Starting /dee2/code/volunteer_pipeline.sh SRR7169972 current disk space = 3049914171392 free memory = 782920904 SRR7169972 SRAfilesize e036b3df2f680ad7b3287da2a421a251 SRR7169972.sra SRR7169972.sra file validated SRR7169972 is paired end SRR7169972 is conventional basespace SRR7169972 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169972_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8405 34.0 33.0 34.0 33.0 34.0 2 33.3055 34.0 33.0 34.0 33.0 34.0 3 33.3565 34.0 34.0 34.0 33.0 34.0 4 33.494 34.0 34.0 34.0 33.0 34.0 5 33.55625 34.0 34.0 34.0 33.0 34.0 6 37.189 38.0 38.0 38.0 36.0 38.0 7 37.38625 38.0 38.0 38.0 37.0 38.0 8 37.55425 38.0 38.0 38.0 38.0 38.0 9 37.62525 38.0 38.0 38.0 38.0 38.0 10-14 37.566449999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.54835 38.0 38.0 38.0 38.0 38.0 20-24 37.506899999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.496300000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.46365 38.0 38.0 38.0 38.0 38.0 35-39 37.37715000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.17345 38.0 38.0 38.0 36.4 38.0 45-49 37.07805 38.0 38.0 38.0 36.0 38.0 50-54 37.03675 38.0 38.0 38.0 36.0 38.0 55-59 37.04045 38.0 38.0 38.0 36.0 38.0 60-64 36.897800000000004 38.0 38.0 38.0 35.6 38.0 65-69 36.85245 38.0 38.0 38.0 35.6 38.0 70-74 36.82305 38.0 38.0 38.0 35.0 38.0 75-79 36.6381 38.0 38.0 38.0 34.4 38.0 80-84 36.60505 38.0 38.0 38.0 34.2 38.0 85-89 36.523 38.0 38.0 38.0 34.0 38.0 90-94 36.37415 38.0 38.0 38.0 34.0 38.0 95-99 36.122499999999995 38.0 37.6 38.0 33.4 38.0 100-104 35.98315 38.0 37.0 38.0 32.6 38.0 105-109 35.9143 38.0 37.0 38.0 32.6 38.0 110-114 35.746449999999996 38.0 37.0 38.0 31.6 38.0 115-119 35.553399999999996 38.0 36.2 38.0 31.0 38.0 120-124 35.30535 38.0 36.0 38.0 29.0 38.0 125-129 34.99935 38.0 35.6 38.0 28.2 38.0 130-134 34.4681 38.0 35.0 38.0 25.2 38.0 135-139 34.00575 38.0 34.4 38.0 23.0 38.0 140-144 33.761849999999995 38.0 34.6 38.0 22.2 38.0 145-149 32.7401 38.0 33.2 38.0 15.0 38.0 150-151 28.459 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 2.0 13 2.0 14 1.0 15 1.0 16 2.0 17 4.0 18 6.0 19 3.0 20 6.0 21 7.0 22 9.0 23 7.0 24 18.0 25 16.0 26 26.0 27 26.0 28 28.0 29 32.0 30 47.0 31 54.0 32 81.0 33 113.0 34 174.0 35 295.0 36 721.0 37 2316.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.0 13.137755102040815 8.010204081632653 33.85204081632653 2 23.0 14.149999999999999 32.7 30.15 3 19.875 18.875 26.275 34.975 4 23.5 27.250000000000004 22.175 27.075 5 22.45 32.775 24.349999999999998 20.424999999999997 6 20.225 33.6 24.45 21.725 7 14.625 27.175 40.699999999999996 17.5 8 17.925 25.25 30.4 26.424999999999997 9 17.224999999999998 24.75 33.225 24.8 10-14 20.565 29.125 26.99 23.32 15-19 20.735 27.935 27.575 23.755000000000003 20-24 20.52 28.28 27.49 23.71 25-29 20.52 28.694999999999997 27.26 23.525 30-34 20.585 28.499999999999996 27.065 23.849999999999998 35-39 20.7 27.765 27.425 24.11 40-44 20.46 28.49 27.555000000000003 23.494999999999997 45-49 20.205000000000002 27.735 27.675 24.385 50-54 20.515 28.65 27.189999999999998 23.645 55-59 20.625 28.01 27.284999999999997 24.08 60-64 20.585 28.134999999999998 27.445000000000004 23.835 65-69 20.674999999999997 27.365000000000002 27.495000000000005 24.465 70-74 20.91 28.34 26.565 24.185000000000002 75-79 21.125 28.415000000000003 26.669999999999998 23.79 80-84 20.18 28.16 27.400000000000002 24.26 85-89 20.408061209181376 28.29924488673301 27.49412411861779 23.798569785467823 90-94 20.365548322483725 27.97696544817226 26.755132699048573 24.902353530295443 95-99 21.258025682182986 27.43780096308186 27.05156500802568 24.25260834670947 100-104 21.29 28.005000000000003 26.424999999999997 24.279999999999998 105-109 21.505 28.025 26.645000000000003 23.825 110-114 21.435000000000002 28.21 26.650000000000002 23.705000000000002 115-119 21.22 28.294999999999998 26.77 23.715 120-124 21.404999999999998 28.04 26.669999999999998 23.885 125-129 21.375 27.815 26.82 23.990000000000002 130-134 21.285 27.235 27.045 24.435000000000002 135-139 20.943377350940377 28.101240496198482 26.855742296918766 24.099639855942375 140-144 21.065 28.299999999999997 26.555 24.08 145-149 21.48 28.255000000000003 26.255 24.01 150-151 21.0 28.65 25.874999999999996 24.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 2.0 25 4.5 26 4.5 27 6.0 28 9.0 29 9.5 30 11.0 31 13.5 32 20.0 33 28.5 34 32.0 35 43.0 36 67.5 37 88.5 38 104.0 39 132.5 40 168.5 41 191.0 42 235.0 43 264.5 44 290.5 45 299.0 46 263.0 47 262.5 48 267.5 49 239.5 50 199.0 51 163.0 52 134.0 53 116.0 54 85.0 55 58.5 56 49.0 57 35.0 58 23.0 59 18.5 60 12.5 61 8.5 62 7.5 63 4.5 64 4.5 65 3.5 66 1.5 67 2.0 68 4.5 69 3.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.15 95-99 0.32 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.04 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0125 0.0 14-15 0.025 0.0 0.0 0.025 0.0 16-17 0.025 0.0 0.0 0.025 0.0 18-19 0.025 0.0 0.0 0.025 0.0 20-21 0.025 0.0 0.0 0.025 0.0 22-23 0.025 0.0 0.0 0.025 0.0 24-25 0.025 0.0 0.0 0.025 0.0 26-27 0.025 0.0 0.0 0.025 0.0 28-29 0.025 0.0 0.0 0.025 0.0 30-31 0.025 0.0 0.0 0.025 0.0 32-33 0.025 0.0 0.0 0.025 0.0 34-35 0.025 0.0 0.0 0.025 0.0 36-37 0.025 0.0 0.0 0.025 0.0 38-39 0.025 0.0 0.0 0.025 0.0 40-41 0.025 0.0 0.0 0.025 0.0 42-43 0.025 0.0 0.0 0.025 0.0 44-45 0.025 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.037500000000000006 0.0 0.0 0.025 0.0 70-71 0.0875 0.0 0.0 0.025 0.0 72-73 0.1 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.16249999999999998 0.0 0.0 0.025 0.0 82-83 0.21250000000000002 0.0 0.0 0.025 0.0 84-85 0.2375 0.0 0.0 0.025 0.0 86-87 0.32499999999999996 0.0 0.0 0.025 0.0 88-89 0.4125 0.0 0.0 0.025 0.0 90-91 0.5375 0.0 0.0 0.025 0.0 92-93 0.6625 0.0 0.0 0.025 0.0 94-95 0.7625 0.0 0.0 0.025 0.0 96-97 0.8625 0.0 0.0 0.025 0.0 98-99 1.1 0.0 0.0 0.025 0.0 100-101 1.3125 0.0 0.0 0.025 0.0 102-103 1.475 0.0 0.0 0.025 0.0 104-105 1.7999999999999998 0.0 0.0 0.025 0.0 106-107 2.1375 0.0 0.0 0.025 0.0 108-109 2.325 0.0 0.0 0.025 0.0 110-111 2.5375 0.0 0.0 0.025 0.0 112-113 2.8499999999999996 0.0 0.0 0.025 0.0 114-115 3.25 0.0 0.0 0.025 0.0 116-117 3.6375 0.0 0.0 0.025 0.0 118-119 4.137499999999999 0.0 0.0 0.025 0.0 120-121 4.5625 0.0 0.0 0.025 0.0 122-123 4.8375 0.0 0.0 0.025 0.0 124-125 5.2 0.0 0.0 0.025 0.0 126-127 5.55 0.0 0.0 0.025 0.0 128-129 5.9375 0.0 0.0 0.025 0.0 130-131 6.15 0.0 0.0 0.025 0.0 132-133 6.5 0.0 0.0 0.025 0.0 134-135 7.075 0.0 0.0 0.025 0.0 136-137 7.65 0.0 0.0 0.025 0.0 138-139 8.3 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAACG 10 0.006832588 144.9875 3 AGATCGG 50 0.0013305914 17.3985 135-139 GGAAGAG 65 0.0076419367 13.383461 140-144 >>END_MODULE SRR7169972 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169972_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.878 33.0 33.0 34.0 31.0 34.0 2 32.23375 34.0 33.0 34.0 32.0 34.0 3 32.08275 34.0 33.0 34.0 32.0 34.0 4 31.863 34.0 33.0 34.0 32.0 34.0 5 31.82675 34.0 33.0 34.0 31.0 34.0 6 36.08175 38.0 38.0 38.0 35.0 38.0 7 36.20575 38.0 38.0 38.0 35.0 38.0 8 36.2 38.0 38.0 38.0 35.0 38.0 9 36.29775 38.0 38.0 38.0 36.0 38.0 10-14 36.17100000000001 38.0 38.0 38.0 36.0 38.0 15-19 35.9752 38.0 38.0 38.0 35.8 38.0 20-24 36.07145 38.0 38.0 38.0 35.8 38.0 25-29 36.0994 38.0 38.0 38.0 36.0 38.0 30-34 36.08055 38.0 38.0 38.0 36.0 38.0 35-39 36.047200000000004 38.0 38.0 38.0 36.0 38.0 40-44 35.9333 38.0 38.0 38.0 35.4 38.0 45-49 35.79875 38.0 38.0 38.0 34.8 38.0 50-54 35.9961 38.0 38.0 38.0 35.4 38.0 55-59 35.95985 38.0 38.0 38.0 34.8 38.0 60-64 35.91985 38.0 38.0 38.0 35.0 38.0 65-69 35.8409 38.0 38.0 38.0 34.4 38.0 70-74 35.8331 38.0 38.0 38.0 34.2 38.0 75-79 35.69935 38.0 38.0 38.0 33.8 38.0 80-84 35.670849999999994 38.0 38.0 38.0 34.0 38.0 85-89 35.32235000000001 38.0 38.0 38.0 32.4 38.0 90-94 34.93575 38.0 38.0 38.0 28.8 38.0 95-99 35.18305 38.0 38.0 38.0 30.6 38.0 100-104 35.1909 38.0 38.0 38.0 30.6 38.0 105-109 35.08615 38.0 38.0 38.0 30.2 38.0 110-114 34.8897 38.0 37.8 38.0 28.4 38.0 115-119 34.59805 38.0 37.2 38.0 26.8 38.0 120-124 34.4294 38.0 36.6 38.0 24.8 38.0 125-129 33.838350000000005 38.0 35.8 38.0 18.2 38.0 130-134 32.9736 38.0 34.2 38.0 13.8 38.0 135-139 31.8979 38.0 33.2 38.0 6.4 38.0 140-144 30.991049999999994 38.0 32.2 38.0 2.0 38.0 145-149 30.36435 38.0 30.4 38.0 2.0 38.0 150-151 25.88775 34.0 16.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 104.0 3 21.0 4 0.0 5 3.0 6 2.0 7 1.0 8 1.0 9 3.0 10 0.0 11 5.0 12 2.0 13 4.0 14 4.0 15 3.0 16 2.0 17 7.0 18 4.0 19 12.0 20 13.0 21 11.0 22 10.0 23 14.0 24 20.0 25 26.0 26 21.0 27 32.0 28 28.0 29 53.0 30 56.0 31 69.0 32 95.0 33 96.0 34 143.0 35 205.0 36 494.0 37 2436.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.58279680659284 21.658511460211177 14.061292814833893 24.69739891836209 2 27.233392720794097 26.597098498345634 28.531432934588953 17.638075846271317 3 19.625928772738916 28.952088137330257 31.437355880092237 19.984627209838585 4 23.79230173081891 33.99638336347197 24.463962800309996 17.747352105399123 5 24.941785252263905 35.1875808538163 23.648124191461836 16.22250970245796 6 22.350230414746544 35.99590373783922 23.169482846902202 18.484383000512032 7 20.760010201479215 21.37209895434838 36.08773272124458 21.780158122927826 8 22.99260769819016 26.306398164669897 25.159316849349988 25.541677287789955 9 22.188217291507268 24.764090793165007 29.227237949502676 23.820453965825045 10-14 23.198729117556628 28.625602131802808 25.94547504355847 22.230193707082094 15-19 23.55695030352917 27.94011729601811 27.07068628459718 21.43224611585554 20-24 23.297086581862946 28.210915059499385 27.318424292162497 21.173574066475172 25-29 23.525795378861623 28.382601567703265 26.77903581126082 21.31256724217429 30-34 23.469701630267608 27.63764995386035 27.63764995386035 21.25499846201169 35-39 23.48321527563905 28.759880915717073 26.578380043116724 21.178523765527153 40-44 23.860064918336853 27.739708382709054 26.79684682363852 21.603379875315575 45-49 23.721649484536083 28.22680412371134 27.0979381443299 20.953608247422682 50-54 23.614383772154493 28.137485913328554 26.785165454359184 21.462964860157772 55-59 23.829547202707555 28.126762730116404 26.480693297779602 21.56299676939644 60-64 23.747947454844006 28.073686371100166 26.96531198686371 21.213054187192117 65-69 23.763848994665572 27.47230201066885 27.5902749281904 21.173574066475172 70-74 23.709866775560208 27.614721045377983 27.400336889387983 21.275075289673833 75-79 23.44004893964111 27.130913539967374 28.196370309951057 21.232667210440457 80-84 24.156096563011456 26.99468085106383 27.59308510638298 21.256137479541735 85-89 24.128838796401613 27.184365629200702 27.58763312997622 21.099162444421466 90-94 24.088426527958386 27.45383615084525 27.53185955786736 20.925877763328998 95-99 24.121299194417364 27.64123351634255 27.533480424855046 20.703986864385037 100-104 24.51566733118642 27.209528190972755 26.913050145683176 21.361754332157645 105-109 24.39737408965022 27.1874038362909 27.341265770848295 21.073956303210586 110-114 24.528883183568677 27.45571245186136 27.214377406931966 20.801026957637998 115-119 24.9115611381697 27.90566521404768 26.075365290951037 21.10740835683158 120-124 24.52407614781635 27.817367403033693 27.425430113000104 20.233126336149855 125-129 25.19429718462093 27.690565649287148 26.398682382006278 20.716454784085645 130-134 25.468971677788872 27.260785034942987 26.688035310808683 20.58220797645946 135-139 25.288948069241012 26.790945406125168 27.057256990679097 20.862849533954726 140-144 25.68297160133895 27.939747327502428 26.282258935320158 20.095022135838462 145-149 25.230704697986578 27.710780201342285 26.174496644295303 20.884018456375838 150-151 25.699188039695837 26.781801778579712 27.38754994200284 20.131460239721612 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 73.0 1 37.5 2 1.5 3 1.0 4 2.5 5 3.5 6 2.0 7 0.5 8 2.0 9 3.0 10 1.5 11 0.5 12 0.0 13 1.5 14 2.5 15 1.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 2.5 27 1.5 28 4.5 29 5.0 30 5.0 31 8.5 32 14.0 33 21.5 34 28.5 35 45.5 36 61.0 37 72.0 38 105.5 39 134.5 40 159.5 41 210.0 42 248.5 43 278.0 44 300.5 45 296.5 46 290.5 47 282.0 48 258.0 49 217.0 50 190.0 51 161.5 52 123.5 53 100.5 54 71.5 55 46.5 56 36.0 57 29.0 58 19.5 59 15.0 60 12.5 61 8.0 62 5.5 63 6.0 64 5.5 65 2.0 66 0.0 67 2.0 68 2.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.9250000000000003 2 1.775 3 2.4250000000000003 4 3.225 5 3.375 6 2.35 7 1.975 8 1.925 9 1.975 10-14 2.4299999999999997 15-19 2.81 20-24 2.52 25-29 2.405 30-34 2.4699999999999998 35-39 2.59 40-44 2.955 45-49 3.0 50-54 2.39 55-59 2.495 60-64 2.56 65-69 2.52 70-74 2.045 75-79 1.92 80-84 2.2399999999999998 85-89 3.29 90-94 3.875 95-99 2.555 100-104 2.185 105-109 2.5100000000000002 110-114 2.625 115-119 2.475 120-124 1.77 125-129 2.855 130-134 4.845 135-139 6.125 140-144 7.39 145-149 4.64 150-151 3.0124999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.35995903737839 97.02499999999999 2 0.6144393241167435 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025601638504864313 1.775 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 71 1.775 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.5875 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.2875 0.0 0.0 0.0 0.0 128-129 5.625 0.0 0.0 0.0 0.0 130-131 5.8375 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.6875 0.0 0.0 0.0 0.0 136-137 7.2875 0.0 0.0 0.0 0.0 138-139 7.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACAAG 10 0.0066589504 146.16882 5 AGATCGG 55 0.0021798795 16.155502 135-139 GGAAGAG 65 0.006625512 13.670041 140-144 >>END_MODULE Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652895 spots for SRR7169972.sra Written 652895 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra Read 652887 spots for SRR7169972.sra Written 652887 spots for SRR7169972.sra SRR ids: ['SRR7169972.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ugbhva8v SRR7169972.sra spots: 13057748 blocks: [[1, 652887], [652888, 1305774], [1305775, 1958661], [1958662, 2611548], [2611549, 3264435], [3264436, 3917322], [3917323, 4570209], [4570210, 5223096], [5223097, 5875983], [5875984, 6528870], [6528871, 7181757], [7181758, 7834644], [7834645, 8487531], [8487532, 9140418], [9140419, 9793305], [9793306, 10446192], [10446193, 11099079], [11099080, 11751966], [11751967, 12404853], [12404854, 13057748]] SRR7169972 file size 4403141 SRR7169972 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169972 SRR7169972_1.fastq SRR7169972_2.fastq Input file: SRR7169972_1.fastq Paired file: SRR7169972_2.fastq trimmed: SRR7169972-trimmed-pair1.fastq, SRR7169972-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:07:34 2025 >> started Wed Feb 12 06:07:49 2025 >> done (14.495s) 13057748 read pairs processed; of these: 22882 ( 0.18%) short read pairs filtered out after trimming by size control 37897 ( 0.29%) empty read pairs filtered out after trimming by size control 12996969 (99.53%) read pairs available; of these: 6394199 (49.20%) trimmed read pairs available after processing 6602770 (50.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 7 0.00% 21 4 0.00% 22 4 0.00% 23 10 0.00% 24 3 0.00% 25 2 0.00% 26 9 0.00% 27 7 0.00% 28 12 0.00% 29 7 0.00% 30 12 0.00% 31 10 0.00% 32 13 0.00% 33 18 0.00% 34 13 0.00% 35 12 0.00% 36 14 0.00% 37 15 0.00% 38 20 0.00% 39 16 0.00% 40 26 0.00% 41 24 0.00% 42 40 0.00% 43 27 0.00% 44 36 0.00% 45 44 0.00% 46 40 0.00% 47 51 0.00% 48 45 0.00% 49 61 0.00% 50 85 0.00% 51 90 0.00% 52 97 0.00% 53 103 0.00% 54 112 0.00% 55 120 0.00% 56 132 0.00% 57 138 0.00% 58 162 0.00% 59 218 0.00% 60 252 0.00% 61 257 0.00% 62 293 0.00% 63 374 0.00% 64 354 0.00% 65 414 0.00% 66 492 0.00% 67 506 0.00% 68 611 0.00% 69 723 0.01% 70 1049 0.01% 71 1208 0.01% 72 1359 0.01% 73 1317 0.01% 74 1375 0.01% 75 1505 0.01% 76 1712 0.01% 77 1866 0.01% 78 1981 0.02% 79 2290 0.02% 80 2526 0.02% 81 2833 0.02% 82 3236 0.02% 83 3779 0.03% 84 5009 0.04% 85 5825 0.04% 86 6038 0.05% 87 6506 0.05% 88 6793 0.05% 89 7017 0.05% 90 7556 0.06% 91 8158 0.06% 92 8960 0.07% 93 9826 0.08% 94 10462 0.08% 95 11201 0.09% 96 11811 0.09% 97 12180 0.09% 98 12557 0.10% 99 13007 0.10% 100 13627 0.10% 101 14422 0.11% 102 15572 0.12% 103 16458 0.13% 104 17482 0.13% 105 18480 0.14% 106 19106 0.15% 107 19913 0.15% 108 20558 0.16% 109 20957 0.16% 110 21719 0.17% 111 22440 0.17% 112 23574 0.18% 113 25082 0.19% 114 26252 0.20% 115 27356 0.21% 116 28492 0.22% 117 28956 0.22% 118 30028 0.23% 119 30294 0.23% 120 31107 0.24% 121 32257 0.25% 122 33252 0.26% 123 34942 0.27% 124 36814 0.28% 125 38610 0.30% 126 40540 0.31% 127 41696 0.32% 128 42371 0.33% 129 43858 0.34% 130 45213 0.35% 131 46661 0.36% 132 49477 0.38% 133 52288 0.40% 134 54672 0.42% 135 58369 0.45% 136 61713 0.47% 137 65180 0.50% 138 70388 0.54% 139 76106 0.59% 140 80596 0.62% 141 86034 0.66% 142 93011 0.72% 143 102346 0.79% 144 112440 0.87% 145 129102 0.99% 146 156356 1.20% 147 202375 1.56% 148 287977 2.22% 149 559030 4.30% 150 3011562 23.17% 151 6602770 50.80% 12996969 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=161.37 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=13.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=44 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=29 fanout-score=44.26 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=10.8 sequence=TCAAGGAAGCTTTCAG SRR7169972 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:08:34 Started mapping on | Feb 12 06:08:34 Finished on | Feb 12 06:09:49 Mapping speed, Million of reads per hour | 623.85 Number of input reads | 12996969 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12283078 Uniquely mapped reads % | 94.51% Average mapped length | 292.48 Number of splices: Total | 11402058 Number of splices: Annotated (sjdb) | 11208643 Number of splices: GT/AG | 11245188 Number of splices: GC/AG | 125119 Number of splices: AT/AC | 9158 Number of splices: Non-canonical | 22593 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216486 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 41829 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 515873 515873 515873 N_multimapping 216486 216486 216486 N_noFeature 234839 12125686 297016 N_ambiguous 144624 671 48949 UnstrandedReadsAssigned:11903615 PositiveStrandReadsAssigned:156721 NegativeStrandReadsAssigned:11937113 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169972 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169972-trimmed-pair1.fastq SRR7169972-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,996,969 reads, 11,890,807 reads pseudoaligned [quant] estimated average fragment length: 231.844 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7169972.ke.tsv 34699 SRR7169972.se.tsv 87100 total ==> SRR7169972.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.16 233 10.7941 Potri.005G024800.1.v4.1 1035 804.156 15 1.54435 Potri.004G059700.1.v4.1 961 730.208 6 0.680297 Potri.007G009000.2.v4.1 1416 1185.16 0 0 Potri.003G141000.2.v4.1 2943 2712.16 195.06 5.95453 Potri.016G087400.1.v4.1 270 85.4536 982.449 951.861 Potri.015G069301.1.v4.1 564 338.106 0 0 Potri.010G195200.1.v4.1 1773 1542.16 12 0.644239 Potri.012G127500.1.v4.1 977 746.18 3535 392.229 ==> SRR7169972.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 824 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169972 completed mapping pipeline successfully