Starting /dee2/code/volunteer_pipeline.sh SRR7169975 current disk space = 3050343034880 free memory = 1579162720 SRR7169975 SRAfilesize d2ae36299fa6787e4185fd40b1d93d20 SRR7169975.sra SRR7169975.sra file validated SRR7169975 is paired end SRR7169975 is conventional basespace SRR7169975 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169975_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13725 34.0 33.0 34.0 33.0 34.0 2 33.457 34.0 34.0 34.0 33.0 34.0 3 33.48875 34.0 34.0 34.0 33.0 34.0 4 33.46875 34.0 34.0 34.0 33.0 34.0 5 33.47775 34.0 34.0 34.0 33.0 34.0 6 37.18525 38.0 38.0 38.0 36.0 38.0 7 37.4525 38.0 38.0 38.0 37.0 38.0 8 37.529 38.0 38.0 38.0 37.0 38.0 9 37.489 38.0 38.0 38.0 37.0 38.0 10-14 37.4933 38.0 38.0 38.0 37.8 38.0 15-19 37.516850000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.438750000000006 38.0 38.0 38.0 37.6 38.0 25-29 37.43579999999999 38.0 38.0 38.0 37.6 38.0 30-34 37.446299999999994 38.0 38.0 38.0 37.6 38.0 35-39 37.36815 38.0 38.0 38.0 37.0 38.0 40-44 37.2981 38.0 38.0 38.0 37.0 38.0 45-49 37.11775 38.0 38.0 38.0 36.0 38.0 50-54 37.13805 38.0 38.0 38.0 36.2 38.0 55-59 37.04485 38.0 38.0 38.0 36.0 38.0 60-64 37.026199999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.94345 38.0 38.0 38.0 35.8 38.0 70-74 36.947799999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.791700000000006 38.0 38.0 38.0 35.0 38.0 80-84 36.68555 38.0 38.0 38.0 34.4 38.0 85-89 36.626549999999995 38.0 38.0 38.0 34.4 38.0 90-94 36.386849999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.2069 38.0 38.0 38.0 34.0 38.0 100-104 36.10785 38.0 37.6 38.0 33.2 38.0 105-109 36.15345 38.0 37.2 38.0 33.2 38.0 110-114 35.88845 38.0 37.0 38.0 32.6 38.0 115-119 35.7901 38.0 37.0 38.0 31.6 38.0 120-124 35.5895 38.0 36.8 38.0 30.8 38.0 125-129 35.3437 38.0 36.0 38.0 30.0 38.0 130-134 34.750750000000004 38.0 35.6 38.0 27.2 38.0 135-139 34.261250000000004 38.0 35.0 38.0 24.0 38.0 140-144 34.01365 38.0 35.0 38.0 23.0 38.0 145-149 33.052749999999996 38.0 34.4 38.0 15.4 38.0 150-151 29.414625 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 2.0 17 0.0 18 2.0 19 5.0 20 4.0 21 9.0 22 12.0 23 7.0 24 21.0 25 14.0 26 25.0 27 29.0 28 34.0 29 40.0 30 42.0 31 53.0 32 77.0 33 93.0 34 141.0 35 241.0 36 657.0 37 2484.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.72016149381781 11.65783497350492 9.109260661115316 36.51274287156195 2 23.075000000000003 15.925 33.375 27.625 3 19.075 22.075 27.6 31.25 4 22.575 29.475 23.75 24.2 5 21.625 34.725 23.1 20.549999999999997 6 19.2 36.05 25.1 19.650000000000002 7 13.875000000000002 25.15 41.199999999999996 19.775000000000002 8 18.8 26.85 30.099999999999998 24.25 9 16.675 25.55 32.75 25.025 10-14 20.055 29.935000000000002 26.740000000000002 23.27 15-19 19.97 28.799999999999997 27.939999999999998 23.29 20-24 19.405 29.315 27.83 23.45 25-29 20.16 29.56 26.655 23.625 30-34 19.86 29.42 26.955000000000002 23.765 35-39 19.865 28.605000000000004 27.405 24.125 40-44 20.549999999999997 29.03 26.91 23.51 45-49 19.68657687878636 28.818905522455314 27.316877785009762 24.17763981374856 50-54 19.535 29.01 27.63 23.825 55-59 20.195 28.665000000000003 27.015 24.125 60-64 20.424999999999997 28.59 26.87 24.115000000000002 65-69 20.175 28.810000000000002 27.145000000000003 23.87 70-74 20.27 28.595 27.455000000000002 23.68 75-79 20.349999999999998 28.675 27.279999999999998 23.695 80-84 20.185 28.76 27.38 23.674999999999997 85-89 20.579260667300286 28.282727227252263 27.26727027162223 23.87074183382522 90-94 20.192693697310318 28.427338418305904 27.057406663990363 24.322561220393414 95-99 20.1963251950667 28.52756103699975 27.525799144223505 23.750314623710043 100-104 20.8970182911551 28.524179403658227 27.04084189426209 23.53796041092458 105-109 20.458068710306545 28.354253137970698 27.62914437165575 23.55853378006701 110-114 20.14622665130953 28.088537232710703 27.642846411938503 24.122389704041264 115-119 20.875 28.075 27.42 23.630000000000003 120-124 20.945 28.23 27.155 23.669999999999998 125-129 21.115000000000002 28.78 26.745 23.36 130-134 20.334219902644655 27.87173182114719 27.50037637376424 24.29367190244392 135-139 21.245089150800847 28.195829555757022 26.49843860179309 24.060642691649036 140-144 21.14437857932282 29.041495026625135 26.323721491007735 23.49040490304431 145-149 20.98691138859636 28.55924978687127 25.8663056015245 24.587533223007874 150-151 21.011137529720937 28.444500062570395 26.24202227505944 24.30234013264923 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 3.5 26 3.5 27 8.5 28 14.0 29 14.5 30 16.5 31 22.5 32 29.5 33 36.0 34 58.0 35 78.5 36 81.5 37 108.0 38 135.5 39 146.0 40 180.5 41 225.0 42 247.0 43 263.0 44 278.0 45 266.5 46 251.5 47 255.0 48 244.0 49 219.0 50 174.0 51 137.5 52 116.5 53 92.0 54 79.0 55 53.0 56 39.5 57 31.5 58 20.0 59 14.0 60 11.0 61 9.0 62 6.0 63 5.5 64 4.0 65 4.5 66 4.5 67 3.0 68 1.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.135 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.045 90-94 0.36 95-99 0.675 100-104 0.22499999999999998 105-109 0.015 110-114 0.155 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.365 135-139 0.73 140-144 0.47000000000000003 145-149 0.295 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.8375000000000004 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.575 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.575 0.0 0.0 0.0 0.0 130-131 6.075 0.0 0.0 0.0 0.0 132-133 6.65 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.9375 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTAAT 10 0.0068910434 144.575 6 >>END_MODULE SRR7169975 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169975_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10775 33.0 33.0 34.0 32.0 34.0 2 32.24075 33.0 33.0 34.0 32.0 34.0 3 32.13625 34.0 33.0 34.0 32.0 34.0 4 31.7845 34.0 33.0 34.0 31.0 34.0 5 31.81075 34.0 33.0 34.0 31.0 34.0 6 35.9475 38.0 38.0 38.0 34.0 38.0 7 36.0155 38.0 38.0 38.0 35.0 38.0 8 35.91275 38.0 38.0 38.0 34.0 38.0 9 35.899 38.0 38.0 38.0 34.0 38.0 10-14 35.8519 38.0 38.0 38.0 34.6 38.0 15-19 35.63865 38.0 38.0 38.0 34.0 38.0 20-24 35.82505 38.0 38.0 38.0 34.6 38.0 25-29 35.9187 38.0 38.0 38.0 35.0 38.0 30-34 35.91265 38.0 38.0 38.0 34.8 38.0 35-39 35.7678 38.0 38.0 38.0 34.2 38.0 40-44 35.653 38.0 38.0 38.0 34.0 38.0 45-49 35.61794999999999 38.0 38.0 38.0 33.8 38.0 50-54 35.88725 38.0 38.0 38.0 34.4 38.0 55-59 35.7875 38.0 38.0 38.0 34.0 38.0 60-64 35.7579 38.0 38.0 38.0 34.0 38.0 65-69 35.662800000000004 38.0 38.0 38.0 33.8 38.0 70-74 35.618 38.0 38.0 38.0 33.6 38.0 75-79 35.55545 38.0 38.0 38.0 33.0 38.0 80-84 35.4277 38.0 38.0 38.0 32.4 38.0 85-89 34.94515 38.0 38.0 38.0 29.8 38.0 90-94 34.51445 38.0 38.0 38.0 26.0 38.0 95-99 34.95315000000001 38.0 38.0 38.0 28.2 38.0 100-104 35.079899999999995 38.0 38.0 38.0 29.6 38.0 105-109 34.83725 38.0 37.2 38.0 28.2 38.0 110-114 34.74745 38.0 37.2 38.0 27.6 38.0 115-119 34.380449999999996 38.0 36.6 38.0 24.6 38.0 120-124 34.3011 38.0 36.0 38.0 24.0 38.0 125-129 33.81699999999999 38.0 35.8 38.0 19.8 38.0 130-134 32.72485 38.0 35.2 38.0 9.2 38.0 135-139 31.540300000000002 38.0 33.8 38.0 2.0 38.0 140-144 30.52355 38.0 32.2 38.0 2.0 38.0 145-149 29.875099999999996 38.0 30.6 38.0 2.0 38.0 150-151 26.204125 34.5 15.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 121.0 3 6.0 4 2.0 5 0.0 6 2.0 7 2.0 8 3.0 9 4.0 10 3.0 11 4.0 12 6.0 13 4.0 14 2.0 15 4.0 16 5.0 17 4.0 18 7.0 19 13.0 20 12.0 21 16.0 22 11.0 23 17.0 24 25.0 25 25.0 26 35.0 27 39.0 28 31.0 29 45.0 30 47.0 31 83.0 32 95.0 33 125.0 34 155.0 35 204.0 36 483.0 37 2360.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.89864692366607 20.95991830482512 13.096757722746998 25.04467704876181 2 27.316700610997962 26.527494908350306 30.320773930753564 15.835030549898166 3 19.994886218358477 28.509332651495782 31.44975709537203 20.046024034773716 4 22.81064324463963 34.073882717644025 23.482304314130715 19.633169723585635 5 24.780134505949302 35.77340920848422 22.115882048629075 17.3305742369374 6 20.401337792642142 37.40674041677386 22.253666066375096 19.9382557242089 7 19.41872427983539 22.093621399176953 38.348765432098766 20.13888888888889 8 22.253593429158112 25.924024640657084 26.771047227926076 25.051334702258725 9 20.782899819727017 25.39273757404069 29.436003090394024 24.38835951583827 10-14 23.45449858210879 28.631090487238982 26.5790152101057 21.335395720546533 15-19 23.431657665143334 28.043207312006647 27.523888658080597 21.001246364769422 20-24 22.91312193864398 27.97628254704821 27.83191544212426 21.278680072183555 25-29 23.86100386100386 27.629343629343627 27.21235521235521 21.297297297297295 30-34 22.628489030796167 27.61355443403028 28.597177876197343 21.160778658976206 35-39 23.00588174594985 27.804148178722528 27.953771540604684 21.236198534722938 40-44 23.40557917660479 28.098102250337032 27.95810432438038 20.538214248677797 45-49 23.314854152634577 27.27319827988187 28.09698979327496 21.31495777420859 50-54 23.155621818929617 27.674669682792658 27.957431494524705 21.212277003753023 55-59 22.96566987492923 27.448659220752486 28.776571105049154 20.809099799269134 60-64 22.783118285097416 28.036806662211482 28.417210713000568 20.762864339690537 65-69 23.627954779033917 27.826310380267216 28.144912641315518 20.40082219938335 70-74 23.564538355535138 27.75481039146634 28.51528607155617 20.16536518144235 75-79 23.016845329249616 27.891781521184278 28.392036753445637 20.69933639612047 80-84 23.658511513157894 27.554481907894733 28.64925986842105 20.137746710526315 85-89 23.474227341429092 27.435242612185334 28.243081252931674 20.8474487934539 90-94 23.429291868039503 27.715906703088883 28.141416263920995 20.71338516495062 95-99 23.750580225901285 27.92304915158079 27.58780751972768 20.73856310279024 100-104 23.600985727487423 27.220453845364002 28.344799260704384 20.83376116644419 105-109 24.205265598433716 26.838064815291872 28.641351950126232 20.31531763614818 110-114 24.039997938250607 27.66867687232617 27.957321787536728 20.3340034018865 115-119 24.357003791372065 27.35936059022441 28.03565939133108 20.247976227072446 120-124 23.754516309602565 27.51005037911557 28.090173528064728 20.645259783217142 125-129 24.65265223903724 27.369454057125147 27.67935540519601 20.2985382986416 130-134 25.291393900686572 27.19676406408005 27.54803342381181 19.963808611421577 135-139 24.846040656166547 27.79443021418061 27.293040492669903 20.066488636982942 140-144 25.036027047999116 27.790710564238996 27.153308945793146 20.01995344196874 145-149 25.38887705092691 27.786064351161304 27.306626891114426 19.518431706797358 150-151 25.74129224394665 27.424575941991453 28.007251068237732 18.826880745824162 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 76.0 1 40.0 2 3.5 3 2.0 4 1.0 5 4.5 6 7.0 7 4.5 8 2.5 9 1.5 10 1.0 11 1.0 12 1.5 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 0.5 24 3.5 25 5.0 26 6.0 27 6.5 28 5.0 29 6.0 30 11.0 31 18.5 32 23.5 33 32.0 34 47.5 35 66.0 36 82.5 37 95.5 38 118.0 39 153.0 40 197.5 41 234.5 42 261.0 43 278.0 44 271.5 45 259.5 46 277.0 47 268.5 48 222.0 49 187.5 50 160.0 51 143.0 52 111.0 53 79.5 54 66.5 55 50.5 56 37.0 57 30.5 58 20.5 59 17.5 60 12.5 61 4.0 62 3.5 63 3.0 64 2.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.075 2 1.7999999999999998 3 2.225 4 3.225 5 3.35 6 2.825 7 2.8000000000000003 8 2.6 9 2.9250000000000003 10-14 3.025 15-19 3.7199999999999998 20-24 3.025 25-29 2.875 30-34 2.91 35-39 3.09 40-44 3.5700000000000003 45-49 3.495 50-54 2.7449999999999997 55-59 2.855 60-64 2.735 65-69 2.7 70-74 2.035 75-79 2.0500000000000003 80-84 2.7199999999999998 85-89 4.0649999999999995 90-94 4.82 95-99 3.055 100-104 2.6100000000000003 105-109 2.955 110-114 2.995 115-119 2.41 120-124 1.745 125-129 3.195 130-134 6.055 135-139 8.254999999999999 140-144 9.790000000000001 145-149 6.140000000000001 150-151 3.4625000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51344430217671 97.15 2 0.3841229193341869 0.75 3 0.05121638924455826 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02560819462227913 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02560819462227913 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 72 1.7999999999999998 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.7125000000000004 0.0 0.0 0.0 0.0 120-121 4.050000000000001 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.012499999999999 0.0 0.0 0.0 0.0 128-129 5.35 0.0 0.0 0.0 0.0 130-131 5.7875 0.0 0.0 0.0 0.0 132-133 6.2625 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 7.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCCCC 10 0.0070736585 143.26923 7 >>END_MODULE Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817303 spots for SRR7169975.sra Written 817303 spots for SRR7169975.sra Read 817314 spots for SRR7169975.sra Written 817314 spots for SRR7169975.sra SRR ids: ['SRR7169975.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mzmhx8zk SRR7169975.sra spots: 16346071 blocks: [[1, 817303], [817304, 1634606], [1634607, 2451909], [2451910, 3269212], [3269213, 4086515], [4086516, 4903818], [4903819, 5721121], [5721122, 6538424], [6538425, 7355727], [7355728, 8173030], [8173031, 8990333], [8990334, 9807636], [9807637, 10624939], [10624940, 11442242], [11442243, 12259545], [12259546, 13076848], [13076849, 13894151], [13894152, 14711454], [14711455, 15528757], [15528758, 16346071]] SRR7169975 file size 5517446 SRR7169975 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169975 SRR7169975_1.fastq SRR7169975_2.fastq Input file: SRR7169975_1.fastq Paired file: SRR7169975_2.fastq trimmed: SRR7169975-trimmed-pair1.fastq, SRR7169975-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:31:39 2025 >> started Wed Feb 12 06:31:57 2025 >> done (17.512s) 16346071 read pairs processed; of these: 24266 ( 0.15%) short read pairs filtered out after trimming by size control 44085 ( 0.27%) empty read pairs filtered out after trimming by size control 16277720 (99.58%) read pairs available; of these: 8028109 (49.32%) trimmed read pairs available after processing 8249611 (50.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 0 0.00% 22 7 0.00% 23 7 0.00% 24 6 0.00% 25 5 0.00% 26 11 0.00% 27 7 0.00% 28 9 0.00% 29 12 0.00% 30 10 0.00% 31 3 0.00% 32 10 0.00% 33 14 0.00% 34 7 0.00% 35 14 0.00% 36 14 0.00% 37 17 0.00% 38 27 0.00% 39 28 0.00% 40 29 0.00% 41 40 0.00% 42 40 0.00% 43 40 0.00% 44 43 0.00% 45 48 0.00% 46 50 0.00% 47 70 0.00% 48 79 0.00% 49 94 0.00% 50 107 0.00% 51 139 0.00% 52 142 0.00% 53 179 0.00% 54 177 0.00% 55 179 0.00% 56 189 0.00% 57 207 0.00% 58 223 0.00% 59 311 0.00% 60 375 0.00% 61 456 0.00% 62 506 0.00% 63 566 0.00% 64 574 0.00% 65 700 0.00% 66 766 0.00% 67 875 0.01% 68 1014 0.01% 69 1173 0.01% 70 1500 0.01% 71 1573 0.01% 72 1783 0.01% 73 2095 0.01% 74 2155 0.01% 75 2390 0.01% 76 2629 0.02% 77 2702 0.02% 78 2971 0.02% 79 3424 0.02% 80 3856 0.02% 81 4545 0.03% 82 5230 0.03% 83 5817 0.04% 84 7286 0.04% 85 8183 0.05% 86 8477 0.05% 87 8958 0.06% 88 9435 0.06% 89 9841 0.06% 90 10583 0.07% 91 11785 0.07% 92 12627 0.08% 93 13811 0.08% 94 14808 0.09% 95 15502 0.10% 96 16382 0.10% 97 16500 0.10% 98 16827 0.10% 99 17500 0.11% 100 18476 0.11% 101 19758 0.12% 102 21368 0.13% 103 22706 0.14% 104 23719 0.15% 105 25085 0.15% 106 25765 0.16% 107 26279 0.16% 108 26581 0.16% 109 27401 0.17% 110 27936 0.17% 111 29100 0.18% 112 30849 0.19% 113 32850 0.20% 114 34670 0.21% 115 35797 0.22% 116 36899 0.23% 117 37797 0.23% 118 38311 0.24% 119 38630 0.24% 120 39268 0.24% 121 40366 0.25% 122 42812 0.26% 123 44680 0.27% 124 47462 0.29% 125 48844 0.30% 126 50579 0.31% 127 52406 0.32% 128 53142 0.33% 129 54670 0.34% 130 55928 0.34% 131 58255 0.36% 132 61326 0.38% 133 64991 0.40% 134 68952 0.42% 135 73072 0.45% 136 77275 0.47% 137 81782 0.50% 138 88135 0.54% 139 95733 0.59% 140 100984 0.62% 141 110069 0.68% 142 119310 0.73% 143 130651 0.80% 144 147544 0.91% 145 169958 1.04% 146 205377 1.26% 147 269169 1.65% 148 381629 2.34% 149 710927 4.37% 150 3652050 22.44% 151 8249611 50.68% 16277720 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=29 prefix-density=0.19 prefix-fanout=2.8 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=262.73 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=3.1 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=282.50 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.3 sequence=AAGAAGAAGAAG SRR7169975 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:32:38 Started mapping on | Feb 12 06:32:38 Finished on | Feb 12 06:33:56 Mapping speed, Million of reads per hour | 751.28 Number of input reads | 16277720 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15564554 Uniquely mapped reads % | 95.62% Average mapped length | 291.89 Number of splices: Total | 14984415 Number of splices: Annotated (sjdb) | 14736503 Number of splices: GT/AG | 14764418 Number of splices: GC/AG | 176505 Number of splices: AT/AC | 12642 Number of splices: Non-canonical | 30850 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293156 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 26515 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439743 439743 439743 N_multimapping 293156 293156 293156 N_noFeature 349387 15383666 442719 N_ambiguous 145604 1144 57157 UnstrandedReadsAssigned:15069563 PositiveStrandReadsAssigned:179744 NegativeStrandReadsAssigned:15064678 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169975 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169975-trimmed-pair1.fastq SRR7169975-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,277,720 reads, 14,980,036 reads pseudoaligned [quant] estimated average fragment length: 234.168 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR7169975.ke.tsv 34699 SRR7169975.se.tsv 87100 total ==> SRR7169975.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.83 292 11.1658 Potri.005G024800.1.v4.1 1035 801.832 25 2.12795 Potri.004G059700.1.v4.1 961 727.871 65 6.09486 Potri.007G009000.2.v4.1 1416 1182.83 0 0 Potri.003G141000.2.v4.1 2943 2709.83 334.165 8.41633 Potri.016G087400.1.v4.1 270 86.4021 1598 1262.29 Potri.015G069301.1.v4.1 564 336.962 0 0 Potri.010G195200.1.v4.1 1773 1539.83 11 0.487555 Potri.012G127500.1.v4.1 977 743.848 5971 547.857 ==> SRR7169975.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 946 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169975 completed mapping pipeline successfully