Starting /dee2/code/volunteer_pipeline.sh SRR7169971 current disk space = 3049928142848 free memory = 1577534092 SRR7169971 SRAfilesize 55e47b2987754f2677f87af0ab64990b SRR7169971.sra SRR7169971.sra file validated SRR7169971 is paired end SRR7169971 is conventional basespace SRR7169971 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169971_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13125 34.0 33.0 34.0 33.0 34.0 2 33.49925 34.0 34.0 34.0 33.0 34.0 3 33.48 34.0 34.0 34.0 33.0 34.0 4 33.53925 34.0 34.0 34.0 33.0 34.0 5 33.5405 34.0 34.0 34.0 33.0 34.0 6 37.36225 38.0 38.0 38.0 36.0 38.0 7 37.609 38.0 38.0 38.0 37.0 38.0 8 37.61375 38.0 38.0 38.0 38.0 38.0 9 37.562 38.0 38.0 38.0 38.0 38.0 10-14 37.56725 38.0 38.0 38.0 38.0 38.0 15-19 37.5935 38.0 38.0 38.0 38.0 38.0 20-24 37.53345 38.0 38.0 38.0 38.0 38.0 25-29 37.476549999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.426849999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.4039 38.0 38.0 38.0 37.6 38.0 40-44 37.22275 38.0 38.0 38.0 37.0 38.0 45-49 37.1675 38.0 38.0 38.0 36.8 38.0 50-54 37.08935 38.0 38.0 38.0 36.0 38.0 55-59 36.997699999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.003750000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.9809 38.0 38.0 38.0 36.0 38.0 70-74 36.87595 38.0 38.0 38.0 36.0 38.0 75-79 36.6245 38.0 38.0 38.0 34.8 38.0 80-84 36.459050000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.41760000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.376799999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.2663 38.0 38.0 38.0 33.8 38.0 100-104 36.0425 38.0 38.0 38.0 33.2 38.0 105-109 35.925 38.0 37.8 38.0 33.2 38.0 110-114 35.647749999999995 38.0 37.0 38.0 31.6 38.0 115-119 35.44605 38.0 37.0 38.0 31.0 38.0 120-124 35.33194999999999 38.0 36.4 38.0 31.0 38.0 125-129 34.8645 38.0 36.0 38.0 27.8 38.0 130-134 34.597300000000004 38.0 35.6 38.0 26.8 38.0 135-139 34.18225 38.0 35.0 38.0 23.8 38.0 140-144 33.9313 38.0 35.0 38.0 23.0 38.0 145-149 32.985749999999996 38.0 34.2 38.0 14.2 38.0 150-151 29.271124999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 2.0 15 3.0 16 2.0 17 7.0 18 5.0 19 21.0 20 5.0 21 11.0 22 16.0 23 7.0 24 18.0 25 15.0 26 20.0 27 23.0 28 27.0 29 37.0 30 43.0 31 65.0 32 64.0 33 97.0 34 132.0 35 223.0 36 567.0 37 2585.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.50912778904665 14.274847870182555 9.254563894523326 32.961460446247465 2 23.95 13.875000000000002 30.3 31.874999999999996 3 19.35 18.95 26.25 35.449999999999996 4 21.925 24.325 24.975 28.775000000000002 5 23.075000000000003 29.075 25.15 22.7 6 20.625 33.650000000000006 24.675 21.05 7 15.35 29.225 38.2 17.224999999999998 8 16.625 28.225 31.3 23.849999999999998 9 18.325 26.375 32.975 22.325 10-14 19.900000000000002 30.28 26.8 23.02 15-19 20.064999999999998 29.294999999999998 27.555000000000003 23.085 20-24 20.044999999999998 28.92 27.589999999999996 23.445 25-29 19.885 28.860000000000003 27.37 23.885 30-34 20.200000000000003 28.689999999999998 27.685 23.425 35-39 20.21 28.84 26.995 23.955000000000002 40-44 20.445 28.825 26.855 23.875 45-49 20.03 28.715000000000003 27.495000000000005 23.76 50-54 20.505000000000003 28.689999999999998 26.810000000000002 23.995 55-59 20.62 28.515 26.950000000000003 23.915 60-64 20.53 27.915 27.52 24.035 65-69 20.455000000000002 28.655 26.76 24.13 70-74 20.84 28.804999999999996 26.974999999999998 23.380000000000003 75-79 20.39 28.685 27.255000000000003 23.669999999999998 80-84 20.515 28.57 26.75 24.165 85-89 20.305 28.935 26.245 24.515 90-94 20.365 28.59 26.75 24.295 95-99 20.335 28.165000000000003 27.245 24.255 100-104 20.445 28.76 26.83 23.965 105-109 20.775 28.595 26.955000000000002 23.674999999999997 110-114 21.26 28.4 26.445 23.895 115-119 21.095 28.244999999999997 27.075 23.585 120-124 21.065 28.225 26.855 23.855 125-129 21.47 28.125 26.575 23.830000000000002 130-134 21.37 28.310000000000002 26.845000000000002 23.474999999999998 135-139 21.065 28.49 26.26 24.185000000000002 140-144 21.615000000000002 27.565 27.060000000000002 23.76 145-149 21.335 28.005000000000003 26.06 24.6 150-151 21.075 27.762500000000003 26.55 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 1.0 21 2.5 22 2.5 23 1.5 24 2.0 25 3.5 26 6.5 27 9.0 28 12.5 29 13.0 30 19.0 31 30.5 32 35.0 33 37.0 34 53.0 35 69.0 36 80.0 37 97.5 38 122.5 39 152.0 40 171.0 41 203.5 42 228.0 43 231.0 44 255.5 45 257.5 46 256.0 47 259.5 48 238.0 49 210.0 50 176.5 51 154.0 52 124.5 53 98.0 54 92.0 55 77.5 56 50.5 57 34.0 58 28.0 59 25.0 60 16.5 61 12.0 62 11.5 63 7.0 64 6.0 65 6.5 66 5.0 67 3.5 68 3.0 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34310257705911 98.3 2 0.631632137443153 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025265285497726126 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATCTCGTATGC 18 0.44999999999999996 TruSeq Adapter, Index 25 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.1624999999999996 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.6875 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.55 0.0 0.0 0.0 0.0 118-119 5.050000000000001 0.0 0.0 0.0 0.0 120-121 5.4625 0.0 0.0 0.0 0.0 122-123 6.0125 0.0 0.0 0.0 0.0 124-125 6.5625 0.0 0.0 0.0 0.0 126-127 7.050000000000001 0.0 0.0 0.0 0.0 128-129 7.6375 0.0 0.0 0.0 0.0 130-131 8.375 0.0 0.0 0.0 0.0 132-133 9.1125 0.0 0.0 0.0 0.0 134-135 9.75 0.0 0.0 0.0 0.0 136-137 10.337499999999999 0.0 0.0 0.0 0.0 138-139 10.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCATG 10 0.0060887975 150.61038 1 AAGTACT 10 0.006836113 144.9625 6 TCAGCTC 10 0.006836113 144.9625 2 >>END_MODULE SRR7169971 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169971_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0545 33.0 33.0 34.0 32.0 34.0 2 32.54175 34.0 33.0 34.0 32.0 34.0 3 32.6105 34.0 33.0 34.0 32.0 34.0 4 32.46825 34.0 33.0 34.0 32.0 34.0 5 32.39375 34.0 33.0 34.0 32.0 34.0 6 36.598 38.0 38.0 38.0 37.0 38.0 7 36.5855 38.0 38.0 38.0 37.0 38.0 8 36.62025 38.0 38.0 38.0 37.0 38.0 9 36.6375 38.0 38.0 38.0 36.0 38.0 10-14 36.5598 38.0 38.0 38.0 36.6 38.0 15-19 36.2982 38.0 38.0 38.0 36.0 38.0 20-24 36.45975 38.0 38.0 38.0 36.2 38.0 25-29 36.523250000000004 38.0 38.0 38.0 36.4 38.0 30-34 36.60755 38.0 38.0 38.0 37.0 38.0 35-39 36.45195 38.0 38.0 38.0 36.6 38.0 40-44 36.336499999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.21765 38.0 38.0 38.0 36.0 38.0 50-54 36.367900000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.36645 38.0 38.0 38.0 36.0 38.0 60-64 36.23415 38.0 38.0 38.0 35.8 38.0 65-69 36.2102 38.0 38.0 38.0 35.4 38.0 70-74 36.11455 38.0 38.0 38.0 35.2 38.0 75-79 36.04335 38.0 38.0 38.0 34.8 38.0 80-84 36.01055 38.0 38.0 38.0 34.8 38.0 85-89 35.63815 38.0 38.0 38.0 33.6 38.0 90-94 35.2692 38.0 38.0 38.0 31.0 38.0 95-99 35.5609 38.0 38.0 38.0 32.6 38.0 100-104 35.626850000000005 38.0 38.0 38.0 33.2 38.0 105-109 35.53565 38.0 38.0 38.0 33.0 38.0 110-114 35.30025 38.0 38.0 38.0 31.6 38.0 115-119 35.13065 38.0 38.0 38.0 30.2 38.0 120-124 34.84785 38.0 37.4 38.0 27.4 38.0 125-129 34.4796 38.0 36.4 38.0 25.4 38.0 130-134 33.4773 38.0 36.0 38.0 15.6 38.0 135-139 32.3888 38.0 35.0 38.0 4.2 38.0 140-144 31.51955 38.0 33.6 38.0 2.0 38.0 145-149 31.05435 38.0 32.8 38.0 2.0 38.0 150-151 27.375124999999997 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 63.0 3 7.0 4 2.0 5 5.0 6 4.0 7 2.0 8 1.0 9 4.0 10 3.0 11 0.0 12 3.0 13 4.0 14 6.0 15 5.0 16 4.0 17 19.0 18 8.0 19 12.0 20 18.0 21 7.0 22 9.0 23 16.0 24 22.0 25 21.0 26 23.0 27 26.0 28 35.0 29 33.0 30 52.0 31 56.0 32 95.0 33 128.0 34 120.0 35 164.0 36 399.0 37 2624.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.922680412371136 22.474226804123713 13.711340206185568 23.89175257731959 2 26.85929648241206 28.894472361809044 27.160804020100503 17.08542713567839 3 22.199798183652874 28.128153380423814 29.515640766902116 20.15640766902119 4 24.344950394301705 33.93538539811753 22.61511065886543 19.104553548715337 5 24.15644171779141 36.47750511247444 21.625766871165645 17.74028629856851 6 23.21745749809693 34.81349911190053 23.67419436691195 18.29484902309059 7 20.823798627002287 22.19679633867277 36.8929570302568 20.086448004068142 8 22.281368821292777 25.272496831432196 27.376425855513308 25.069708491761723 9 22.663965560901495 25.246897948847806 28.538870600151938 23.55026589009876 10-14 23.96219704283319 28.499568111376455 26.04542452111173 21.492810324678622 15-19 24.230199662972986 27.830260940611755 26.829392840729206 21.110146555686054 20-24 23.575788402848424 28.285859613428283 26.96846388606307 21.169888097660223 25-29 24.140727973233297 28.31795599716111 26.32059211193349 21.220723917672107 30-34 23.84112670348042 28.010537514565076 27.21009169664117 20.93824408531334 35-39 23.447118074986008 27.593223787963577 27.343948720557563 21.615709416492855 40-44 24.771438786454876 27.498850809540837 27.10046478369682 20.629245620307472 45-49 23.541442961599426 27.903052615431818 26.90085391419952 21.654650508769237 50-54 24.030889600162578 28.47635014987553 26.367931717725956 21.124828532235938 55-59 24.222244814965432 27.973769825132166 27.11468076453843 20.689304595363968 60-64 23.74598971329633 28.237510821408566 27.09680704791974 20.919692417375362 65-69 24.271499644633973 27.561173723220634 27.439333942532233 20.72799268961316 70-74 24.284558600465164 27.95530387299019 26.999696632622104 20.760440893922542 75-79 24.536966944234166 27.524602573807723 27.15619480191774 20.782235680040372 80-84 24.01277437015258 27.799462665382467 27.682871191767628 20.504891772697317 85-89 24.17627466051755 27.650525236997183 27.568537022802975 20.604663079682297 90-94 24.377545234290427 27.831331511933605 27.279756688489098 20.51136656528687 95-99 24.179953285264546 27.50076165329542 27.60739311465421 20.711891946785823 100-104 24.846734559456856 27.511779905760754 26.650453463038964 20.991032071743426 105-109 24.46803108018892 27.164694530496163 27.642069981209687 20.725204408105224 110-114 24.448632404624867 27.820506290429382 27.32134671216829 20.409514592777466 115-119 24.930439621591542 27.672383265037688 26.539181464056256 20.857995649314514 120-124 24.804598860370128 27.55282134032575 27.230094296808026 20.412485502496093 125-129 25.630037751249873 27.512498724619938 26.492194674012854 20.365268850117335 130-134 25.676029081018882 27.511899157905752 26.790104084941678 20.02196767613369 135-139 25.958969975424722 26.97937813869003 27.09156961213805 19.970082273747195 140-144 26.20309289499297 27.598139937276954 26.81950902995566 19.379258137774414 145-149 25.977083660335897 28.07513210903573 26.484591639198452 19.463192591429916 150-151 26.977220373688255 27.34834911696954 26.209367801382133 19.465062707960072 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 27.0 1 18.5 2 6.0 3 1.0 4 2.0 5 3.5 6 2.5 7 2.5 8 2.5 9 1.5 10 0.5 11 1.0 12 1.0 13 1.0 14 1.5 15 0.5 16 1.5 17 2.5 18 2.0 19 1.5 20 0.5 21 1.5 22 2.0 23 1.5 24 1.5 25 2.5 26 2.5 27 3.5 28 5.5 29 6.5 30 8.5 31 8.5 32 11.5 33 18.5 34 31.0 35 38.5 36 47.5 37 76.0 38 101.5 39 138.0 40 176.5 41 215.0 42 265.0 43 282.0 44 282.0 45 279.0 46 281.5 47 286.5 48 252.5 49 217.5 50 187.5 51 150.0 52 122.5 53 105.0 54 87.0 55 63.5 56 51.0 57 38.5 58 24.5 59 14.0 60 8.0 61 8.5 62 10.5 63 7.0 64 2.5 65 3.0 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.0 2 0.5 3 0.8999999999999999 4 1.725 5 2.1999999999999997 6 1.4749999999999999 7 1.675 8 1.375 9 1.275 10-14 1.595 15-19 2.085 20-24 1.7000000000000002 25-29 1.37 30-34 1.3050000000000002 35-39 1.7149999999999999 40-44 2.105 45-49 2.215 50-54 1.585 55-59 1.6400000000000001 60-64 1.815 65-69 1.51 70-74 1.11 75-79 0.9249999999999999 80-84 1.365 85-89 2.4250000000000003 90-94 3.005 95-99 1.53 100-104 1.315 105-109 1.545 110-114 1.8350000000000002 115-119 1.165 120-124 0.845 125-129 1.9900000000000002 130-134 4.405 135-139 6.41 140-144 7.53 145-149 4.4350000000000005 150-151 2.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.28735047085773 97.52499999999999 2 0.5090353779587682 1.0 3 0.07635530669381523 0.22499999999999998 4 0.025451768897938407 0.1 5 0.050903537795876815 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050903537795876815 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 20 0.5 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 16 0.4 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.0875000000000004 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.7750000000000004 0.0 0.0 0.0 0.0 110-111 3.1125 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.8375000000000004 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.2125 0.0 0.0 0.0 0.0 122-123 5.775 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.8 0.0 0.0 0.0 0.0 128-129 7.3875 0.0 0.0 0.0 0.0 130-131 8.1 0.0 0.0 0.0 0.0 132-133 8.7375 0.0 0.0 0.0 0.0 134-135 9.399999999999999 0.0 0.0 0.0 0.0 136-137 10.05 0.0 0.0 0.0 0.0 138-139 10.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673666 spots for SRR7169971.sra Written 673666 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra Read 673663 spots for SRR7169971.sra Written 673663 spots for SRR7169971.sra SRR ids: ['SRR7169971.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3aorb2cj SRR7169971.sra spots: 13473263 blocks: [[1, 673663], [673664, 1347326], [1347327, 2020989], [2020990, 2694652], [2694653, 3368315], [3368316, 4041978], [4041979, 4715641], [4715642, 5389304], [5389305, 6062967], [6062968, 6736630], [6736631, 7410293], [7410294, 8083956], [8083957, 8757619], [8757620, 9431282], [9431283, 10104945], [10104946, 10778608], [10778609, 11452271], [11452272, 12125934], [12125935, 12799597], [12799598, 13473263]] SRR7169971 file size 4543946 SRR7169971 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169971 SRR7169971_1.fastq SRR7169971_2.fastq Input file: SRR7169971_1.fastq Paired file: SRR7169971_2.fastq trimmed: SRR7169971-trimmed-pair1.fastq, SRR7169971-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:00:50 2025 >> started Wed Feb 12 06:01:05 2025 >> done (14.644s) 13473263 read pairs processed; of these: 24378 ( 0.18%) short read pairs filtered out after trimming by size control 84006 ( 0.62%) empty read pairs filtered out after trimming by size control 13364879 (99.20%) read pairs available; of these: 6520092 (48.79%) trimmed read pairs available after processing 6844787 (51.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 6 0.00% 21 8 0.00% 22 3 0.00% 23 11 0.00% 24 12 0.00% 25 14 0.00% 26 10 0.00% 27 13 0.00% 28 12 0.00% 29 9 0.00% 30 18 0.00% 31 15 0.00% 32 21 0.00% 33 24 0.00% 34 14 0.00% 35 23 0.00% 36 29 0.00% 37 37 0.00% 38 28 0.00% 39 33 0.00% 40 28 0.00% 41 33 0.00% 42 54 0.00% 43 68 0.00% 44 59 0.00% 45 62 0.00% 46 86 0.00% 47 86 0.00% 48 92 0.00% 49 123 0.00% 50 150 0.00% 51 158 0.00% 52 160 0.00% 53 191 0.00% 54 207 0.00% 55 225 0.00% 56 222 0.00% 57 269 0.00% 58 281 0.00% 59 340 0.00% 60 397 0.00% 61 434 0.00% 62 512 0.00% 63 571 0.00% 64 611 0.00% 65 655 0.00% 66 810 0.01% 67 1001 0.01% 68 1295 0.01% 69 1751 0.01% 70 3021 0.02% 71 2540 0.02% 72 1977 0.01% 73 2056 0.02% 74 2094 0.02% 75 2316 0.02% 76 2456 0.02% 77 2730 0.02% 78 2955 0.02% 79 3328 0.02% 80 3701 0.03% 81 4251 0.03% 82 4794 0.04% 83 5397 0.04% 84 7031 0.05% 85 8224 0.06% 86 8462 0.06% 87 9258 0.07% 88 10162 0.08% 89 10481 0.08% 90 11175 0.08% 91 11652 0.09% 92 12748 0.10% 93 13820 0.10% 94 14680 0.11% 95 15706 0.12% 96 16924 0.13% 97 17772 0.13% 98 18256 0.14% 99 18679 0.14% 100 19531 0.15% 101 20329 0.15% 102 21820 0.16% 103 23007 0.17% 104 23982 0.18% 105 25914 0.19% 106 26910 0.20% 107 27709 0.21% 108 28323 0.21% 109 29615 0.22% 110 30416 0.23% 111 31134 0.23% 112 32187 0.24% 113 33823 0.25% 114 35574 0.27% 115 36932 0.28% 116 38448 0.29% 117 39908 0.30% 118 40431 0.30% 119 40923 0.31% 120 41715 0.31% 121 42878 0.32% 122 43493 0.33% 123 45287 0.34% 124 47216 0.35% 125 48634 0.36% 126 50976 0.38% 127 52631 0.39% 128 53631 0.40% 129 55408 0.41% 130 56679 0.42% 131 57666 0.43% 132 59568 0.45% 133 61974 0.46% 134 64078 0.48% 135 67683 0.51% 136 70214 0.53% 137 73483 0.55% 138 78779 0.59% 139 83689 0.63% 140 86203 0.64% 141 92459 0.69% 142 98413 0.74% 143 104764 0.78% 144 114042 0.85% 145 128137 0.96% 146 149292 1.12% 147 187528 1.40% 148 263480 1.97% 149 491063 3.67% 150 2782185 20.82% 151 6844787 51.21% 13364879 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=36 prefix-density=0.28 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=87.72 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.3 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=42 prefix-density=0.23 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=43.17 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=10.6 sequence=TCAAGGAAGCTTTCAG SRR7169971 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:01:48 Started mapping on | Feb 12 06:01:48 Finished on | Feb 12 06:03:09 Mapping speed, Million of reads per hour | 593.99 Number of input reads | 13364879 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12654877 Uniquely mapped reads % | 94.69% Average mapped length | 290.45 Number of splices: Total | 10890264 Number of splices: Annotated (sjdb) | 10698706 Number of splices: GT/AG | 10729252 Number of splices: GC/AG | 125045 Number of splices: AT/AC | 9551 Number of splices: Non-canonical | 26416 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252454 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 13835 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 478192 478192 478192 N_multimapping 252454 252454 252454 N_noFeature 268460 12472012 350487 N_ambiguous 150766 967 49281 UnstrandedReadsAssigned:12235651 PositiveStrandReadsAssigned:181898 NegativeStrandReadsAssigned:12255109 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169971 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169971-trimmed-pair1.fastq SRR7169971-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,364,879 reads, 12,211,552 reads pseudoaligned [quant] estimated average fragment length: 214.222 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR7169971.ke.tsv 34699 SRR7169971.se.tsv 87100 total ==> SRR7169971.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.78 188 7.63629 Potri.005G024800.1.v4.1 1035 821.778 29 2.58697 Potri.004G059700.1.v4.1 961 747.785 3 0.294098 Potri.007G009000.2.v4.1 1416 1202.78 0 0 Potri.003G141000.2.v4.1 2943 2729.78 281.089 7.54857 Potri.016G087400.1.v4.1 270 90.0721 1111 904.216 Potri.015G069301.1.v4.1 564 352.861 0 0 Potri.010G195200.1.v4.1 1773 1559.78 13 0.610983 Potri.012G127500.1.v4.1 977 763.778 6534 627.134 ==> SRR7169971.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 960 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169971 completed mapping pipeline successfully