Starting /dee2/code/volunteer_pipeline.sh SRR7169974 current disk space = 3050240159744 free memory = 1579884644 SRR7169974 SRAfilesize 1e00691d20e947495702a3c8fc8646d3 SRR7169974.sra SRR7169974.sra file validated SRR7169974 is paired end SRR7169974 is conventional basespace SRR7169974 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169974_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.071 34.0 34.0 34.0 33.0 34.0 2 33.54525 34.0 34.0 34.0 33.0 34.0 3 33.5645 34.0 34.0 34.0 33.0 34.0 4 33.65275 34.0 34.0 34.0 33.0 34.0 5 33.6315 34.0 34.0 34.0 33.0 34.0 6 37.531 38.0 38.0 38.0 37.0 38.0 7 37.6865 38.0 38.0 38.0 38.0 38.0 8 37.74075 38.0 38.0 38.0 38.0 38.0 9 37.76 38.0 38.0 38.0 38.0 38.0 10-14 37.7429 38.0 38.0 38.0 38.0 38.0 15-19 37.740700000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.723800000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6925 38.0 38.0 38.0 38.0 38.0 30-34 37.6791 38.0 38.0 38.0 38.0 38.0 35-39 37.66415 38.0 38.0 38.0 38.0 38.0 40-44 37.553700000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.3713 38.0 38.0 38.0 38.0 38.0 50-54 37.4938 38.0 38.0 38.0 38.0 38.0 55-59 37.4491 38.0 38.0 38.0 37.4 38.0 60-64 37.4619 38.0 38.0 38.0 37.2 38.0 65-69 37.386649999999996 38.0 38.0 38.0 37.2 38.0 70-74 37.34635 38.0 38.0 38.0 37.0 38.0 75-79 37.29045 38.0 38.0 38.0 37.0 38.0 80-84 37.17165 38.0 38.0 38.0 36.8 38.0 85-89 36.9921 38.0 38.0 38.0 36.2 38.0 90-94 36.84825 38.0 38.0 38.0 36.0 38.0 95-99 36.645700000000005 38.0 38.0 38.0 35.6 38.0 100-104 36.7625 38.0 38.0 38.0 35.6 38.0 105-109 36.7023 38.0 38.0 38.0 35.0 38.0 110-114 36.550700000000006 38.0 38.0 38.0 34.8 38.0 115-119 36.371399999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.263549999999995 38.0 38.0 38.0 34.0 38.0 125-129 35.98365 38.0 37.6 38.0 32.8 38.0 130-134 35.5674 38.0 36.6 38.0 31.8 38.0 135-139 35.12425 38.0 36.0 38.0 29.4 38.0 140-144 35.036950000000004 38.0 36.0 38.0 29.4 38.0 145-149 34.3757 38.0 35.4 38.0 27.0 38.0 150-151 31.080125 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 4.0 17 3.0 18 6.0 19 8.0 20 2.0 21 3.0 22 4.0 23 3.0 24 10.0 25 13.0 26 13.0 27 16.0 28 19.0 29 16.0 30 26.0 31 40.0 32 51.0 33 62.0 34 126.0 35 167.0 36 428.0 37 2979.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.24758515505846 12.277580071174377 8.769700050838841 39.705134722928314 2 21.575 14.05 35.3 29.075 3 20.5 17.724999999999998 27.025 34.75 4 22.95 24.6 23.25 29.2 5 22.45 31.874999999999996 23.45 22.225 6 20.200000000000003 34.025 25.674999999999997 20.1 7 14.6 28.849999999999998 38.5 18.05 8 18.125 26.6 31.125000000000004 24.15 9 17.325 24.4 33.7 24.575 10-14 19.605 30.37 26.85 23.175 15-19 20.200000000000003 28.689999999999998 27.38 23.73 20-24 20.044999999999998 28.395 27.43 24.13 25-29 19.939999999999998 28.785 27.6 23.674999999999997 30-34 20.055 29.005 27.22 23.72 35-39 20.035 28.59 27.139999999999997 24.235 40-44 20.31914361462658 28.89300185083287 27.332299534790653 23.455554999749886 45-49 20.50793013451114 28.367797630997792 27.067857859867495 24.056414374623568 50-54 19.681968196819682 29.512951295129515 26.927692769276927 23.877387738773876 55-59 20.255000000000003 28.225 27.565 23.955000000000002 60-64 19.965 28.15 27.955000000000002 23.93 65-69 20.19 28.59 27.37 23.849999999999998 70-74 20.349999999999998 28.389999999999997 26.784999999999997 24.474999999999998 75-79 19.575 28.335 26.815 25.275 80-84 20.24101205060253 28.036401820091005 27.571378568928445 24.15120756037802 85-89 19.801434087148372 28.97257182971469 27.157398585970014 24.068595497166925 90-94 20.053395123916985 28.359862986097117 27.171065887568002 24.415676002417893 95-99 20.13206310801956 28.28267553808156 27.783658450526737 23.801602903372146 100-104 20.743747807347265 28.862827644965673 26.34190347316193 24.051521074525134 105-109 20.686034301715086 28.466423321166058 27.04635231761588 23.801190059502975 110-114 21.11010920749424 28.44905320108206 26.75082657048392 23.690011020939785 115-119 20.990247561890474 28.20205051262816 26.93173293323331 23.875968992248062 120-124 20.62 28.82 26.529999999999998 24.03 125-129 20.86 28.375 25.96 24.805 130-134 20.563747617614606 28.44317383890059 26.657638679907713 24.335439863577086 135-139 21.020326021332263 28.914268464479775 26.57979472730932 23.485610786878645 140-144 20.88690237042989 27.937926878264363 26.48151868220169 24.693652069104058 145-149 21.05157636208711 28.524885970628038 26.71545285950579 23.70808480777906 150-151 21.2875 28.7375 25.974999999999998 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 2.5 26 3.5 27 5.5 28 8.5 29 11.5 30 16.0 31 21.5 32 31.0 33 41.5 34 52.5 35 67.5 36 80.0 37 97.5 38 127.0 39 149.5 40 169.0 41 199.0 42 231.5 43 257.5 44 280.0 45 284.0 46 271.5 47 257.5 48 230.5 49 215.5 50 191.5 51 156.5 52 128.0 53 101.0 54 79.5 55 57.5 56 44.5 57 30.0 58 16.5 59 15.5 60 17.5 61 12.5 62 6.5 63 4.5 64 3.0 65 3.5 66 2.5 67 2.0 68 3.5 69 2.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.045 45-49 0.38 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.28500000000000003 90-94 0.74 95-99 0.8049999999999999 100-104 0.23500000000000001 105-109 0.005 110-114 0.19 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.31 135-139 0.62 140-144 0.44 145-149 0.245 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4779874213836478 0.95 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGATAGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.1 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.1500000000000004 0.0 0.0 0.0 0.0 114-115 3.525 0.0 0.0 0.0 0.0 116-117 3.925 0.0 0.0 0.0 0.0 118-119 4.3 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.4375 0.0 0.0 0.0 0.0 126-127 5.825 0.0 0.0 0.0 0.0 128-129 6.2875 0.0 0.0 0.0 0.0 130-131 6.8875 0.0 0.0 0.0 0.0 132-133 7.2375 0.0 0.0 0.0 0.0 134-135 7.637499999999999 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTCT 20 3.5877043E-4 108.75 8 >>END_MODULE SRR7169974 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169974_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.18675 33.0 33.0 34.0 32.0 34.0 2 32.3345 34.0 33.0 34.0 32.0 34.0 3 32.3905 34.0 33.0 34.0 32.0 34.0 4 32.088 34.0 33.0 34.0 32.0 34.0 5 32.00625 34.0 33.0 34.0 32.0 34.0 6 36.21 38.0 38.0 38.0 36.0 38.0 7 36.32475 38.0 38.0 38.0 37.0 38.0 8 36.267 38.0 38.0 38.0 36.0 38.0 9 36.23925 38.0 38.0 38.0 37.0 38.0 10-14 36.18915 38.0 38.0 38.0 36.4 38.0 15-19 35.9399 38.0 38.0 38.0 35.8 38.0 20-24 36.12365 38.0 38.0 38.0 36.2 38.0 25-29 36.157500000000006 38.0 38.0 38.0 36.2 38.0 30-34 36.21055 38.0 38.0 38.0 36.8 38.0 35-39 36.107 38.0 38.0 38.0 36.0 38.0 40-44 36.0101 38.0 38.0 38.0 36.2 38.0 45-49 35.9344 38.0 38.0 38.0 36.0 38.0 50-54 36.1284 38.0 38.0 38.0 36.2 38.0 55-59 36.11615 38.0 38.0 38.0 36.0 38.0 60-64 36.0603 38.0 38.0 38.0 36.0 38.0 65-69 36.03925 38.0 38.0 38.0 36.0 38.0 70-74 35.998 38.0 38.0 38.0 35.6 38.0 75-79 35.921549999999996 38.0 38.0 38.0 35.2 38.0 80-84 35.7832 38.0 38.0 38.0 34.4 38.0 85-89 35.50625 38.0 38.0 38.0 34.0 38.0 90-94 35.2114 38.0 38.0 38.0 32.4 38.0 95-99 35.516949999999994 38.0 38.0 38.0 33.4 38.0 100-104 35.469849999999994 38.0 38.0 38.0 33.2 38.0 105-109 35.33435000000001 38.0 38.0 38.0 32.6 38.0 110-114 35.1495 38.0 38.0 38.0 30.6 38.0 115-119 34.978899999999996 38.0 37.8 38.0 29.6 38.0 120-124 34.7639 38.0 37.4 38.0 27.6 38.0 125-129 34.40475 38.0 36.8 38.0 25.2 38.0 130-134 33.57815 38.0 36.0 38.0 15.8 38.0 135-139 32.790549999999996 38.0 35.0 38.0 8.8 38.0 140-144 31.88825 38.0 33.0 38.0 2.0 38.0 145-149 31.338900000000002 38.0 33.2 38.0 2.0 38.0 150-151 27.162875 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 120.0 3 12.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 3.0 10 0.0 11 4.0 12 1.0 13 1.0 14 5.0 15 3.0 16 1.0 17 4.0 18 6.0 19 3.0 20 7.0 21 10.0 22 13.0 23 12.0 24 6.0 25 20.0 26 17.0 27 27.0 28 32.0 29 38.0 30 44.0 31 67.0 32 85.0 33 117.0 34 123.0 35 148.0 36 423.0 37 2645.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.88946015424165 20.925449871465297 14.113110539845758 28.071979434447304 2 29.8343949044586 26.47133757961783 27.694267515923563 16.0 3 20.865335381464416 28.673835125448026 29.416282642089094 21.044546850998465 4 24.39150699119627 32.72915587778353 23.977213878819263 18.90212325220093 5 25.36964980544747 36.00518806744488 21.763942931258107 16.861219195849547 6 22.451081359423274 37.100926879505664 23.249227600411945 17.198764160659113 7 20.44284243048404 22.142121524201855 38.825952626158596 18.58908341915551 8 22.525070712265364 25.636410388274623 27.282077654924148 24.556441244535872 9 23.308464111139696 23.97736043220993 29.740159506045792 22.974015950604578 10-14 23.350018060787452 29.139790494865576 26.513235977088602 20.99695546725837 15-19 23.655523255813954 27.491694352159467 27.57475083056478 21.278031561461795 20-24 23.89677419354839 28.07225806451613 26.838709677419352 21.19225806451613 25-29 24.018773531383776 28.057145804322037 26.896694001753573 21.027386662540614 30-34 23.17973063625574 27.87037514835647 27.658805923938285 21.291088291449505 35-39 23.43451057448679 28.248616784735507 27.02828481307203 21.288587827705673 40-44 24.103203031718838 27.33219124746924 27.342573846233716 21.222031874578207 45-49 23.5187298951956 27.49818408218325 28.00664107087268 20.97644495174847 50-54 24.379675006448284 27.50580345628063 27.81016249677586 20.30435904049523 55-59 24.313867106892282 27.79612051176228 27.73937267849773 20.15063970284771 60-64 23.77586295856767 28.290593880604714 27.795263402301224 20.13827975852639 65-69 23.78623281676363 27.45713844411265 27.977140503526748 20.779488235596975 70-74 24.12662637024895 27.9018543182051 27.18471468087286 20.786804630673085 75-79 24.015990159901598 27.121771217712176 28.49528495284953 20.366953669536695 80-84 24.606197879131063 27.741171625656335 27.597034901678164 20.055595593534438 85-89 24.01396342416506 27.83827437086438 27.62465482207055 20.523107382900015 90-94 23.95413372427876 27.535473061416827 27.729200481700612 20.781192732603802 95-99 24.124573907654167 27.936163619460803 27.807044726784426 20.132217746100608 100-104 24.180517676117944 27.06735964596305 28.019348530849587 20.732774147069417 105-109 24.234429960686942 27.736395613490583 27.80881440099317 20.220360024829297 110-114 24.823980120107684 27.402153655001037 27.412507765582937 20.361358459308345 115-119 24.351451513279805 27.645666049001445 27.645666049001445 20.357216388717315 120-124 25.29441884280594 28.064516129032256 27.025089605734763 19.615975422427034 125-129 25.083039236039028 27.28357899107328 27.195349802781816 20.438031970105875 130-134 25.147285175946077 27.923146329812642 27.41361923464784 19.51594925959344 135-139 25.472921846286887 27.84563830937196 27.1051778186142 19.576262025726948 140-144 24.92753623188406 27.716707683893905 27.612797374897458 19.742958709324583 145-149 25.90863267363506 27.601209741603437 27.054703666366 19.435453918395503 150-151 25.865209471766846 28.024980483996874 26.424668227946917 19.685141816289356 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 82.0 1 46.5 2 7.5 3 3.0 4 1.5 5 2.5 6 3.0 7 2.0 8 2.0 9 1.0 10 0.5 11 1.0 12 2.0 13 2.5 14 1.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 1.5 21 1.5 22 1.0 23 0.5 24 1.5 25 2.0 26 2.5 27 4.0 28 3.5 29 5.5 30 9.0 31 10.5 32 15.0 33 26.0 34 33.5 35 45.5 36 73.5 37 100.5 38 125.0 39 148.5 40 187.5 41 232.5 42 242.0 43 255.5 44 293.5 45 305.5 46 279.5 47 247.0 48 230.5 49 209.0 50 164.5 51 127.0 52 107.5 53 88.5 54 78.5 55 55.0 56 35.5 57 32.0 58 20.5 59 18.0 60 14.5 61 10.0 62 8.0 63 4.0 64 3.0 65 3.5 66 2.5 67 3.0 68 3.0 69 2.5 70 2.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.75 2 1.875 3 2.35 4 3.45 5 3.6249999999999996 6 2.9000000000000004 7 2.9000000000000004 8 2.775 9 2.825 10-14 3.105 15-19 3.6799999999999997 20-24 3.125 25-29 3.055 30-34 3.105 35-39 3.305 40-44 3.685 45-49 3.63 50-54 3.075 55-59 3.08 60-64 3.0949999999999998 65-69 2.8850000000000002 70-74 2.39 75-79 2.44 80-84 2.87 85-89 4.035 90-94 4.505 95-99 3.19 100-104 2.835 105-109 3.34 110-114 3.42 115-119 2.86 120-124 2.35 125-129 3.66 130-134 5.795 135-139 7.489999999999999 140-144 8.575000000000001 145-149 5.765 150-151 3.925 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.43444730077121 96.7 2 0.3856041131105398 0.75 3 0.051413881748071974 0.15 4 0.025706940874035987 0.1 5 0.051413881748071974 0.25 6 0.0 0.0 7 0.025706940874035987 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025706940874035987 1.875 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 75 1.875 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.3375 0.0 0.0 0.0 0.0 110-111 2.6 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.15 0.0 0.0 0.0 0.0 120-121 4.425 0.0 0.0 0.0 0.0 122-123 4.675 0.0 0.0 0.0 0.0 124-125 5.1375 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.25 0.0 0.0 0.0 0.0 136-137 7.699999999999999 0.0 0.0 0.0 0.0 138-139 8.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665078 spots for SRR7169974.sra Written 665078 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra Read 665074 spots for SRR7169974.sra Written 665074 spots for SRR7169974.sra SRR ids: ['SRR7169974.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ixgvzasl SRR7169974.sra spots: 13301484 blocks: [[1, 665074], [665075, 1330148], [1330149, 1995222], [1995223, 2660296], [2660297, 3325370], [3325371, 3990444], [3990445, 4655518], [4655519, 5320592], [5320593, 5985666], [5985667, 6650740], [6650741, 7315814], [7315815, 7980888], [7980889, 8645962], [8645963, 9311036], [9311037, 9976110], [9976111, 10641184], [10641185, 11306258], [11306259, 11971332], [11971333, 12636406], [12636407, 13301484]] SRR7169974 file size 4485736 SRR7169974 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169974 SRR7169974_1.fastq SRR7169974_2.fastq Input file: SRR7169974_1.fastq Paired file: SRR7169974_2.fastq trimmed: SRR7169974-trimmed-pair1.fastq, SRR7169974-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:03:59 2025 >> started Wed Feb 12 07:04:14 2025 >> done (15.785s) 13301484 read pairs processed; of these: 13749 ( 0.10%) short read pairs filtered out after trimming by size control 36703 ( 0.28%) empty read pairs filtered out after trimming by size control 13251032 (99.62%) read pairs available; of these: 6160926 (46.49%) trimmed read pairs available after processing 7090106 (53.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 5 0.00% 24 6 0.00% 25 2 0.00% 26 7 0.00% 27 2 0.00% 28 6 0.00% 29 5 0.00% 30 9 0.00% 31 10 0.00% 32 8 0.00% 33 12 0.00% 34 13 0.00% 35 18 0.00% 36 20 0.00% 37 30 0.00% 38 22 0.00% 39 25 0.00% 40 34 0.00% 41 29 0.00% 42 36 0.00% 43 26 0.00% 44 40 0.00% 45 51 0.00% 46 60 0.00% 47 79 0.00% 48 82 0.00% 49 93 0.00% 50 133 0.00% 51 116 0.00% 52 155 0.00% 53 150 0.00% 54 168 0.00% 55 163 0.00% 56 223 0.00% 57 214 0.00% 58 225 0.00% 59 259 0.00% 60 358 0.00% 61 388 0.00% 62 478 0.00% 63 520 0.00% 64 580 0.00% 65 636 0.00% 66 688 0.01% 67 815 0.01% 68 865 0.01% 69 1202 0.01% 70 1848 0.01% 71 1708 0.01% 72 1672 0.01% 73 1856 0.01% 74 1957 0.01% 75 2276 0.02% 76 2365 0.02% 77 2561 0.02% 78 2855 0.02% 79 3130 0.02% 80 3547 0.03% 81 4006 0.03% 82 4481 0.03% 83 4978 0.04% 84 6200 0.05% 85 6947 0.05% 86 7547 0.06% 87 7843 0.06% 88 8454 0.06% 89 8898 0.07% 90 9550 0.07% 91 10047 0.08% 92 10759 0.08% 93 11778 0.09% 94 12432 0.09% 95 13367 0.10% 96 13865 0.10% 97 14907 0.11% 98 15439 0.12% 99 15987 0.12% 100 17009 0.13% 101 17251 0.13% 102 18222 0.14% 103 19168 0.14% 104 20089 0.15% 105 21175 0.16% 106 22226 0.17% 107 23214 0.18% 108 23660 0.18% 109 24359 0.18% 110 24947 0.19% 111 25623 0.19% 112 26444 0.20% 113 27297 0.21% 114 28510 0.22% 115 30063 0.23% 116 31308 0.24% 117 32068 0.24% 118 33505 0.25% 119 33336 0.25% 120 33975 0.26% 121 35182 0.27% 122 35907 0.27% 123 36989 0.28% 124 38531 0.29% 125 40205 0.30% 126 41721 0.31% 127 43136 0.33% 128 44351 0.33% 129 45202 0.34% 130 47161 0.36% 131 48378 0.37% 132 48963 0.37% 133 51858 0.39% 134 53541 0.40% 135 55628 0.42% 136 59207 0.45% 137 62651 0.47% 138 67488 0.51% 139 72842 0.55% 140 75640 0.57% 141 81149 0.61% 142 87205 0.66% 143 94053 0.71% 144 104111 0.79% 145 117709 0.89% 146 141096 1.06% 147 176421 1.33% 148 256387 1.93% 149 487069 3.68% 150 2855358 21.55% 151 7090106 53.51% 13251032 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=226.76 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=42 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=8 fanout-score=45.42 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=11.8 sequence=TGTTGGTGGTGG SRR7169974 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:04:58 Started mapping on | Feb 12 07:04:58 Finished on | Feb 12 07:06:38 Mapping speed, Million of reads per hour | 477.04 Number of input reads | 13251032 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12396335 Uniquely mapped reads % | 93.55% Average mapped length | 291.91 Number of splices: Total | 11339347 Number of splices: Annotated (sjdb) | 11141104 Number of splices: GT/AG | 11175755 Number of splices: GC/AG | 128810 Number of splices: AT/AC | 10136 Number of splices: Non-canonical | 24646 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227420 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 192252 % of reads mapped to too many loci | 1.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639398 639398 639398 N_multimapping 227420 227420 227420 N_noFeature 274129 12237195 346475 N_ambiguous 136749 843 49332 UnstrandedReadsAssigned:11985457 PositiveStrandReadsAssigned:158297 NegativeStrandReadsAssigned:12000528 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169974 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169974-trimmed-pair1.fastq SRR7169974-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,251,032 reads, 12,065,710 reads pseudoaligned [quant] estimated average fragment length: 224.494 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7169974.ke.tsv 34699 SRR7169974.se.tsv 87100 total ==> SRR7169974.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.51 199 8.80598 Potri.005G024800.1.v4.1 1035 811.506 26 2.5442 Potri.004G059700.1.v4.1 961 737.535 3 0.323004 Potri.007G009000.2.v4.1 1416 1192.51 0 0 Potri.003G141000.2.v4.1 2943 2719.51 176 5.13916 Potri.016G087400.1.v4.1 270 87.3715 1524 1385.11 Potri.015G069301.1.v4.1 564 343.99 0 0 Potri.010G195200.1.v4.1 1773 1549.51 15 0.768719 Potri.012G127500.1.v4.1 977 753.518 3262 343.764 ==> SRR7169974.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1073 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169974 completed mapping pipeline successfully