% 55 211 0.00% 56 250 0.00% 57 235 0.00% 58 303 0.00% 59 328 0.00% 60 309 0.00% 61 398 0.00% 62 480 0.00% 63 517 0.00% 64 607 0.00% 65 656 0.01% 66 847 0.01% 67 1071 0.01% 68 1266 0.01% 69 1327 0.01% 70 2015 0.02% 71 1948 0.01% 72 1789 0.01% 73 1853 0.01% 74 1973 0.02% 75 2248 0.02% 76 2394 0.02% 77 2556 0.02% 78 2812 0.02% 79 3251 0.02% 80 3627 0.03% 81 4129 0.03% 82 4520 0.03% 83 5182 0.04% 84 7478 0.06% 85 9346 0.07% 86 9527 0.07% 87 9932 0.08% 88 10327 0.08% 89 10697 0.08% 90 11282 0.09% 91 11718 0.09% 92 12501 0.10% 93 13539 0.10% 94 14201 0.11% 95 15175 0.12% 96 15876 0.12% 97 16647 0.13% 98 17212 0.13% 99 17696 0.14% 100 18672 0.14% 101 19432 0.15% 102 20890 0.16% 103 21661 0.17% 104 23111 0.18% 105 24343 0.19% 106 25336 0.19% 107 25997 0.20% 108 26582 0.20% 109 27712 0.21% 110 28132 0.22% 111 29177 0.22% 112 30386 0.23% 113 32033 0.25% 114 33206 0.25% 115 34722 0.27% 116 35510 0.27% 117 36205 0.28% 118 36882 0.28% 119 37230 0.29% 120 38724 0.30% 121 39618 0.30% 122 40666 0.31% 123 41979 0.32% 124 44230 0.34% 125 45594 0.35% 126 47208 0.36% 127 49117 0.38% 128 49847 0.38% 129 51320 0.39% 130 52526 0.40% 131 53693 0.41% 132 56268 0.43% 133 58296 0.45% 134 61220 0.47% 135 64296 0.49% 136 67129 0.51% 137 70752 0.54% 138 75957 0.58% 139 80836 0.62% 140 84356 0.65% 141 89222 0.68% 142 95465 0.73% 143 104071 0.80% 144 114699 0.88% 145 130070 1.00% 146 156142 1.20% 147 198873 1.53% 148 275268 2.11% 149 510751 3.92% 150 2790764 21.41% 151 6574855 50.44% 13035292 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=47.05 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.68 fanout-score-rank=23 prefix-density=0.29 prefix-fanout=4.6 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=147.38 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.0 sequence=GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCC SRR7169969 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:04:34 Started mapping on | Feb 12 06:04:34 Finished on | Feb 12 06:05:50 Mapping speed, Million of reads per hour | 617.46 Number of input reads | 13035292 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12078032 Uniquely mapped reads % | 92.66% Average mapped length | 290.41 Number of splices: Total | 10446161 Number of splices: Annotated (sjdb) | 10252870 Number of splices: GT/AG | 10289631 Number of splices: GC/AG | 123343 Number of splices: AT/AC | 8949 Number of splices: Non-canonical | 24238 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 241590 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 36270 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 752167 752167 752167 N_multimapping 241590 241590 241590 N_noFeature 253640 11909747 326137 N_ambiguous 143928 705 47714 UnstrandedReadsAssigned:11680464 PositiveStrandReadsAssigned:167580 NegativeStrandReadsAssigned:11704181 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169969 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169969-trimmed-pair1.fastq SRR7169969-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,035,292 reads, 11,678,802 reads pseudoaligned [quant] estimated average fragment length: 223.408 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR7169969.ke.tsv 34699 SRR7169969.se.tsv 87100 total ==> SRR7169969.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.59 145 5.93174 Potri.005G024800.1.v4.1 1035 812.592 33 2.98307 Potri.004G059700.1.v4.1 961 738.604 13 1.29287 Potri.007G009000.2.v4.1 1416 1193.59 0 0 Potri.003G141000.2.v4.1 2943 2720.59 212 5.72393 Potri.016G087400.1.v4.1 270 88.7891 1536.15 1270.86 Potri.015G069301.1.v4.1 564 344.657 0 0 Potri.010G195200.1.v4.1 1773 1550.59 13 0.61584 Potri.012G127500.1.v4.1 977 754.604 3700 360.168 ==> SRR7169969.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 647 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169969 completed mapping pipeline successfully