Starting /dee2/code/volunteer_pipeline.sh SRR7169976 current disk space = 3050259709952 free memory = 1397966516 SRR7169976 SRAfilesize 1450e9978ea47f9fd251fa36a8a4d3c1 SRR7169976.sra SRR7169976.sra file validated SRR7169976 is paired end SRR7169976 is conventional basespace SRR7169976 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169976_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.195 34.0 33.0 34.0 33.0 34.0 2 33.4995 34.0 34.0 34.0 33.0 34.0 3 33.496 34.0 34.0 34.0 33.0 34.0 4 33.5615 34.0 34.0 34.0 33.0 34.0 5 33.508 34.0 34.0 34.0 33.0 34.0 6 37.27925 38.0 38.0 38.0 36.0 38.0 7 37.48975 38.0 38.0 38.0 37.0 38.0 8 37.547 38.0 38.0 38.0 37.0 38.0 9 37.5065 38.0 38.0 38.0 38.0 38.0 10-14 37.564499999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.5332 38.0 38.0 38.0 38.0 38.0 20-24 37.527150000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.47075 38.0 38.0 38.0 37.8 38.0 30-34 37.50655 38.0 38.0 38.0 38.0 38.0 35-39 37.43035 38.0 38.0 38.0 37.2 38.0 40-44 37.314299999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.20505000000001 38.0 38.0 38.0 36.6 38.0 50-54 37.21775 38.0 38.0 38.0 36.4 38.0 55-59 37.1777 38.0 38.0 38.0 36.0 38.0 60-64 37.097500000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.02345 38.0 38.0 38.0 36.0 38.0 70-74 37.0479 38.0 38.0 38.0 36.0 38.0 75-79 36.899649999999994 38.0 38.0 38.0 35.6 38.0 80-84 36.856100000000005 38.0 38.0 38.0 35.2 38.0 85-89 36.7506 38.0 38.0 38.0 35.0 38.0 90-94 36.621399999999994 38.0 38.0 38.0 34.6 38.0 95-99 36.42145000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.32695 38.0 38.0 38.0 34.0 38.0 105-109 36.3073 38.0 38.0 38.0 34.0 38.0 110-114 36.17805 38.0 37.6 38.0 33.6 38.0 115-119 35.99745 38.0 37.0 38.0 33.0 38.0 120-124 35.8243 38.0 37.0 38.0 32.6 38.0 125-129 35.60145 38.0 36.6 38.0 31.2 38.0 130-134 34.98265 38.0 36.0 38.0 28.2 38.0 135-139 34.59095 38.0 35.2 38.0 26.6 38.0 140-144 34.56419999999999 38.0 35.2 38.0 26.8 38.0 145-149 33.604099999999995 38.0 35.0 38.0 20.6 38.0 150-151 29.728125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 3.0 18 1.0 19 4.0 20 5.0 21 3.0 22 3.0 23 8.0 24 12.0 25 17.0 26 23.0 27 20.0 28 31.0 29 35.0 30 44.0 31 47.0 32 74.0 33 88.0 34 129.0 35 256.0 36 569.0 37 2620.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.25662376987131 11.884935654806965 9.462528387585163 37.39591218773656 2 23.525 15.925 33.1 27.450000000000003 3 20.549999999999997 19.225 24.55 35.675000000000004 4 22.575 27.200000000000003 23.200000000000003 27.025 5 21.975 30.825000000000003 25.15 22.05 6 19.75 35.025 24.675 20.549999999999997 7 14.499999999999998 26.924999999999997 40.225 18.35 8 18.475 25.35 29.65 26.525 9 18.125 25.825 31.874999999999996 24.175 10-14 19.81 29.7 27.365000000000002 23.125 15-19 19.895 29.225 27.35 23.53 20-24 19.645000000000003 28.939999999999998 27.644999999999996 23.77 25-29 19.81 28.994999999999997 27.67 23.525 30-34 20.080000000000002 28.4 27.750000000000004 23.77 35-39 20.025000000000002 28.515 27.474999999999998 23.985 40-44 20.145 29.025000000000002 27.075 23.755000000000003 45-49 20.167142070760146 28.339088224991244 27.203122654256116 24.290647049992494 50-54 19.759999999999998 28.785 27.555000000000003 23.9 55-59 19.895 29.12 27.01 23.974999999999998 60-64 20.455000000000002 28.88 26.900000000000002 23.765 65-69 20.395 28.28 27.42 23.905 70-74 19.955000000000002 28.470000000000002 27.765 23.810000000000002 75-79 20.285 28.78 27.01 23.925 80-84 20.349999999999998 28.425 27.48 23.745 85-89 20.41408281656331 27.820564112822566 27.640528105621126 24.124824964993 90-94 20.706766917293233 28.000000000000004 27.644110275689222 23.649122807017545 95-99 19.945684972842486 27.972238986119493 27.695634681150672 24.386441359887346 100-104 20.381495944728147 28.06648643236207 27.09522379092821 24.456793831981578 105-109 20.57602880144007 28.741437071853593 27.2013600680034 23.481174058702937 110-114 20.5124355702347 28.804483811239557 27.403292798879047 23.2797878196467 115-119 20.61 28.525 27.055 23.810000000000002 120-124 20.75 28.185 26.87 24.195 125-129 21.32 28.54 26.415 23.724999999999998 130-134 20.63484103901314 28.417410490422224 26.73252432052954 24.2152241500351 135-139 21.289770438985098 28.48872331856625 26.339105920257754 23.882400322190897 140-144 21.342625087736888 28.271332598014638 25.779604933319966 24.606437380928504 145-149 21.60781367392938 28.16929626846982 26.155772602053595 24.06711745554721 150-151 21.085542771385693 28.151575787893947 26.063031515757878 24.69984992496248 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 1.0 24 1.5 25 2.5 26 3.0 27 4.5 28 7.5 29 10.0 30 12.0 31 19.5 32 30.0 33 40.0 34 56.5 35 70.5 36 85.0 37 101.0 38 108.0 39 136.5 40 177.5 41 220.5 42 271.5 43 276.0 44 280.0 45 275.0 46 259.0 47 270.0 48 237.0 49 195.0 50 175.5 51 146.0 52 122.5 53 104.0 54 76.0 55 53.5 56 37.5 57 28.5 58 28.0 59 20.0 60 13.0 61 11.5 62 7.5 63 4.0 64 1.0 65 3.0 66 4.0 67 2.0 68 3.0 69 2.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.08499999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.25 95-99 0.58 100-104 0.13 105-109 0.005 110-114 0.08499999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.29 135-139 0.6799999999999999 140-144 0.27 145-149 0.17500000000000002 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.8375 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.6624999999999996 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.425 0.0 0.0 0.0 0.0 136-137 8.0125 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAGAT 10 0.006420516 147.98718 1 >>END_MODULE SRR7169976 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169976_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1595 33.0 33.0 34.0 32.0 34.0 2 32.26625 33.0 33.0 34.0 32.0 34.0 3 32.2435 34.0 33.0 34.0 32.0 34.0 4 31.94325 34.0 33.0 34.0 32.0 34.0 5 31.914 34.0 33.0 34.0 32.0 34.0 6 36.02875 38.0 38.0 38.0 35.0 38.0 7 36.0305 38.0 38.0 38.0 35.0 38.0 8 36.055 38.0 38.0 38.0 35.0 38.0 9 36.02725 38.0 38.0 38.0 35.0 38.0 10-14 35.971500000000006 38.0 38.0 38.0 35.0 38.0 15-19 35.755649999999996 38.0 38.0 38.0 34.4 38.0 20-24 35.9623 38.0 38.0 38.0 35.2 38.0 25-29 36.00435 38.0 38.0 38.0 35.6 38.0 30-34 36.0339 38.0 38.0 38.0 35.8 38.0 35-39 35.9266 38.0 38.0 38.0 35.0 38.0 40-44 35.755250000000004 38.0 38.0 38.0 34.8 38.0 45-49 35.63805 38.0 38.0 38.0 34.0 38.0 50-54 35.959199999999996 38.0 38.0 38.0 34.8 38.0 55-59 35.93515 38.0 38.0 38.0 35.0 38.0 60-64 35.8843 38.0 38.0 38.0 34.6 38.0 65-69 35.83955 38.0 38.0 38.0 34.4 38.0 70-74 35.8256 38.0 38.0 38.0 34.2 38.0 75-79 35.76885 38.0 38.0 38.0 34.0 38.0 80-84 35.5804 38.0 38.0 38.0 33.2 38.0 85-89 35.1256 38.0 38.0 38.0 30.8 38.0 90-94 34.70495 38.0 38.0 38.0 27.6 38.0 95-99 35.16395 38.0 38.0 38.0 29.2 38.0 100-104 35.226350000000004 38.0 38.0 38.0 31.0 38.0 105-109 35.08855 38.0 38.0 38.0 29.8 38.0 110-114 34.940250000000006 38.0 37.8 38.0 28.8 38.0 115-119 34.66645 38.0 37.0 38.0 27.2 38.0 120-124 34.53985 38.0 37.0 38.0 26.4 38.0 125-129 34.04665 38.0 36.0 38.0 20.6 38.0 130-134 33.058949999999996 38.0 35.6 38.0 11.8 38.0 135-139 31.895349999999997 38.0 34.2 38.0 2.0 38.0 140-144 31.167250000000003 38.0 33.2 38.0 2.0 38.0 145-149 30.498649999999998 38.0 32.2 38.0 2.0 38.0 150-151 26.79875 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 117.0 3 6.0 4 1.0 5 3.0 6 5.0 7 0.0 8 0.0 9 2.0 10 5.0 11 1.0 12 4.0 13 2.0 14 1.0 15 10.0 16 7.0 17 1.0 18 6.0 19 13.0 20 9.0 21 12.0 22 10.0 23 20.0 24 12.0 25 22.0 26 25.0 27 36.0 28 39.0 29 29.0 30 46.0 31 83.0 32 94.0 33 157.0 34 138.0 35 198.0 36 402.0 37 2484.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.038216560509554 20.35668789808917 15.464968152866243 26.140127388535035 2 26.593853187706372 26.720853441706883 29.972059944119888 16.713233426466854 3 20.679091141179473 29.231554761296913 30.3293336737299 19.76002042379372 4 22.983767070342694 34.60448338057201 23.138366400412263 19.273383148673023 5 26.031991744066048 33.384932920536635 22.961816305469558 17.62125902992776 6 20.24145902902646 38.76188029797072 22.861546365271 18.135114307731826 7 21.52938157557095 20.81088016422889 37.31075186040544 20.348986399794715 8 23.16167050986421 24.82705611068409 26.82551883166795 25.185754547783755 9 20.844055584148226 26.351003602676276 28.692743180648485 24.112197632527018 10-14 23.270051962751452 28.656685702526108 26.521582548747237 21.551679785975203 15-19 23.59136660786552 27.11943550897582 28.468403029988586 20.820794853170074 20-24 23.24037867874048 28.838238320642105 26.85737806132949 21.06400493928792 25-29 23.511261956186363 28.262881826596733 27.902910624292915 20.322945592923993 30-34 23.387966911575813 27.6781585572625 27.559985613728617 21.373888917433078 35-39 23.040074173277016 28.067374059956734 28.098279592046975 20.794272174719275 40-44 23.827275551413482 27.518898208553384 28.010769390079737 20.6430568499534 45-49 23.55863782217162 27.740399544560606 27.698995963150814 21.001966670116964 50-54 23.822473063109285 27.680861980502826 27.562852744997436 20.933812211390457 55-59 23.399116044814473 28.142666255524716 27.176482680645492 21.281735019015315 60-64 23.356765354815536 27.4924316280979 27.677151213505052 21.473651803581507 65-69 23.458183683940483 27.593637762955364 27.839917906618776 21.108260646485377 70-74 23.698155507999594 26.95913584021196 27.92723937633751 21.41546927545093 75-79 23.727777494778664 27.308848250216496 28.546686363404817 20.41668789160002 80-84 23.33418825339831 27.51987689151064 28.622723775327007 20.523211079764042 85-89 23.676401686709355 27.242438440314437 28.538705814982563 20.54245405799365 90-94 24.134494334872013 27.900755350398658 27.4339068401175 20.530843474611835 95-99 23.760234821566506 27.431896596117205 28.410319789896494 20.397548792419794 100-104 24.305626729527518 28.067028799836013 26.939633083939736 20.68771138669673 105-109 24.547231940728544 27.325581395348834 27.70631817246347 20.42086849145915 110-114 24.33336765160095 27.808092247503346 27.37053433542675 20.48800576546896 115-119 24.406831662916755 27.81243608099816 27.694825117610968 20.085907138474127 120-124 24.738392766432998 27.64909072437265 27.34938534999492 20.263131159199432 125-129 24.83488132094943 27.920536635706917 27.136222910216716 20.108359133126935 130-134 25.166303017401948 27.8005428130488 26.901176094939068 20.131978074610185 135-139 25.104967555482848 27.689623207372264 27.30247014559136 19.90293909155352 140-144 24.995858870299816 28.55170890618961 26.729611838109435 19.72282038540114 145-149 25.755801575473708 27.65062806046413 26.756440281030446 19.837130083031724 150-151 25.42000516929439 27.836650297234428 27.125872318428534 19.617472215042646 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 68.0 1 35.0 2 2.0 3 2.0 4 4.0 5 3.5 6 3.5 7 5.5 8 2.5 9 1.0 10 2.5 11 2.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 2.0 18 2.5 19 1.5 20 1.0 21 1.0 22 1.5 23 1.5 24 2.5 25 4.5 26 4.0 27 3.0 28 5.0 29 6.5 30 7.0 31 12.5 32 18.0 33 25.0 34 38.0 35 54.0 36 85.0 37 107.5 38 110.0 39 139.0 40 187.5 41 214.0 42 237.5 43 269.0 44 307.0 45 307.0 46 280.0 47 263.0 48 244.0 49 218.0 50 164.5 51 127.5 52 114.0 53 87.5 54 57.0 55 45.5 56 41.5 57 31.0 58 22.5 59 16.0 60 8.5 61 5.0 62 4.5 63 2.0 64 2.0 65 4.0 66 3.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.875 2 1.575 3 2.075 4 2.9749999999999996 5 3.1 6 2.675 7 2.5749999999999997 8 2.4250000000000003 9 2.85 10-14 2.815 15-19 3.63 20-24 2.82 25-29 2.77 30-34 2.685 35-39 2.93 40-44 3.4299999999999997 45-49 3.39 50-54 2.55 55-59 2.71 60-64 2.555 65-69 2.55 70-74 1.87 75-79 1.8450000000000002 80-84 2.5250000000000004 85-89 3.955 90-94 4.68 95-99 2.905 100-104 2.4299999999999997 105-109 2.82 110-114 2.87 115-119 2.22 120-124 1.5699999999999998 125-129 3.1 130-134 6.045 135-139 8.305 140-144 9.445 145-149 6.0600000000000005 150-151 3.2750000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.48901379662749 97.35000000000001 2 0.4087889626980072 0.8 3 0.0510986203372509 0.15 4 0.0 0.0 5 0.02554931016862545 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554931016862545 1.575 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 63 1.575 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.5625 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.362500000000001 0.0 0.0 0.0 0.0 124-125 4.7375 0.0 0.0 0.0 0.0 126-127 5.112500000000001 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 6.1875 0.0 0.0 0.0 0.0 132-133 6.65 0.0 0.0 0.0 0.0 134-135 7.0375 0.0 0.0 0.0 0.0 136-137 7.637499999999999 0.0 0.0 0.0 0.0 138-139 8.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 40 0.007768423 18.071669 100-104 >>END_MODULE Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823257 spots for SRR7169976.sra Written 823257 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra Read 823249 spots for SRR7169976.sra Written 823249 spots for SRR7169976.sra SRR ids: ['SRR7169976.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_udce385t SRR7169976.sra spots: 16464988 blocks: [[1, 823249], [823250, 1646498], [1646499, 2469747], [2469748, 3292996], [3292997, 4116245], [4116246, 4939494], [4939495, 5762743], [5762744, 6585992], [6585993, 7409241], [7409242, 8232490], [8232491, 9055739], [9055740, 9878988], [9878989, 10702237], [10702238, 11525486], [11525487, 12348735], [12348736, 13171984], [13171985, 13995233], [13995234, 14818482], [14818483, 15641731], [15641732, 16464988]] SRR7169976 file size 5557743 SRR7169976 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169976 SRR7169976_1.fastq SRR7169976_2.fastq Input file: SRR7169976_1.fastq Paired file: SRR7169976_2.fastq trimmed: SRR7169976-trimmed-pair1.fastq, SRR7169976-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:58:18 2025 >> started Wed Feb 12 06:58:38 2025 >> done (19.120s) 16464988 read pairs processed; of these: 32583 ( 0.20%) short read pairs filtered out after trimming by size control 58070 ( 0.35%) empty read pairs filtered out after trimming by size control 16374335 (99.45%) read pairs available; of these: 7933032 (48.45%) trimmed read pairs available after processing 8441303 (51.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 5 0.00% 21 1 0.00% 22 5 0.00% 23 10 0.00% 24 4 0.00% 25 2 0.00% 26 5 0.00% 27 5 0.00% 28 10 0.00% 29 14 0.00% 30 15 0.00% 31 10 0.00% 32 16 0.00% 33 10 0.00% 34 18 0.00% 35 10 0.00% 36 11 0.00% 37 20 0.00% 38 14 0.00% 39 31 0.00% 40 22 0.00% 41 30 0.00% 42 45 0.00% 43 30 0.00% 44 47 0.00% 45 53 0.00% 46 53 0.00% 47 53 0.00% 48 65 0.00% 49 75 0.00% 50 108 0.00% 51 104 0.00% 52 123 0.00% 53 141 0.00% 54 169 0.00% 55 178 0.00% 56 156 0.00% 57 214 0.00% 58 240 0.00% 59 265 0.00% 60 307 0.00% 61 346 0.00% 62 384 0.00% 63 458 0.00% 64 507 0.00% 65 556 0.00% 66 600 0.00% 67 773 0.00% 68 855 0.01% 69 1021 0.01% 70 1277 0.01% 71 1436 0.01% 72 1464 0.01% 73 1621 0.01% 74 1816 0.01% 75 1978 0.01% 76 2095 0.01% 77 2357 0.01% 78 2584 0.02% 79 2838 0.02% 80 3383 0.02% 81 3811 0.02% 82 4549 0.03% 83 5207 0.03% 84 6785 0.04% 85 8003 0.05% 86 8340 0.05% 87 8563 0.05% 88 8855 0.05% 89 9652 0.06% 90 10332 0.06% 91 10954 0.07% 92 12108 0.07% 93 13070 0.08% 94 13696 0.08% 95 14682 0.09% 96 15419 0.09% 97 16471 0.10% 98 16972 0.10% 99 17637 0.11% 100 18439 0.11% 101 19574 0.12% 102 21270 0.13% 103 22596 0.14% 104 23612 0.14% 105 24682 0.15% 106 25913 0.16% 107 26730 0.16% 108 27625 0.17% 109 28039 0.17% 110 28823 0.18% 111 30430 0.19% 112 31646 0.19% 113 33689 0.21% 114 34665 0.21% 115 36542 0.22% 116 37417 0.23% 117 38500 0.24% 118 39150 0.24% 119 40273 0.25% 120 41443 0.25% 121 42224 0.26% 122 44070 0.27% 123 46431 0.28% 124 48318 0.30% 125 50551 0.31% 126 52518 0.32% 127 53918 0.33% 128 55692 0.34% 129 57178 0.35% 130 58508 0.36% 131 61046 0.37% 132 63505 0.39% 133 66884 0.41% 134 70556 0.43% 135 74283 0.45% 136 78763 0.48% 137 83099 0.51% 138 88792 0.54% 139 95819 0.59% 140 101693 0.62% 141 109629 0.67% 142 118996 0.73% 143 128481 0.78% 144 144396 0.88% 145 164474 1.00% 146 197320 1.21% 147 255344 1.56% 148 361277 2.21% 149 670175 4.09% 150 3621878 22.12% 151 8441303 51.55% 16374335 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=38 prefix-density=0.25 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=35 fanout-score=76.84 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=13.8 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=51.10 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR7169976 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:59:40 Started mapping on | Feb 12 06:59:40 Finished on | Feb 12 07:01:00 Mapping speed, Million of reads per hour | 736.85 Number of input reads | 16374335 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14241583 Uniquely mapped reads % | 86.98% Average mapped length | 289.59 Number of splices: Total | 13389711 Number of splices: Annotated (sjdb) | 13166856 Number of splices: GT/AG | 13196844 Number of splices: GC/AG | 150640 Number of splices: AT/AC | 11178 Number of splices: Non-canonical | 31049 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267743 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 28107 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.18% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1891130 1891130 1891130 N_multimapping 267743 267743 267743 N_noFeature 308090 14081999 371718 N_ambiguous 188744 1715 91491 UnstrandedReadsAssigned:13744749 PositiveStrandReadsAssigned:157869 NegativeStrandReadsAssigned:13778374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169976 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169976-trimmed-pair1.fastq SRR7169976-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,374,335 reads, 15,059,243 reads pseudoaligned [quant] estimated average fragment length: 222.221 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7169976.ke.tsv 34699 SRR7169976.se.tsv 87100 total ==> SRR7169976.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.78 296 11.0841 Potri.005G024800.1.v4.1 1035 813.779 26 2.14967 Potri.004G059700.1.v4.1 961 739.805 11 1.00041 Potri.007G009000.2.v4.1 1416 1194.78 0 0 Potri.003G141000.2.v4.1 2943 2721.78 344.15 8.50745 Potri.016G087400.1.v4.1 270 88.9296 1401 1059.98 Potri.015G069301.1.v4.1 564 346.546 0 0 Potri.010G195200.1.v4.1 1773 1551.78 31.8489 1.38092 Potri.012G127500.1.v4.1 977 755.792 4540 404.164 ==> SRR7169976.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 756 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169976 completed mapping pipeline successfully