Starting /dee2/code/volunteer_pipeline.sh SRR7169973 current disk space = 3050331676672 free memory = 1490806040 SRR7169973 SRAfilesize d82ea7a3dd57a5a8865203bbfdf45798 SRR7169973.sra SRR7169973.sra file validated SRR7169973 is paired end SRR7169973 is conventional basespace SRR7169973 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169973_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5165 34.0 34.0 34.0 33.0 34.0 2 33.57775 34.0 34.0 34.0 33.0 34.0 3 33.67025 34.0 34.0 34.0 33.0 34.0 4 33.65275 34.0 34.0 34.0 33.0 34.0 5 33.72325 34.0 34.0 34.0 33.0 34.0 6 37.25475 38.0 37.0 38.0 36.0 38.0 7 37.551 38.0 38.0 38.0 37.0 38.0 8 37.674 38.0 38.0 38.0 38.0 38.0 9 37.7435 38.0 38.0 38.0 38.0 38.0 10-14 37.6784 38.0 38.0 38.0 38.0 38.0 15-19 37.679050000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.6357 38.0 38.0 38.0 38.0 38.0 25-29 37.644349999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.56575 38.0 38.0 38.0 38.0 38.0 35-39 37.429550000000006 38.0 38.0 38.0 37.8 38.0 40-44 36.789049999999996 38.0 38.0 38.0 35.2 38.0 45-49 37.1276 38.0 38.0 38.0 36.4 38.0 50-54 37.032000000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.03675 38.0 38.0 38.0 36.0 38.0 60-64 36.980850000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.8326 38.0 38.0 38.0 35.8 38.0 70-74 36.236900000000006 38.0 38.0 38.0 34.0 38.0 75-79 33.02285 38.0 37.0 38.0 4.4 38.0 80-84 32.67615 38.0 36.2 38.0 2.0 38.0 85-89 32.589999999999996 38.0 36.4 38.0 2.0 38.0 90-94 32.3636 38.0 35.8 38.0 2.0 38.0 95-99 32.235200000000006 38.0 35.8 38.0 2.0 38.0 100-104 32.24775 38.0 35.2 38.0 2.0 38.0 105-109 32.164199999999994 38.0 35.0 38.0 2.0 38.0 110-114 31.819349999999996 38.0 34.2 38.0 2.0 38.0 115-119 31.600299999999997 38.0 34.0 38.0 2.0 38.0 120-124 31.4041 38.0 34.0 38.0 2.0 38.0 125-129 30.97585 38.0 33.0 38.0 2.0 38.0 130-134 30.680149999999998 38.0 32.0 38.0 2.0 38.0 135-139 30.145900000000005 38.0 29.8 38.0 2.0 38.0 140-144 29.575200000000002 37.2 27.8 38.0 2.0 38.0 145-149 28.86105 36.2 26.2 38.0 2.0 38.0 150-151 25.146625 33.5 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 4.0 14 8.0 15 10.0 16 17.0 17 28.0 18 125.0 19 260.0 20 15.0 21 12.0 22 10.0 23 12.0 24 23.0 25 19.0 26 23.0 27 27.0 28 23.0 29 35.0 30 33.0 31 43.0 32 63.0 33 77.0 34 122.0 35 226.0 36 707.0 37 2071.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.236828901154034 13.973908680381333 10.737581535373808 29.051680883090818 2 21.975 24.925 26.200000000000003 26.900000000000002 3 17.375 17.474999999999998 33.725 31.424999999999997 4 18.925 23.75 20.974999999999998 36.35 5 31.6 25.5 22.25 20.65 6 29.75 29.65 22.45 18.15 7 12.8 38.224999999999994 33.75 15.225 8 15.8 37.775 26.200000000000003 20.225 9 26.200000000000003 25.8 28.000000000000004 20.0 10-14 19.005 32.97 24.04 23.985 15-19 18.83 29.054999999999996 27.215 24.9 20-24 19.040000000000003 31.395 26.19 23.375 25-29 19.17 29.28 26.495 25.055 30-34 18.87 29.020000000000003 26.71 25.4 35-39 21.33 27.250000000000004 26.51 24.91 40-44 16.76 28.895 28.865000000000002 25.480000000000004 45-49 21.6 28.985 28.23 21.185000000000002 50-54 19.62 26.615 26.325 27.439999999999998 55-59 18.565 27.060000000000002 31.019999999999996 23.355 60-64 19.415 29.054999999999996 28.71 22.82 65-69 16.669999999999998 38.48 23.68 21.17 70-74 17.015 38.345 23.87 20.77 75-79 17.705000000000002 36.09 23.945 22.259999999999998 80-84 19.875 32.58 25.445 22.1 85-89 20.575 30.36 25.295 23.77 90-94 19.18822881737651 29.888393974275562 26.655322556428608 24.268054651919325 95-99 18.51759171212652 32.10049547069716 26.390070567038688 22.99184225013763 100-104 18.45 35.91 23.98 21.66 105-109 18.145 36.815 23.76 21.279999999999998 110-114 17.815 36.445 23.84 21.9 115-119 18.65 35.699999999999996 23.43 22.220000000000002 120-124 18.557783667550133 34.56518477771666 24.273641046156925 22.603390508576286 125-129 18.935 33.489999999999995 24.240000000000002 23.335 130-134 19.292717086834735 33.90356142456983 23.93957583033213 22.864145658263304 135-139 19.28578573572072 33.51505451635491 24.147244173251973 23.051915574672403 140-144 19.242697078831533 33.953581432573024 23.484393757503 23.319327731092436 145-149 19.198639387724477 33.80021009454254 23.51558201190536 23.485568505827622 150-151 18.70233779222403 35.02937867233405 23.6029503687961 22.665333166645834 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 2.5 23 2.5 24 3.5 25 7.5 26 12.0 27 16.5 28 18.0 29 22.5 30 30.0 31 40.0 32 54.0 33 68.0 34 87.0 35 110.5 36 125.5 37 133.5 38 132.0 39 155.0 40 195.5 41 237.5 42 263.0 43 250.0 44 237.5 45 232.0 46 223.0 47 206.0 48 192.5 49 179.5 50 150.5 51 116.5 52 90.0 53 86.0 54 82.5 55 56.0 56 41.5 57 34.5 58 20.5 59 14.0 60 14.5 61 12.5 62 10.0 63 7.5 64 4.0 65 4.5 66 4.5 67 1.5 68 0.5 69 0.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.095 95-99 0.095 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.0 130-134 0.04 135-139 0.03 140-144 0.04 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.37142857142858 86.075 2 1.4000000000000001 2.45 3 0.08571428571428572 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.05714285714285715 0.35000000000000003 8 0.028571428571428574 0.2 9 0.0 0.0 >10 0.028571428571428574 0.25 >50 0.0 0.0 >100 0.028571428571428574 10.45 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGC 418 10.45 TruSeq Adapter, Index 20 (98% over 50bp) CGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGCCGT 10 0.25 TruSeq Adapter, Index 20 (98% over 50bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGCC 8 0.2 TruSeq Adapter, Index 20 (98% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATATCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 20 (97% over 41bp) GAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGCCGTCT 7 0.17500000000000002 TruSeq Adapter, Index 20 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.2125 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.5875 0.0 0.0 0.0 0.0 122-123 5.074999999999999 0.0 0.0 0.0 0.0 124-125 5.475 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.6375 0.0 0.0 0.0 0.0 130-131 7.1 0.0 0.0 0.0 0.0 132-133 7.762499999999999 0.0 0.0 0.0 0.0 134-135 8.2375 0.0 0.0 0.0 0.0 136-137 8.8625 0.0 0.0 0.0 0.0 138-139 9.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATGCG 10 0.006830828 145.0 145 TGTGGAC 10 0.006830828 145.0 145 GATCGGA 55 3.3778633E-8 79.09091 1 GAAGAGC 60 6.176924E-8 72.5 6 TCGGAAG 60 6.176924E-8 72.5 3 AGAGCAC 60 6.176924E-8 72.5 8 ATCGGAA 60 6.176924E-8 72.5 2 GGAAGAG 60 6.176924E-8 72.5 5 AAGAGCA 65 1.0757503E-7 66.92307 7 GAGCACA 65 1.0757503E-7 66.92307 9 CGGAAGA 65 1.0757503E-7 66.92307 4 TGCCGTC 35 3.5374105E-6 29.0 45-49 ATGCCGT 35 3.5374105E-6 29.0 45-49 GCTTGAA 35 3.5374105E-6 29.0 55-59 GCCGTCT 35 3.5374105E-6 29.0 45-49 CGTCTTC 35 3.5374105E-6 29.0 50-54 TATGCCG 40 9.990927E-6 25.375 45-49 TCTCGTA 40 9.990927E-6 25.375 40-44 TGCTTGA 40 9.990927E-6 25.375 55-59 GTCTTCT 40 9.990927E-6 25.375 50-54 >>END_MODULE SRR7169973 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169973_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8935 33.0 33.0 34.0 32.0 34.0 2 32.91475 34.0 33.0 34.0 33.0 34.0 3 32.81025 34.0 33.0 34.0 33.0 34.0 4 32.7615 34.0 33.0 34.0 33.0 34.0 5 32.87025 34.0 33.0 34.0 33.0 34.0 6 36.88825 38.0 38.0 38.0 37.0 38.0 7 36.951 38.0 38.0 38.0 37.0 38.0 8 36.9925 38.0 38.0 38.0 37.0 38.0 9 36.98475 38.0 38.0 38.0 38.0 38.0 10-14 36.7954 38.0 38.0 38.0 37.4 38.0 15-19 36.703900000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.76775 38.0 38.0 38.0 37.4 38.0 25-29 36.70165 38.0 38.0 38.0 37.0 38.0 30-34 36.68955 38.0 38.0 38.0 37.0 38.0 35-39 36.59065 38.0 38.0 38.0 37.0 38.0 40-44 36.55185 38.0 38.0 38.0 37.0 38.0 45-49 36.43345 38.0 38.0 38.0 36.2 38.0 50-54 36.5145 38.0 38.0 38.0 36.0 38.0 55-59 36.52145 38.0 38.0 38.0 36.6 38.0 60-64 36.514300000000006 38.0 38.0 38.0 36.6 38.0 65-69 35.4048 38.0 38.0 38.0 27.4 38.0 70-74 32.995850000000004 38.0 38.0 38.0 2.0 38.0 75-79 32.83925 38.0 38.0 38.0 2.0 38.0 80-84 32.6299 38.0 38.0 38.0 2.0 38.0 85-89 32.346500000000006 38.0 38.0 38.0 2.0 38.0 90-94 32.2442 38.0 37.0 38.0 2.0 38.0 95-99 32.3251 38.0 37.0 38.0 2.0 38.0 100-104 32.2807 38.0 37.0 38.0 2.0 38.0 105-109 32.14475 38.0 36.8 38.0 2.0 38.0 110-114 31.971600000000002 38.0 36.2 38.0 2.0 38.0 115-119 31.8666 38.0 35.6 38.0 2.0 38.0 120-124 31.664800000000003 38.0 35.2 38.0 2.0 38.0 125-129 31.3257 38.0 34.6 38.0 2.0 38.0 130-134 30.708199999999998 38.0 33.8 38.0 2.0 38.0 135-139 30.07455 38.0 32.2 38.0 2.0 38.0 140-144 29.54325 38.0 31.0 38.0 2.0 38.0 145-149 29.099849999999996 38.0 28.6 38.0 2.0 38.0 150-151 25.529375 34.5 14.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 23.0 4 3.0 5 2.0 6 1.0 7 3.0 8 0.0 9 1.0 10 4.0 11 2.0 12 2.0 13 6.0 14 11.0 15 21.0 16 25.0 17 251.0 18 106.0 19 42.0 20 12.0 21 8.0 22 6.0 23 8.0 24 18.0 25 12.0 26 7.0 27 22.0 28 21.0 29 18.0 30 32.0 31 35.0 32 64.0 33 88.0 34 86.0 35 147.0 36 353.0 37 2514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.928338762214985 20.04510147832623 13.154597845151592 20.871961914307192 2 26.084775520441433 35.214446952595935 24.55480311010785 14.145974416854779 3 18.22759315206445 28.046324269889222 35.24672708962739 18.479355488418932 4 22.82251956576622 30.169149204746276 21.10578136834133 25.902549861146174 5 33.30819507290095 31.8753142282554 20.01005530417295 14.80643539467069 6 30.97389558232932 32.9066265060241 21.561244979919678 14.558232931726907 7 19.608335425558625 31.609339693698217 31.333165955310065 17.449158925433093 8 22.289156626506024 33.93574297188755 22.31425702811245 21.460843373493976 9 30.446787148594378 24.87449799196787 24.824297188755022 19.854417670682732 10-14 25.715725806451612 28.407258064516128 24.91935483870968 20.95766129032258 15-19 25.868336025848144 24.90407915993538 28.665185783521807 20.56239903069467 20-24 28.0106822533508 29.92038697974403 24.055225234304142 18.01370553260103 25-29 26.885460778382736 31.735228876789673 23.29602742488405 18.083282919943535 30-34 25.906526994359385 27.98146655922643 28.122481869460113 17.989524576954068 35-39 20.663368336025847 27.064822294022616 29.180129240710823 23.09168012924071 40-44 30.137055580842564 25.211146512921662 26.379406261063064 18.27239164517271 45-49 24.125379170879675 25.171890798786656 26.172901921132457 24.529828109201212 50-54 24.06912883559228 26.91590668614904 29.092558069229607 19.922406409029072 55-59 21.540864657865566 31.43706540360778 29.21495515469112 17.807114783835534 60-64 21.702492683419113 36.254919769906145 24.71490564133616 17.327681905338583 65-69 21.564875887417553 36.34761593071849 24.38447208096269 17.703036100901265 70-74 21.606022584692596 34.86574654956085 25.405269761606025 18.12296110414053 75-79 22.23505196043978 33.791857020934785 25.111702394698526 18.861388623926903 80-84 22.732080793834687 32.624792222837854 26.006145166977284 18.636981816350172 85-89 24.588999391110207 31.317231581083828 25.517556322305662 18.576212705500307 90-94 23.65858606349528 31.39263616999696 26.179125671974845 18.769652094532915 95-99 23.59539258588602 31.497409587042906 25.682812735777876 19.224385091293193 100-104 23.338360985419808 32.332830568124685 25.585721468074407 18.743086978381097 105-109 22.812311406155704 32.9963789981895 26.030979682156506 18.16032991349829 110-114 22.239031770045386 33.171961674230964 25.985879979828542 18.60312657589511 115-119 22.96177224092028 32.28512583513337 26.156628321695884 18.596473602250466 120-124 22.743464954091618 32.487080427474794 25.82911043098691 18.94034418744669 125-129 23.704715644606356 32.493422384132764 25.556567496458204 18.24529447480267 130-134 23.583021862679843 31.990169474169267 25.656648405099585 18.770160258051302 135-139 23.129743404409105 32.21126542413134 25.716350869946826 18.942640301512725 140-144 23.947984395318596 31.828348504551368 25.617685305591674 18.605981794538362 145-149 24.098227022620748 31.96963521499898 25.229264316282862 18.702873446097414 150-151 23.768006065200908 31.69067475360121 25.815011372251707 18.72630780894617 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 3.5 2 3.5 3 3.5 4 3.0 5 2.5 6 1.5 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.5 16 1.5 17 2.0 18 2.0 19 1.5 20 1.0 21 1.0 22 1.5 23 1.0 24 3.0 25 4.0 26 2.5 27 3.0 28 6.0 29 10.5 30 12.5 31 23.0 32 43.5 33 55.5 34 65.0 35 80.0 36 112.0 37 137.0 38 156.5 39 186.0 40 193.0 41 217.5 42 253.5 43 264.5 44 281.0 45 283.0 46 254.0 47 227.5 48 199.5 49 169.0 50 141.5 51 123.5 52 96.5 53 85.5 54 80.0 55 48.5 56 37.5 57 31.0 58 19.0 59 15.0 60 12.5 61 10.0 62 6.5 63 3.5 64 4.0 65 3.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.325 3 0.7000000000000001 4 0.975 5 0.5499999999999999 6 0.4 7 0.42500000000000004 8 0.4 9 0.4 10-14 0.8 15-19 0.96 20-24 0.77 25-29 0.8200000000000001 30-34 0.72 35-39 0.96 40-44 1.135 45-49 1.0999999999999999 50-54 0.765 55-59 0.77 60-64 0.91 65-69 0.695 70-74 0.375 75-79 0.40499999999999997 80-84 0.735 85-89 1.46 90-94 1.41 95-99 0.5950000000000001 100-104 0.5499999999999999 105-109 0.58 110-114 0.8500000000000001 115-119 0.46499999999999997 120-124 0.345 125-129 1.18 130-134 2.3449999999999998 135-139 3.1550000000000002 140-144 3.875 145-149 1.8599999999999999 150-151 1.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.85 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49174729652817 86.52499999999999 2 1.3659647125782584 2.4 3 0.08537279453614115 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028457598178713718 0.325 >50 0.0 0.0 >100 0.028457598178713718 10.525 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 421 10.525 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 13 0.325 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 2.6500000000000004 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.1875 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.3625 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.237500000000001 0.0 0.0 0.0 0.0 126-127 5.725 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.725 0.0 0.0 0.0 0.0 132-133 7.3125 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.35 0.0 0.0 0.0 0.0 138-139 8.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 60 6.258597E-8 72.3625 9 GATCGGA 60 6.258597E-8 72.3625 1 TCGGAAG 60 6.258597E-8 72.3625 3 CGGAAGA 60 6.258597E-8 72.3625 4 GAAGAGC 65 1.089993E-7 66.79615 6 AGAGCGT 70 1.8210449E-7 62.024994 8 AAGAGCG 75 2.9353941E-7 57.890003 7 ATCGGAA 75 2.9353941E-7 57.890003 2 GGAAGAG 80 4.5864E-7 54.271873 5 CCGTATC 35 3.590114E-6 28.945 45-49 CATTAAA 35 3.590114E-6 28.945 50-54 CGTATCA 35 3.590114E-6 28.945 45-49 GCCGTAT 35 3.590114E-6 28.945 45-49 GTGGTCG 40 1.0139192E-5 25.326874 40-44 TCATTAA 40 1.0139192E-5 25.326874 50-54 GGTCGCC 40 1.0139192E-5 25.326874 40-44 TGGTCGC 45 2.5245694E-5 22.51278 40-44 GTCGCCG 45 2.5245694E-5 22.51278 40-44 TCTCGGT 45 2.5245694E-5 22.51278 35-39 GATCTCG 45 2.5245694E-5 22.51278 30-34 >>END_MODULE Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457682 spots for SRR7169973.sra Written 457682 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra Read 457679 spots for SRR7169973.sra Written 457679 spots for SRR7169973.sra SRR ids: ['SRR7169973.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k14hgp8h SRR7169973.sra spots: 9153583 blocks: [[1, 457679], [457680, 915358], [915359, 1373037], [1373038, 1830716], [1830717, 2288395], [2288396, 2746074], [2746075, 3203753], [3203754, 3661432], [3661433, 4119111], [4119112, 4576790], [4576791, 5034469], [5034470, 5492148], [5492149, 5949827], [5949828, 6407506], [6407507, 6865185], [6865186, 7322864], [7322865, 7780543], [7780544, 8238222], [8238223, 8695901], [8695902, 9153583]] SRR7169973 file size 3081801 SRR7169973 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169973 SRR7169973_1.fastq SRR7169973_2.fastq Input file: SRR7169973_1.fastq Paired file: SRR7169973_2.fastq trimmed: SRR7169973-trimmed-pair1.fastq, SRR7169973-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:20:33 2025 >> started Wed Feb 12 06:20:42 2025 >> done (9.774s) 9153583 read pairs processed; of these: 35185 ( 0.38%) short read pairs filtered out after trimming by size control 1133991 (12.39%) empty read pairs filtered out after trimming by size control 7984407 (87.23%) read pairs available; of these: 4449404 (55.73%) trimmed read pairs available after processing 3535003 (44.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 18 0.00% 20 23 0.00% 21 52 0.00% 22 36 0.00% 23 49 0.00% 24 54 0.00% 25 64 0.00% 26 39 0.00% 27 52 0.00% 28 16 0.00% 29 55 0.00% 30 78 0.00% 31 32 0.00% 32 35 0.00% 33 34 0.00% 34 63 0.00% 35 62 0.00% 36 46 0.00% 37 33 0.00% 38 60 0.00% 39 83 0.00% 40 87 0.00% 41 76 0.00% 42 87 0.00% 43 115 0.00% 44 250 0.00% 45 325 0.00% 46 396 0.00% 47 371 0.00% 48 317 0.00% 49 384 0.00% 50 341 0.00% 51 355 0.00% 52 421 0.01% 53 360 0.00% 54 438 0.01% 55 374 0.00% 56 440 0.01% 57 450 0.01% 58 423 0.01% 59 425 0.01% 60 431 0.01% 61 513 0.01% 62 588 0.01% 63 834 0.01% 64 1352 0.02% 65 2507 0.03% 66 3448 0.04% 67 3180 0.04% 68 4583 0.06% 69 7643 0.10% 70 9057 0.11% 71 5326 0.07% 72 3355 0.04% 73 2890 0.04% 74 2505 0.03% 75 2389 0.03% 76 2308 0.03% 77 2286 0.03% 78 2310 0.03% 79 2430 0.03% 80 2730 0.03% 81 3063 0.04% 82 3315 0.04% 83 3974 0.05% 84 5259 0.07% 85 5978 0.07% 86 6457 0.08% 87 6615 0.08% 88 7148 0.09% 89 7412 0.09% 90 7888 0.10% 91 8103 0.10% 92 8670 0.11% 93 9316 0.12% 94 9801 0.12% 95 10496 0.13% 96 11119 0.14% 97 11212 0.14% 98 11874 0.15% 99 12268 0.15% 100 12554 0.16% 101 13315 0.17% 102 14241 0.18% 103 14607 0.18% 104 15764 0.20% 105 16403 0.21% 106 16982 0.21% 107 17709 0.22% 108 18603 0.23% 109 18811 0.24% 110 19105 0.24% 111 19534 0.24% 112 20354 0.25% 113 21327 0.27% 114 21826 0.27% 115 22366 0.28% 116 23369 0.29% 117 24118 0.30% 118 24309 0.30% 119 24533 0.31% 120 25321 0.32% 121 25593 0.32% 122 26676 0.33% 123 28256 0.35% 124 29325 0.37% 125 29894 0.37% 126 31424 0.39% 127 32046 0.40% 128 33140 0.42% 129 33827 0.42% 130 35395 0.44% 131 35800 0.45% 132 37498 0.47% 133 38718 0.48% 134 40584 0.51% 135 42972 0.54% 136 45457 0.57% 137 47787 0.60% 138 50250 0.63% 139 53048 0.66% 140 55941 0.70% 141 59545 0.75% 142 64002 0.80% 143 70166 0.88% 144 77937 0.98% 145 89806 1.12% 146 108549 1.36% 147 143631 1.80% 148 208264 2.61% 149 396251 4.96% 150 1852410 23.20% 151 3535003 44.27% 7984407 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.64 fanout-score-rank=27 prefix-density=0.19 prefix-fanout=3.7 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=310.79 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=27.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=30 prefix-density=0.45 prefix-fanout=2.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=307.78 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=27.6 sequence=AAGAAGAAGAAG SRR7169973 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:21:29 Started mapping on | Feb 12 06:21:32 Finished on | Feb 12 06:22:30 Mapping speed, Million of reads per hour | 495.58 Number of input reads | 7984407 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 7364805 Uniquely mapped reads % | 92.24% Average mapped length | 289.85 Number of splices: Total | 5643090 Number of splices: Annotated (sjdb) | 5520754 Number of splices: GT/AG | 5549112 Number of splices: GC/AG | 71642 Number of splices: AT/AC | 5086 Number of splices: Non-canonical | 17250 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.63 Insertion rate per base | 0.03% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 151853 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 22530 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.50% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485125 485125 485125 N_multimapping 151853 151853 151853 N_noFeature 204389 7252584 259536 N_ambiguous 88366 591 31003 UnstrandedReadsAssigned:7072050 PositiveStrandReadsAssigned:111630 NegativeStrandReadsAssigned:7074266 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169973 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169973-trimmed-pair1.fastq SRR7169973-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,984,407 reads, 7,089,360 reads pseudoaligned [quant] estimated average fragment length: 215.94 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7169973.ke.tsv 34699 SRR7169973.se.tsv 87100 total ==> SRR7169973.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.06 144 9.93153 Potri.005G024800.1.v4.1 1035 820.06 53 8.03701 Potri.004G059700.1.v4.1 961 746.069 0 0 Potri.007G009000.2.v4.1 1416 1201.06 0 0 Potri.003G141000.2.v4.1 2943 2728.06 148 6.7464 Potri.016G087400.1.v4.1 270 87.8721 857 1212.81 Potri.015G069301.1.v4.1 564 350.564 0 0 Potri.010G195200.1.v4.1 1773 1558.06 65 5.18792 Potri.012G127500.1.v4.1 977 762.069 4365 712.285 ==> SRR7169973.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 663 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7169973 completed mapping pipeline successfully