Starting /dee2/code/volunteer_pipeline.sh SRR7169970 current disk space = 3050275639296 free memory = 1577882548 SRR7169970 SRAfilesize 168f189d03f076df5d8f864ae0948080 SRR7169970.sra SRR7169970.sra file validated SRR7169970 is paired end SRR7169970 is conventional basespace SRR7169970 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169970_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.50425 34.0 34.0 34.0 33.0 34.0 2 33.62025 34.0 34.0 34.0 33.0 34.0 3 33.69825 34.0 34.0 34.0 33.0 34.0 4 33.68875 34.0 34.0 34.0 33.0 34.0 5 33.69925 34.0 34.0 34.0 33.0 34.0 6 37.235 38.0 38.0 38.0 36.0 38.0 7 37.49725 38.0 38.0 38.0 37.0 38.0 8 37.587 38.0 38.0 38.0 38.0 38.0 9 37.5665 38.0 38.0 38.0 38.0 38.0 10-14 37.6077 38.0 38.0 38.0 38.0 38.0 15-19 37.58985 38.0 38.0 38.0 38.0 38.0 20-24 37.5405 38.0 38.0 38.0 38.0 38.0 25-29 37.47515 38.0 38.0 38.0 37.8 38.0 30-34 37.422450000000005 38.0 38.0 38.0 37.6 38.0 35-39 37.25575 38.0 38.0 38.0 36.6 38.0 40-44 36.87949999999999 38.0 38.0 38.0 35.4 38.0 45-49 36.776149999999994 38.0 38.0 38.0 35.0 38.0 50-54 36.684749999999994 38.0 38.0 38.0 34.8 38.0 55-59 36.66665 38.0 38.0 38.0 34.4 38.0 60-64 36.66925 38.0 38.0 38.0 34.2 38.0 65-69 36.455 38.0 38.0 38.0 34.0 38.0 70-74 36.272749999999995 38.0 38.0 38.0 33.6 38.0 75-79 35.7365 38.0 37.0 38.0 32.8 38.0 80-84 35.505050000000004 38.0 37.0 38.0 31.0 38.0 85-89 35.335249999999995 38.0 37.0 38.0 30.2 38.0 90-94 35.0595 38.0 36.6 38.0 29.0 38.0 95-99 35.000150000000005 38.0 36.0 38.0 28.8 38.0 100-104 34.8669 38.0 36.0 38.0 28.4 38.0 105-109 34.595 38.0 35.8 38.0 26.8 38.0 110-114 34.21640000000001 38.0 35.0 38.0 24.2 38.0 115-119 33.935 38.0 34.6 38.0 22.2 38.0 120-124 33.52335000000001 38.0 34.0 38.0 15.0 38.0 125-129 33.245050000000006 38.0 34.0 38.0 15.0 38.0 130-134 32.888250000000006 38.0 33.8 38.0 15.0 38.0 135-139 32.00075 37.4 31.8 38.0 14.2 38.0 140-144 31.2635 36.0 31.0 38.0 13.2 38.0 145-149 30.22675 36.0 29.6 38.0 4.2 38.0 150-151 25.57075 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 2.0 11 1.0 12 3.0 13 5.0 14 5.0 15 8.0 16 8.0 17 10.0 18 25.0 19 39.0 20 13.0 21 13.0 22 14.0 23 11.0 24 11.0 25 26.0 26 21.0 27 33.0 28 44.0 29 49.0 30 46.0 31 79.0 32 89.0 33 153.0 34 219.0 35 421.0 36 1098.0 37 1551.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.04524886877828 15.837104072398189 10.960281548516843 33.15736551030668 2 23.225 16.35 31.175000000000004 29.25 3 18.6 20.275000000000002 28.225 32.9 4 20.75 28.375 23.325000000000003 27.55 5 22.225 31.75 24.3 21.725 6 20.724999999999998 34.050000000000004 25.7 19.525000000000002 7 15.45 31.05 36.425000000000004 17.075000000000003 8 16.950000000000003 30.099999999999998 29.525000000000002 23.425 9 17.5 28.425 32.9 21.175 10-14 18.875 31.424999999999997 27.08 22.62 15-19 18.565 30.354999999999997 27.455000000000002 23.625 20-24 18.790000000000003 30.740000000000002 27.415 23.055 25-29 18.525 30.94 27.61 22.925 30-34 18.529999999999998 31.22 27.0 23.25 35-39 18.845 31.455 26.965 22.735 40-44 18.404999999999998 30.620000000000005 27.76 23.215 45-49 18.93 30.855 27.54 22.675 50-54 19.255 29.68 26.974999999999998 24.09 55-59 19.3 29.705 27.62 23.375 60-64 19.465 29.86 28.065 22.61 65-69 19.25 31.405 26.075 23.27 70-74 19.27 31.715 26.290000000000003 22.725 75-79 18.77 31.525 26.465 23.24 80-84 19.075 30.56 26.490000000000002 23.875 85-89 19.900000000000002 29.145 27.474999999999998 23.48 90-94 19.037604526563516 30.43412948775725 26.763807520905313 23.76445846477392 95-99 19.513294276701217 29.572880676981622 27.13935206048771 23.774472985829455 100-104 19.475 30.490000000000002 26.595000000000002 23.44 105-109 19.84 30.305 26.279999999999998 23.575 110-114 19.46 30.445 26.740000000000002 23.355 115-119 19.84099204960248 30.516525826291314 26.03130156507825 23.611180559027954 120-124 19.794948737184296 30.117529382345587 26.261565391347837 23.82595648912228 125-129 19.935 29.854999999999997 26.35 23.86 130-134 19.805893241282703 30.28165491020061 26.324478463154733 23.58797338536195 135-139 20.19509754877439 29.34467233616808 26.843421710855424 23.6168084042021 140-144 20.56631147130922 30.311671419280607 25.80419230576817 23.317824803642004 145-149 20.576461168935147 29.78382706164932 25.52542033626902 24.11429143314652 150-151 19.717429357339338 29.694923730932732 27.056764191047762 23.53088272068017 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 2.5 18 2.5 19 3.5 20 2.5 21 1.5 22 1.5 23 2.0 24 3.5 25 6.5 26 13.0 27 16.0 28 20.0 29 26.0 30 29.5 31 38.0 32 58.5 33 86.5 34 105.0 35 111.0 36 123.5 37 154.5 38 175.0 39 168.0 40 203.0 41 226.5 42 234.0 43 253.5 44 235.0 45 228.0 46 211.0 47 194.5 48 179.0 49 153.5 50 140.0 51 117.5 52 94.0 53 84.5 54 72.5 55 53.0 56 42.5 57 37.5 58 26.0 59 12.0 60 8.0 61 10.5 62 11.5 63 7.0 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.145 95-99 0.145 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.025 125-129 0.0 130-134 0.055 135-139 0.05 140-144 0.055 145-149 0.08 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2161323681489 94.975 2 1.6804550155118927 3.25 3 0.0517063081695967 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02585315408479835 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.02585315408479835 1.425 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTATAATATCTCGTATGC 57 1.425 TruSeq Adapter, Index 9 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTATAATATCTCGTATGCC 8 0.2 TruSeq Adapter, Index 9 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.2875 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 3.975 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.7625 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.637499999999999 0.0 0.0 0.0 0.0 126-127 6.2125 0.0 0.0 0.0 0.0 128-129 6.675 0.0 0.0 0.0 0.0 130-131 7.0375 0.0 0.0 0.0 0.0 132-133 7.5 0.0 0.0 0.0 0.0 134-135 8.3 0.0 0.0 0.0 0.0 136-137 9.05 0.0 0.0 0.0 0.0 138-139 9.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACATGT 10 0.0068519996 144.85 6 >>END_MODULE SRR7169970 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169970_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.051 34.0 33.0 34.0 33.0 34.0 2 33.12575 34.0 33.0 34.0 33.0 34.0 3 33.061 34.0 33.0 34.0 33.0 34.0 4 32.89175 34.0 33.0 34.0 33.0 34.0 5 32.9815 34.0 33.0 34.0 33.0 34.0 6 37.15025 38.0 38.0 38.0 38.0 38.0 7 37.23775 38.0 38.0 38.0 38.0 38.0 8 37.20175 38.0 38.0 38.0 38.0 38.0 9 37.1235 38.0 38.0 38.0 38.0 38.0 10-14 37.03645 38.0 38.0 38.0 38.0 38.0 15-19 36.9343 38.0 38.0 38.0 38.0 38.0 20-24 37.012449999999994 38.0 38.0 38.0 38.0 38.0 25-29 36.9802 38.0 38.0 38.0 38.0 38.0 30-34 36.96615 38.0 38.0 38.0 38.0 38.0 35-39 36.887 38.0 38.0 38.0 38.0 38.0 40-44 36.76875 38.0 38.0 38.0 37.8 38.0 45-49 36.722100000000005 38.0 38.0 38.0 37.0 38.0 50-54 36.853300000000004 38.0 38.0 38.0 37.4 38.0 55-59 36.871449999999996 38.0 38.0 38.0 37.0 38.0 60-64 36.8156 38.0 38.0 38.0 37.0 38.0 65-69 36.644349999999996 38.0 38.0 38.0 36.8 38.0 70-74 36.22975 38.0 38.0 38.0 36.4 38.0 75-79 36.1114 38.0 38.0 38.0 36.0 38.0 80-84 35.980450000000005 38.0 38.0 38.0 35.8 38.0 85-89 35.74285 38.0 38.0 38.0 35.0 38.0 90-94 35.60795 38.0 38.0 38.0 34.2 38.0 95-99 35.751 38.0 38.0 38.0 34.0 38.0 100-104 35.746300000000005 38.0 38.0 38.0 34.2 38.0 105-109 35.5912 38.0 38.0 38.0 33.8 38.0 110-114 35.4364 38.0 38.0 38.0 33.4 38.0 115-119 35.30120000000001 38.0 38.0 38.0 32.2 38.0 120-124 35.12195 38.0 38.0 38.0 31.2 38.0 125-129 34.779399999999995 38.0 37.0 38.0 29.6 38.0 130-134 33.93465 38.0 36.0 38.0 19.8 38.0 135-139 33.06654999999999 38.0 35.2 38.0 13.8 38.0 140-144 32.4669 38.0 33.8 38.0 6.4 38.0 145-149 31.998 38.0 33.0 38.0 2.0 38.0 150-151 27.881 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 15.0 4 6.0 5 0.0 6 2.0 7 1.0 8 0.0 9 3.0 10 0.0 11 5.0 12 5.0 13 6.0 14 2.0 15 9.0 16 10.0 17 32.0 18 27.0 19 5.0 20 6.0 21 7.0 22 4.0 23 11.0 24 12.0 25 10.0 26 13.0 27 18.0 28 24.0 29 24.0 30 32.0 31 45.0 32 66.0 33 103.0 34 105.0 35 189.0 36 409.0 37 2761.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.00250626566416 22.706766917293233 13.283208020050125 23.007518796992482 2 27.769423558897245 30.401002506265662 25.563909774436087 16.265664160401002 3 22.023659702995218 30.002516989680345 29.27258998238107 18.701233324943367 4 25.46693589096416 33.08934881373044 22.71580010095911 18.727915194346288 5 26.490566037735846 35.0188679245283 21.48427672955975 17.0062893081761 6 23.80593262946204 35.570638511814984 22.574157868275517 18.04927099044746 7 20.567553992968357 24.334505273731793 35.05775991963837 20.040180813661475 8 23.17930688096434 26.971371170266195 26.544450025113008 23.304871923656453 9 23.353443941679235 26.018099547511316 28.104575163398692 22.52388134741076 10-14 25.34146464391916 28.088302000907213 25.729549921878935 20.840683433294693 15-19 25.021448397678526 27.766843300529903 27.030027756749934 20.181680545041637 20-24 25.304724488768006 28.2512340082603 26.412813538833486 20.03122796413821 25-29 24.879081015719468 28.783756549778317 26.219266424828696 20.11789600967352 30-34 24.96095914563498 28.411666918543148 26.663644148909377 19.9637297869125 35-39 23.831634198041787 27.732916119915213 27.091955183203797 21.343494498839206 40-44 25.24792552114957 27.80307630034406 27.413479052823313 19.53551912568306 45-49 24.46028616209111 28.15106931594115 26.437130289701198 20.951514232266547 50-54 24.216466794316236 28.192079008364406 27.305250428297896 20.286203769021466 55-59 24.09590007051476 28.04472650347537 27.747557167321446 20.111816258688425 60-64 23.843398415821603 29.01468139851672 27.480954543161296 19.66096564250038 65-69 23.435768261964736 29.0176322418136 27.506297229219147 20.04030226700252 70-74 23.795649771437184 29.28115738182549 27.673682624202538 19.249510222534788 75-79 23.313900894562266 28.781787114282842 27.841994170268368 20.06231782088652 80-84 23.898356357769487 28.45114449934456 27.609155994756478 20.041343148129474 85-89 24.43947328283085 28.333926483298594 27.845848797600286 19.380751436270273 90-94 24.217161447742985 28.126270841805614 27.958519723464825 19.69804798698658 95-99 23.856998992950654 28.3484390735146 28.197381671701915 19.59718026183283 100-104 24.0410752038659 28.17376422027585 27.88180811436625 19.903352461492 105-109 23.931322692714367 28.014702180152057 28.38225668395348 19.671718443180104 110-114 23.795590980174545 28.830146799172677 27.7102355849266 19.664026635726177 115-119 24.60269563468115 28.70649768658218 27.831422249044458 18.859384429692213 120-124 24.186910258984142 28.543465167637024 28.322625978719135 18.946998594659707 125-129 24.55909183052909 29.03912426515305 27.706263936752485 18.695519967565378 130-134 25.01802080115333 28.82298424467099 27.52548656163114 18.633508392544538 135-139 24.37395659432387 28.192821368948245 28.500626043405674 18.932595993322206 140-144 25.618922470433642 28.052562417871226 27.952693823915904 18.37582128777924 145-149 24.85424976986806 28.61307149432341 27.631175207118748 18.90150352868978 150-151 25.22750252780586 28.70323559150657 27.692113245702732 18.377148634984835 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.5 2 3.5 3 4.5 4 2.5 5 1.0 6 1.0 7 1.0 8 1.5 9 1.5 10 2.0 11 1.5 12 1.5 13 3.0 14 1.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 2.5 26 1.5 27 1.5 28 5.0 29 10.5 30 14.5 31 16.5 32 17.5 33 24.0 34 39.0 35 50.5 36 64.0 37 98.0 38 126.0 39 159.0 40 189.0 41 216.0 42 261.5 43 287.5 44 298.5 45 319.0 46 298.0 47 249.0 48 214.0 49 183.0 50 167.5 51 144.5 52 113.5 53 91.5 54 81.5 55 65.5 56 48.0 57 36.0 58 21.0 59 14.5 60 8.5 61 4.5 62 6.0 63 4.5 64 2.0 65 0.5 66 0.5 67 0.5 68 0.5 69 1.0 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.25 3 0.675 4 0.95 5 0.625 6 0.5499999999999999 7 0.44999999999999996 8 0.44999999999999996 9 0.5499999999999999 10-14 0.795 15-19 0.9249999999999999 20-24 0.73 25-29 0.76 30-34 0.745 35-39 0.9299999999999999 40-44 1.18 45-49 1.105 50-54 0.77 55-59 0.73 60-64 0.895 65-69 0.75 70-74 0.46499999999999997 75-79 0.51 80-84 0.83 85-89 1.6549999999999998 90-94 1.6400000000000001 95-99 0.7000000000000001 100-104 0.67 105-109 0.695 110-114 0.885 115-119 0.58 120-124 0.38 125-129 1.34 130-134 2.8899999999999997 135-139 4.16 140-144 4.875 145-149 2.23 150-151 1.0999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16062176165804 94.72500000000001 2 1.5803108808290156 3.05 3 0.18134715025906736 0.525 4 0.0 0.0 5 0.025906735751295335 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025906735751295335 0.25 >50 0.025906735751295335 1.325 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 53 1.325 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.23750000000000002 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.35 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.3125 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.975 0.0 0.0 0.0 0.0 122-123 5.3875 0.0 0.0 0.0 0.0 124-125 5.9 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 6.824999999999999 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.6625 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.1875 0.0 0.0 0.0 0.0 138-139 9.712499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCG 40 0.005958363 53.56804 6 AAAAAAA 270 0.0015576977 6.3488045 65-69 >>END_MODULE Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489017 spots for SRR7169970.sra Written 489017 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra Read 489011 spots for SRR7169970.sra Written 489011 spots for SRR7169970.sra SRR ids: ['SRR7169970.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ylozjotv SRR7169970.sra spots: 9780226 blocks: [[1, 489011], [489012, 978022], [978023, 1467033], [1467034, 1956044], [1956045, 2445055], [2445056, 2934066], [2934067, 3423077], [3423078, 3912088], [3912089, 4401099], [4401100, 4890110], [4890111, 5379121], [5379122, 5868132], [5868133, 6357143], [6357144, 6846154], [6846155, 7335165], [7335166, 7824176], [7824177, 8313187], [8313188, 8802198], [8802199, 9291209], [9291210, 9780226]] SRR7169970 file size 3292926 SRR7169970 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169970 SRR7169970_1.fastq SRR7169970_2.fastq Input file: SRR7169970_1.fastq Paired file: SRR7169970_2.fastq trimmed: SRR7169970-trimmed-pair1.fastq, SRR7169970-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:45:20 2025 >> started Wed Feb 12 06:45:31 2025 >> done (10.985s) 9780226 read pairs processed; of these: 32270 ( 0.33%) short read pairs filtered out after trimming by size control 146883 ( 1.50%) empty read pairs filtered out after trimming by size control 9601073 (98.17%) read pairs available; of these: 5792110 (60.33%) trimmed read pairs available after processing 3808963 (39.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 8 0.00% 21 9 0.00% 22 10 0.00% 23 15 0.00% 24 12 0.00% 25 13 0.00% 26 12 0.00% 27 19 0.00% 28 29 0.00% 29 27 0.00% 30 26 0.00% 31 38 0.00% 32 36 0.00% 33 29 0.00% 34 33 0.00% 35 41 0.00% 36 37 0.00% 37 57 0.00% 38 62 0.00% 39 59 0.00% 40 60 0.00% 41 57 0.00% 42 85 0.00% 43 94 0.00% 44 93 0.00% 45 144 0.00% 46 131 0.00% 47 120 0.00% 48 136 0.00% 49 166 0.00% 50 190 0.00% 51 215 0.00% 52 232 0.00% 53 254 0.00% 54 251 0.00% 55 266 0.00% 56 282 0.00% 57 287 0.00% 58 366 0.00% 59 348 0.00% 60 399 0.00% 61 465 0.00% 62 513 0.01% 63 597 0.01% 64 580 0.01% 65 767 0.01% 66 1198 0.01% 67 1536 0.02% 68 1906 0.02% 69 3397 0.04% 70 9472 0.10% 71 8531 0.09% 72 5377 0.06% 73 3546 0.04% 74 2953 0.03% 75 2839 0.03% 76 2809 0.03% 77 2728 0.03% 78 2788 0.03% 79 2972 0.03% 80 3258 0.03% 81 3628 0.04% 82 4298 0.04% 83 4741 0.05% 84 6391 0.07% 85 7443 0.08% 86 7657 0.08% 87 8059 0.08% 88 8726 0.09% 89 9111 0.09% 90 9593 0.10% 91 10007 0.10% 92 10820 0.11% 93 11651 0.12% 94 12315 0.13% 95 12873 0.13% 96 13862 0.14% 97 14167 0.15% 98 14634 0.15% 99 15093 0.16% 100 15761 0.16% 101 16698 0.17% 102 17683 0.18% 103 18577 0.19% 104 20032 0.21% 105 20966 0.22% 106 21915 0.23% 107 22178 0.23% 108 23296 0.24% 109 23628 0.25% 110 24236 0.25% 111 24456 0.25% 112 25786 0.27% 113 27035 0.28% 114 28412 0.30% 115 29076 0.30% 116 30412 0.32% 117 30650 0.32% 118 31104 0.32% 119 31349 0.33% 120 32582 0.34% 121 32751 0.34% 122 34027 0.35% 123 36134 0.38% 124 38222 0.40% 125 39392 0.41% 126 40673 0.42% 127 42442 0.44% 128 42948 0.45% 129 43794 0.46% 130 45370 0.47% 131 46722 0.49% 132 48483 0.50% 133 51465 0.54% 134 53655 0.56% 135 57043 0.59% 136 59663 0.62% 137 63588 0.66% 138 66428 0.69% 139 69910 0.73% 140 73595 0.77% 141 79791 0.83% 142 86573 0.90% 143 96376 1.00% 144 109372 1.14% 145 127399 1.33% 146 157685 1.64% 147 213939 2.23% 148 311308 3.24% 149 572304 5.96% 150 2287165 23.82% 151 3808963 39.67% 9601073 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.44 fanout-score-rank=17 prefix-density=0.29 prefix-fanout=5.1 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=55.09 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=8.6 sequence=TCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAAT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.26 fanout-score-rank=20 prefix-density=0.42 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.11 sequence-density-rank=9 fanout-score=245.49 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=24.9 sequence=AAGAAGAAGAAG SRR7169970 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:46:19 Started mapping on | Feb 12 06:46:19 Finished on | Feb 12 06:47:50 Mapping speed, Million of reads per hour | 379.82 Number of input reads | 9601073 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 8748146 Uniquely mapped reads % | 91.12% Average mapped length | 288.80 Number of splices: Total | 6744497 Number of splices: Annotated (sjdb) | 6605866 Number of splices: GT/AG | 6634290 Number of splices: GC/AG | 84310 Number of splices: AT/AC | 5801 Number of splices: Non-canonical | 20096 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 178626 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 28810 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.65% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 697813 697813 697813 N_multimapping 178626 178626 178626 N_noFeature 192254 8621169 252403 N_ambiguous 102845 775 35446 UnstrandedReadsAssigned:8453047 PositiveStrandReadsAssigned:126202 NegativeStrandReadsAssigned:8460297 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7169970 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169970-trimmed-pair1.fastq SRR7169970-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,601,073 reads, 8,484,806 reads pseudoaligned [quant] estimated average fragment length: 213.057 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52401 SRR7169970.ke.tsv 34699 SRR7169970.se.tsv 87100 total ==> SRR7169970.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.94 131 7.04261 Potri.005G024800.1.v4.1 1035 822.943 26 3.0674 Potri.004G059700.1.v4.1 961 748.965 0 0 Potri.007G009000.2.v4.1 1416 1203.94 0 0 Potri.003G141000.2.v4.1 2943 2730.94 124 4.40834 Potri.016G087400.1.v4.1 270 89.141 1306.51 1422.98 Potri.015G069301.1.v4.1 564 353.429 0 0 Potri.010G195200.1.v4.1 1773 1560.94 42 2.61233 Potri.012G127500.1.v4.1 977 764.952 4720 599.065 ==> SRR7169970.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 586 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169970 completed mapping pipeline successfully