Starting /dee2/code/volunteer_pipeline.sh SRR7169977 current disk space = 3050364686336 free memory = 1482461712 SRR7169977 SRAfilesize 76350d95f1548aceed84b11a7a8094ed SRR7169977.sra SRR7169977.sra file validated SRR7169977 is paired end SRR7169977 is conventional basespace SRR7169977 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169977_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9865 34.0 33.0 34.0 33.0 34.0 2 33.45475 34.0 34.0 34.0 33.0 34.0 3 33.42725 34.0 34.0 34.0 33.0 34.0 4 33.48675 34.0 34.0 34.0 33.0 34.0 5 33.489 34.0 34.0 34.0 33.0 34.0 6 37.284 38.0 38.0 38.0 36.0 38.0 7 37.4845 38.0 38.0 38.0 37.0 38.0 8 37.47025 38.0 38.0 38.0 38.0 38.0 9 37.559 38.0 38.0 38.0 38.0 38.0 10-14 37.56305 38.0 38.0 38.0 38.0 38.0 15-19 37.4919 38.0 38.0 38.0 38.0 38.0 20-24 37.45405 38.0 38.0 38.0 38.0 38.0 25-29 37.43769999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.39185 38.0 38.0 38.0 37.8 38.0 35-39 37.34875 38.0 38.0 38.0 37.4 38.0 40-44 37.141450000000006 38.0 38.0 38.0 36.8 38.0 45-49 37.10945 38.0 38.0 38.0 36.4 38.0 50-54 37.05925 38.0 38.0 38.0 36.0 38.0 55-59 36.97324999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.9908 38.0 38.0 38.0 36.0 38.0 65-69 36.92165 38.0 38.0 38.0 36.0 38.0 70-74 36.818799999999996 38.0 38.0 38.0 35.4 38.0 75-79 36.650099999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.506150000000005 38.0 38.0 38.0 34.4 38.0 85-89 36.3779 38.0 38.0 38.0 34.0 38.0 90-94 36.36955 38.0 38.0 38.0 34.0 38.0 95-99 36.25435 38.0 38.0 38.0 33.8 38.0 100-104 36.0409 38.0 37.8 38.0 33.2 38.0 105-109 35.90875 38.0 37.4 38.0 32.8 38.0 110-114 35.6771 38.0 37.0 38.0 31.4 38.0 115-119 35.6032 38.0 37.0 38.0 31.0 38.0 120-124 35.398849999999996 38.0 36.2 38.0 29.8 38.0 125-129 35.0118 38.0 36.0 38.0 28.4 38.0 130-134 34.6469 38.0 35.6 38.0 27.2 38.0 135-139 34.1302 38.0 35.0 38.0 23.4 38.0 140-144 33.93535 38.0 35.0 38.0 22.8 38.0 145-149 33.1413 38.0 34.4 38.0 15.4 38.0 150-151 29.25275 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 1.0 12 1.0 13 6.0 14 3.0 15 1.0 16 5.0 17 6.0 18 4.0 19 7.0 20 9.0 21 7.0 22 12.0 23 18.0 24 19.0 25 20.0 26 18.0 27 25.0 28 29.0 29 34.0 30 46.0 31 45.0 32 64.0 33 75.0 34 133.0 35 250.0 36 614.0 37 2543.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.400304414003045 12.810755961440892 11.669203450025368 34.11973617453069 2 21.5 16.325 32.525 29.65 3 19.475 21.4 25.324999999999996 33.800000000000004 4 22.1 28.075 22.900000000000002 26.924999999999997 5 22.3 32.675 23.75 21.275 6 19.85 33.925 24.5 21.725 7 14.475 27.725 38.975 18.825 8 18.3 27.224999999999998 30.775000000000002 23.7 9 17.474999999999998 25.775 31.775 24.975 10-14 19.84 30.53 26.545 23.085 15-19 19.955000000000002 29.23 27.095000000000002 23.72 20-24 19.68 29.955 26.38 23.985 25-29 19.21 29.509999999999998 27.21 24.07 30-34 19.84 29.505 26.875 23.78 35-39 19.97 29.759999999999998 26.57 23.7 40-44 19.99 29.215000000000003 27.139999999999997 23.655 45-49 20.025000000000002 29.035 26.82 24.12 50-54 20.26 29.18 26.21 24.349999999999998 55-59 19.915 28.565 26.58 24.94 60-64 19.915 28.9 26.82 24.365000000000002 65-69 20.075000000000003 28.67 27.435 23.82 70-74 20.1 29.37 26.615 23.915 75-79 20.035 28.43 27.175 24.36 80-84 20.76 28.46 26.69 24.09 85-89 20.345 28.549999999999997 27.229999999999997 23.875 90-94 20.560000000000002 28.294999999999998 27.134999999999998 24.01 95-99 20.97 28.044999999999998 27.08 23.905 100-104 20.79 28.77 26.979999999999997 23.46 105-109 21.154999999999998 28.71 26.465 23.669999999999998 110-114 20.68 28.660000000000004 26.87 23.79 115-119 20.335 27.58 27.389999999999997 24.695 120-124 20.77 28.38 26.655 24.195 125-129 21.005 28.49 26.340000000000003 24.165 130-134 20.97 27.589999999999996 27.145000000000003 24.295 135-139 21.955 28.08 26.540000000000003 23.425 140-144 21.38 28.12 25.915 24.585 145-149 21.245 28.549999999999997 25.874999999999996 24.33 150-151 22.05 28.012500000000003 25.525 24.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 2.0 24 3.0 25 4.0 26 5.5 27 8.5 28 12.0 29 13.0 30 24.0 31 32.5 32 34.0 33 44.0 34 59.0 35 76.5 36 97.0 37 110.0 38 113.0 39 133.0 40 175.0 41 203.5 42 223.0 43 243.0 44 249.5 45 249.0 46 258.0 47 257.5 48 224.5 49 197.0 50 183.5 51 158.0 52 126.5 53 107.0 54 87.0 55 65.0 56 52.5 57 39.0 58 30.0 59 23.0 60 14.5 61 12.0 62 11.0 63 8.0 64 3.5 65 2.0 66 4.5 67 3.0 68 1.0 69 3.5 70 3.5 71 1.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.675 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.875 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 3.9749999999999996 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 4.8375 0.0 0.0 0.0 0.0 122-123 5.2125 0.0 0.0 0.0 0.0 124-125 5.6 0.0 0.0 0.0 0.0 126-127 6.1125 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.199999999999999 0.0 0.0 0.0 0.0 132-133 7.675000000000001 0.0 0.0 0.0 0.0 134-135 8.2625 0.0 0.0 0.0 0.0 136-137 8.75 0.0 0.0 0.0 0.0 138-139 9.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169977 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169977_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.90275 33.0 33.0 34.0 32.0 34.0 2 32.3665 34.0 33.0 34.0 31.0 34.0 3 32.39925 34.0 33.0 34.0 32.0 34.0 4 32.227 34.0 33.0 34.0 32.0 34.0 5 32.1355 34.0 33.0 34.0 32.0 34.0 6 36.35975 38.0 38.0 38.0 36.0 38.0 7 36.3665 38.0 38.0 38.0 36.0 38.0 8 36.4175 38.0 38.0 38.0 36.0 38.0 9 36.31975 38.0 38.0 38.0 36.0 38.0 10-14 36.2594 38.0 38.0 38.0 36.0 38.0 15-19 35.99679999999999 38.0 38.0 38.0 34.6 38.0 20-24 36.18915 38.0 38.0 38.0 36.0 38.0 25-29 36.23055000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.2813 38.0 38.0 38.0 36.2 38.0 35-39 36.192099999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.04344999999999 38.0 38.0 38.0 35.8 38.0 45-49 35.94675 38.0 38.0 38.0 35.2 38.0 50-54 36.095150000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.1135 38.0 38.0 38.0 35.6 38.0 60-64 36.01585 38.0 38.0 38.0 35.4 38.0 65-69 35.9701 38.0 38.0 38.0 34.4 38.0 70-74 35.98225 38.0 38.0 38.0 35.0 38.0 75-79 35.88825 38.0 38.0 38.0 34.0 38.0 80-84 35.81025 38.0 38.0 38.0 33.8 38.0 85-89 35.49419999999999 38.0 38.0 38.0 33.2 38.0 90-94 35.0538 38.0 38.0 38.0 29.4 38.0 95-99 35.353300000000004 38.0 38.0 38.0 30.6 38.0 100-104 35.3942 38.0 38.0 38.0 32.2 38.0 105-109 35.302899999999994 38.0 38.0 38.0 32.0 38.0 110-114 35.0353 38.0 38.0 38.0 29.8 38.0 115-119 34.76745 38.0 37.2 38.0 27.6 38.0 120-124 34.5897 38.0 37.0 38.0 26.8 38.0 125-129 34.14255 38.0 36.2 38.0 21.6 38.0 130-134 33.213499999999996 38.0 35.6 38.0 14.0 38.0 135-139 32.34765 38.0 34.8 38.0 4.2 38.0 140-144 31.483999999999998 38.0 33.6 38.0 2.0 38.0 145-149 30.9512 38.0 32.6 38.0 2.0 38.0 150-151 27.534125 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 79.0 3 12.0 4 9.0 5 4.0 6 1.0 7 2.0 8 3.0 9 2.0 10 2.0 11 3.0 12 1.0 13 5.0 14 8.0 15 5.0 16 8.0 17 13.0 18 8.0 19 13.0 20 8.0 21 13.0 22 14.0 23 20.0 24 16.0 25 17.0 26 30.0 27 35.0 28 34.0 29 24.0 30 62.0 31 58.0 32 100.0 33 103.0 34 108.0 35 168.0 36 395.0 37 2617.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.18988648090816 19.96904024767802 15.2218782249742 25.61919504643963 2 26.664991203820055 25.936164865544107 28.248303593867806 19.15054033676803 3 21.989396617015906 29.790456955314315 29.386518555920222 18.83362787174956 4 24.707379134860048 33.56234096692112 22.519083969465647 19.21119592875318 5 23.701049398515487 35.93550038392629 22.57486562579985 17.788584591758383 6 22.5609756097561 35.46747967479675 24.034552845528456 17.9369918699187 7 21.612001017035343 21.332316297991355 37.29977116704806 19.75591151792525 8 22.670728611322673 25.184056867225184 26.707286113226708 25.437928408225435 9 23.112012164216928 25.21540800810948 28.71262037506336 22.95995945261024 10-14 24.304672802155896 28.499516957339704 25.30126608023593 21.89454416026847 15-19 24.225697638761115 27.787999591127466 26.94981089645303 21.036491873658385 20-24 24.40712468193384 27.83206106870229 26.732824427480917 21.02798982188295 25-29 24.441851024964482 27.80596711995129 26.826669372843515 20.925512482240716 30-34 24.1631162507608 27.774396429296004 27.20632988435788 20.856157435585313 35-39 23.99592771697633 27.615169254263172 27.07050139984729 21.318401628913207 40-44 24.42865177156296 27.89508666087223 26.320364026790738 21.35589754077407 45-49 24.07739161590828 27.199672416440603 27.742232686697037 20.98070328095409 50-54 24.135827572183814 27.653517690117933 26.911346075640502 21.299308662057747 55-59 24.51937747940189 27.45397212897976 26.86400162750483 21.162648764113516 60-64 24.386268717530815 27.834368951818274 26.749516145461953 21.02984618518896 65-69 24.61139896373057 27.59829320329168 27.308747333130146 20.481560499847607 70-74 24.09815330129016 27.366557045282065 27.54869719200607 20.986592461421704 75-79 24.746327426927152 27.154323792215664 27.45721641678025 20.642132364076936 80-84 24.13898047172204 27.23307126553386 27.709865584580267 20.918082678163834 85-89 24.498692240627726 27.098825580799012 27.68859941535463 20.713882763218628 90-94 24.43319733512369 27.26333729277488 27.557713164282394 20.745752207819038 95-99 24.584582549926317 27.56237613699883 26.962752172366482 20.89028914070837 100-104 24.55366200040576 27.61716372489349 27.54108338405356 20.28809089064719 105-109 24.715447154471544 27.510162601626014 27.220528455284555 20.553861788617887 110-114 24.603862026799817 27.8952463443216 27.130993019819638 20.36989860905895 115-119 25.156946132037262 27.085864722559737 27.561765897124342 20.195423248278654 120-124 24.745335350479074 27.574382249117495 27.685325264750375 19.994957135653053 125-129 24.98468137254902 27.588848039215684 27.272263071895424 20.15420751633987 130-134 25.65499895200168 27.12219660448543 26.76587717459652 20.45692726891637 135-139 26.018858878056577 27.48388471578499 26.87123754728038 19.626018858878055 140-144 26.02857449779783 27.382103340852936 27.280051563003543 19.309270598345687 145-149 25.86179839933044 27.357849034890414 27.179996861432233 19.600355704346917 150-151 25.82917146881803 28.30067870405942 26.57190421308746 19.298245614035086 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 32.0 1 19.0 2 4.5 3 3.0 4 2.0 5 3.5 6 4.0 7 1.0 8 0.0 9 0.5 10 1.5 11 2.0 12 1.0 13 0.5 14 0.5 15 1.0 16 2.5 17 2.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 2.0 26 2.5 27 1.5 28 1.5 29 4.5 30 11.0 31 14.5 32 17.0 33 24.0 34 30.0 35 39.0 36 59.0 37 86.5 38 107.5 39 136.0 40 164.5 41 193.5 42 234.5 43 244.5 44 253.0 45 276.5 46 279.5 47 281.0 48 267.0 49 228.0 50 199.0 51 160.5 52 127.0 53 111.0 54 91.5 55 69.0 56 53.5 57 40.5 58 29.0 59 25.0 60 16.5 61 11.0 62 7.0 63 5.5 64 6.0 65 4.0 66 3.5 67 3.5 68 2.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.1 2 0.525 3 0.975 4 1.7500000000000002 5 2.325 6 1.6 7 1.675 8 1.525 9 1.35 10-14 1.6650000000000003 15-19 2.17 20-24 1.7500000000000002 25-29 1.46 30-34 1.4200000000000002 35-39 1.775 40-44 2.205 45-49 2.315 50-54 1.6400000000000001 55-59 1.69 60-64 1.83 65-69 1.5699999999999998 70-74 1.175 75-79 0.955 80-84 1.425 85-89 2.505 90-94 3.1850000000000005 95-99 1.6049999999999998 100-104 1.4200000000000002 105-109 1.6 110-114 1.865 115-119 1.24 120-124 0.8500000000000001 125-129 2.08 130-134 4.58 135-139 6.145 140-144 6.909999999999999 145-149 4.415 150-151 2.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4169835234474 98.05 2 0.38022813688212925 0.75 3 0.10139416983523447 0.3 4 0.025348542458808618 0.1 5 0.025348542458808618 0.125 6 0.025348542458808618 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025348542458808618 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.4749999999999996 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.125 0.0 0.0 0.0 0.0 124-125 5.512499999999999 0.0 0.0 0.0 0.0 126-127 6.0125 0.0 0.0 0.0 0.0 128-129 6.5625 0.0 0.0 0.0 0.0 130-131 7.0375 0.0 0.0 0.0 0.0 132-133 7.4125 0.0 0.0 0.0 0.0 134-135 8.025 0.0 0.0 0.0 0.0 136-137 8.462499999999999 0.0 0.0 0.0 0.0 138-139 9.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703115 spots for SRR7169977.sra Written 703115 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra Read 703101 spots for SRR7169977.sra Written 703101 spots for SRR7169977.sra SRR ids: ['SRR7169977.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_08b8o704 SRR7169977.sra spots: 14062034 blocks: [[1, 703101], [703102, 1406202], [1406203, 2109303], [2109304, 2812404], [2812405, 3515505], [3515506, 4218606], [4218607, 4921707], [4921708, 5624808], [5624809, 6327909], [6327910, 7031010], [7031011, 7734111], [7734112, 8437212], [8437213, 9140313], [9140314, 9843414], [9843415, 10546515], [10546516, 11249616], [11249617, 11952717], [11952718, 12655818], [12655819, 13358919], [13358920, 14062034]] SRR7169977 file size 4743461 SRR7169977 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169977 SRR7169977_1.fastq SRR7169977_2.fastq Input file: SRR7169977_1.fastq Paired file: SRR7169977_2.fastq trimmed: SRR7169977-trimmed-pair1.fastq, SRR7169977-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:29:48 2025 >> started Wed Feb 12 06:30:03 2025 >> done (14.714s) 14062034 read pairs processed; of these: 29958 ( 0.21%) short read pairs filtered out after trimming by size control 42072 ( 0.30%) empty read pairs filtered out after trimming by size control 13990004 (99.49%) read pairs available; of these: 6701357 (47.90%) trimmed read pairs available after processing 7288647 (52.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 16 0.00% 20 9 0.00% 21 7 0.00% 22 6 0.00% 23 6 0.00% 24 8 0.00% 25 12 0.00% 26 13 0.00% 27 10 0.00% 28 8 0.00% 29 16 0.00% 30 18 0.00% 31 21 0.00% 32 17 0.00% 33 12 0.00% 34 18 0.00% 35 29 0.00% 36 19 0.00% 37 24 0.00% 38 29 0.00% 39 34 0.00% 40 32 0.00% 41 40 0.00% 42 44 0.00% 43 64 0.00% 44 62 0.00% 45 73 0.00% 46 62 0.00% 47 83 0.00% 48 85 0.00% 49 80 0.00% 50 117 0.00% 51 125 0.00% 52 143 0.00% 53 167 0.00% 54 171 0.00% 55 173 0.00% 56 249 0.00% 57 238 0.00% 58 265 0.00% 59 324 0.00% 60 316 0.00% 61 448 0.00% 62 455 0.00% 63 508 0.00% 64 556 0.00% 65 692 0.00% 66 790 0.01% 67 851 0.01% 68 930 0.01% 69 1273 0.01% 70 1991 0.01% 71 2136 0.02% 72 2014 0.01% 73 2060 0.01% 74 2120 0.02% 75 2310 0.02% 76 2479 0.02% 77 2764 0.02% 78 3011 0.02% 79 3271 0.02% 80 3671 0.03% 81 4269 0.03% 82 4866 0.03% 83 5540 0.04% 84 7496 0.05% 85 8788 0.06% 86 8992 0.06% 87 9698 0.07% 88 10003 0.07% 89 10473 0.07% 90 11010 0.08% 91 11668 0.08% 92 12582 0.09% 93 14055 0.10% 94 14807 0.11% 95 15782 0.11% 96 16397 0.12% 97 17131 0.12% 98 17852 0.13% 99 18135 0.13% 100 19233 0.14% 101 20332 0.15% 102 21452 0.15% 103 23146 0.17% 104 24205 0.17% 105 25542 0.18% 106 26697 0.19% 107 27200 0.19% 108 27736 0.20% 109 28547 0.20% 110 29504 0.21% 111 30387 0.22% 112 31858 0.23% 113 33781 0.24% 114 35135 0.25% 115 37394 0.27% 116 37884 0.27% 117 39375 0.28% 118 39271 0.28% 119 39693 0.28% 120 40434 0.29% 121 41752 0.30% 122 43261 0.31% 123 44772 0.32% 124 47374 0.34% 125 49240 0.35% 126 51301 0.37% 127 52291 0.37% 128 53374 0.38% 129 54670 0.39% 130 55949 0.40% 131 57693 0.41% 132 59833 0.43% 133 62767 0.45% 134 64726 0.46% 135 68411 0.49% 136 71937 0.51% 137 75631 0.54% 138 80620 0.58% 139 84835 0.61% 140 87419 0.62% 141 92948 0.66% 142 99887 0.71% 143 107260 0.77% 144 117905 0.84% 145 132734 0.95% 146 155864 1.11% 147 194846 1.39% 148 273309 1.95% 149 508461 3.63% 150 2914355 20.83% 151 7288647 52.10% 13990004 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=253.35 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=28.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=131.79 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=13.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAAGGAGAA SRR7169977 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:30:48 Started mapping on | Feb 12 06:30:48 Finished on | Feb 12 06:32:20 Mapping speed, Million of reads per hour | 547.43 Number of input reads | 13990004 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12908296 Uniquely mapped reads % | 92.27% Average mapped length | 290.67 Number of splices: Total | 11371125 Number of splices: Annotated (sjdb) | 11163312 Number of splices: GT/AG | 11194937 Number of splices: GC/AG | 137662 Number of splices: AT/AC | 10116 Number of splices: Non-canonical | 28410 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256704 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 53839 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.44% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 850022 850022 850022 N_multimapping 256704 256704 256704 N_noFeature 257000 12751223 324457 N_ambiguous 142036 1098 51597 UnstrandedReadsAssigned:12509260 PositiveStrandReadsAssigned:155975 NegativeStrandReadsAssigned:12532242 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169977 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169977-trimmed-pair1.fastq SRR7169977-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,990,004 reads, 12,545,502 reads pseudoaligned [quant] estimated average fragment length: 215.608 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7169977.ke.tsv 34699 SRR7169977.se.tsv 87100 total ==> SRR7169977.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.39 200 7.35945 Potri.005G024800.1.v4.1 1035 820.392 29 2.34575 Potri.004G059700.1.v4.1 961 746.407 11 0.977963 Potri.007G009000.2.v4.1 1416 1201.39 0 0 Potri.003G141000.2.v4.1 2943 2728.39 216 5.25355 Potri.016G087400.1.v4.1 270 88.8189 2138.53 1597.77 Potri.015G069301.1.v4.1 564 351.448 0 0 Potri.010G195200.1.v4.1 1773 1558.39 12 0.510987 Potri.012G127500.1.v4.1 977 762.397 7236 629.829 ==> SRR7169977.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 635 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169977 completed mapping pipeline successfully