Starting /dee2/code/volunteer_pipeline.sh SRR7169978 current disk space = 3050088562688 free memory = 1582628404 SRR7169978 SRAfilesize 520e54231e092d5707c522c2fcb3ba53 SRR7169978.sra SRR7169978.sra file validated SRR7169978 is paired end SRR7169978 is conventional basespace SRR7169978 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169978_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.489 34.0 34.0 34.0 33.0 34.0 2 33.629 34.0 34.0 34.0 33.0 34.0 3 33.69375 34.0 34.0 34.0 33.0 34.0 4 33.678 34.0 34.0 34.0 33.0 34.0 5 33.7625 34.0 34.0 34.0 33.0 34.0 6 37.38775 38.0 38.0 38.0 36.0 38.0 7 37.646 38.0 38.0 38.0 38.0 38.0 8 37.71475 38.0 38.0 38.0 38.0 38.0 9 37.7065 38.0 38.0 38.0 38.0 38.0 10-14 37.718650000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.67015 38.0 38.0 38.0 38.0 38.0 20-24 37.6583 38.0 38.0 38.0 38.0 38.0 25-29 37.6056 38.0 38.0 38.0 38.0 38.0 30-34 37.4967 38.0 38.0 38.0 38.0 38.0 35-39 37.43339999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.06105000000001 38.0 38.0 38.0 36.4 38.0 45-49 37.0446 38.0 38.0 38.0 36.0 38.0 50-54 37.09085 38.0 38.0 38.0 36.0 38.0 55-59 37.036500000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.963649999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.88125 38.0 38.0 38.0 36.0 38.0 70-74 36.6635 38.0 38.0 38.0 35.2 38.0 75-79 35.9767 38.0 38.0 38.0 34.0 38.0 80-84 35.8916 38.0 38.0 38.0 34.0 38.0 85-89 35.77720000000001 38.0 38.0 38.0 33.6 38.0 90-94 35.56015 38.0 38.0 38.0 32.6 38.0 95-99 35.40235 38.0 37.4 38.0 31.0 38.0 100-104 35.393950000000004 38.0 37.2 38.0 31.0 38.0 105-109 35.19325 38.0 37.0 38.0 30.6 38.0 110-114 34.943749999999994 38.0 37.0 38.0 28.8 38.0 115-119 34.61395 38.0 36.0 38.0 27.2 38.0 120-124 34.3646 38.0 36.0 38.0 25.0 38.0 125-129 34.06345 38.0 35.0 38.0 23.4 38.0 130-134 33.6272 38.0 35.0 38.0 19.0 38.0 135-139 33.1637 38.0 34.4 38.0 14.8 38.0 140-144 32.5575 38.0 34.0 38.0 14.0 38.0 145-149 31.82645 38.0 32.4 38.0 11.0 38.0 150-151 27.64225 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 1.0 10 0.0 11 4.0 12 1.0 13 6.0 14 9.0 15 7.0 16 9.0 17 8.0 18 19.0 19 54.0 20 10.0 21 6.0 22 9.0 23 16.0 24 14.0 25 24.0 26 16.0 27 26.0 28 30.0 29 34.0 30 32.0 31 44.0 32 68.0 33 94.0 34 128.0 35 253.0 36 750.0 37 2325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.90952500628298 13.872832369942195 13.520985172153807 32.69665745162101 2 23.674999999999997 16.825000000000003 30.475 29.025000000000002 3 19.400000000000002 20.150000000000002 27.725 32.725 4 21.075 26.025 24.05 28.849999999999998 5 22.825 30.75 24.975 21.45 6 21.7 33.125 25.224999999999998 19.950000000000003 7 14.099999999999998 32.2 37.75 15.950000000000001 8 17.424999999999997 30.85 28.825 22.900000000000002 9 16.1 29.15 33.225 21.525 10-14 18.375 32.28 27.515 21.83 15-19 17.96 30.39 27.71 23.94 20-24 19.155 30.990000000000002 27.91 21.945 25-29 18.625 31.405 27.155 22.814999999999998 30-34 18.575 31.205 27.084999999999997 23.135 35-39 19.23 30.635 26.75 23.385 40-44 18.834999999999997 30.61 27.200000000000003 23.355 45-49 19.12 30.669999999999998 28.1 22.11 50-54 19.62 29.82 26.815 23.745 55-59 18.675 30.020000000000003 28.21 23.095 60-64 18.755 29.735 28.005000000000003 23.505000000000003 65-69 19.015 32.0 26.284999999999997 22.7 70-74 19.365 31.369999999999997 26.185000000000002 23.080000000000002 75-79 19.25 31.1 26.384999999999998 23.265 80-84 19.255 30.785 26.484999999999996 23.474999999999998 85-89 19.74 29.785 27.145000000000003 23.330000000000002 90-94 19.66868525098844 30.113607927531156 26.92557930033532 23.292127521145087 95-99 19.57957957957958 30.875875875875874 26.176176176176174 23.36836836836837 100-104 19.765 30.769999999999996 26.029999999999998 23.435 105-109 19.285 31.235000000000003 26.724999999999998 22.755 110-114 19.57 31.209999999999997 26.13 23.09 115-119 19.665 30.825000000000003 26.295 23.215 120-124 19.655 30.654999999999998 25.72 23.97 125-129 20.57 29.945 25.845000000000002 23.64 130-134 20.204091841328598 30.38367265269371 26.041718773448054 23.37051673252964 135-139 20.355088772193046 29.657414353588397 26.691672918229557 23.295823955988997 140-144 20.108043217286912 29.796918767507 25.97539015606242 24.119647859143658 145-149 20.721216364909473 30.339101730519157 25.53766129838952 23.402020606181857 150-151 20.56507063382923 30.428803600450056 24.79059882485311 24.21552694086761 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.5 15 1.0 16 1.5 17 2.0 18 2.0 19 1.5 20 2.0 21 2.0 22 2.0 23 3.0 24 7.0 25 12.0 26 14.0 27 19.5 28 26.5 29 31.0 30 45.0 31 59.0 32 65.5 33 81.5 34 107.0 35 113.0 36 129.5 37 171.0 38 182.5 39 179.5 40 193.5 41 205.0 42 208.5 43 203.0 44 222.5 45 218.0 46 200.0 47 195.0 48 161.0 49 148.5 50 143.5 51 120.5 52 103.5 53 95.0 54 81.0 55 62.0 56 43.5 57 35.0 58 25.0 59 13.5 60 8.0 61 6.5 62 9.0 63 9.0 64 5.5 65 3.5 66 2.0 67 2.0 68 3.0 69 3.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.095 95-99 0.1 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.045 135-139 0.025 140-144 0.04 145-149 0.03 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.99426934097421 94.05 2 1.6671008075019538 3.2 3 0.15629070070330814 0.44999999999999996 4 0.10419380046887211 0.4 5 0.0 0.0 6 0.026048450117218028 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026048450117218028 0.25 >50 0.026048450117218028 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGCAATCTCGTATGC 60 1.5 TruSeq Adapter, Index 10 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGCAATCTCGTATGCC 10 0.25 TruSeq Adapter, Index 10 (97% over 35bp) GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.0375 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.2125 0.0 0.0 0.0 0.0 122-123 4.7375 0.0 0.0 0.0 0.0 124-125 5.1625 0.0 0.0 0.0 0.0 126-127 5.8 0.0 0.0 0.0 0.0 128-129 6.4625 0.0 0.0 0.0 0.0 130-131 7.2125 0.0 0.0 0.0 0.0 132-133 7.6875 0.0 0.0 0.0 0.0 134-135 8.162500000000001 0.0 0.0 0.0 0.0 136-137 8.8625 0.0 0.0 0.0 0.0 138-139 9.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAATCT 10 0.006830828 145.0 3 AAAAAAA 180 0.0012783089 8.055555 65-69 >>END_MODULE SRR7169978 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169978_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.045 34.0 33.0 34.0 33.0 34.0 2 33.10325 34.0 33.0 34.0 33.0 34.0 3 32.9155 34.0 33.0 34.0 33.0 34.0 4 32.741 34.0 33.0 34.0 33.0 34.0 5 32.86 34.0 33.0 34.0 33.0 34.0 6 36.97625 38.0 38.0 38.0 38.0 38.0 7 37.0175 38.0 38.0 38.0 37.0 38.0 8 37.052 38.0 38.0 38.0 38.0 38.0 9 36.9915 38.0 38.0 38.0 38.0 38.0 10-14 36.74955 38.0 38.0 38.0 37.2 38.0 15-19 36.60835 38.0 38.0 38.0 37.0 38.0 20-24 36.6832 38.0 38.0 38.0 37.0 38.0 25-29 36.61645 38.0 38.0 38.0 37.0 38.0 30-34 36.6549 38.0 38.0 38.0 37.0 38.0 35-39 36.5163 38.0 38.0 38.0 37.0 38.0 40-44 36.4478 38.0 38.0 38.0 37.0 38.0 45-49 36.4134 38.0 38.0 38.0 37.0 38.0 50-54 36.57425 38.0 38.0 38.0 37.0 38.0 55-59 36.5641 38.0 38.0 38.0 37.0 38.0 60-64 36.4929 38.0 38.0 38.0 36.8 38.0 65-69 36.3678 38.0 38.0 38.0 36.2 38.0 70-74 35.9008 38.0 38.0 38.0 35.6 38.0 75-79 35.8291 38.0 38.0 38.0 35.0 38.0 80-84 35.658500000000004 38.0 38.0 38.0 34.6 38.0 85-89 35.273399999999995 38.0 38.0 38.0 33.6 38.0 90-94 35.19865 38.0 38.0 38.0 33.2 38.0 95-99 35.37495 38.0 38.0 38.0 33.4 38.0 100-104 35.39165 38.0 38.0 38.0 33.2 38.0 105-109 35.27715 38.0 38.0 38.0 32.6 38.0 110-114 35.14055 38.0 38.0 38.0 31.6 38.0 115-119 34.951299999999996 38.0 38.0 38.0 30.0 38.0 120-124 34.78815 38.0 38.0 38.0 29.0 38.0 125-129 34.298950000000005 38.0 36.8 38.0 23.8 38.0 130-134 33.4952 38.0 35.8 38.0 14.4 38.0 135-139 32.621249999999996 38.0 35.0 38.0 6.4 38.0 140-144 31.894 38.0 33.6 38.0 2.0 38.0 145-149 31.5002 38.0 33.0 38.0 2.0 38.0 150-151 27.65825 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 24.0 4 6.0 5 3.0 6 3.0 7 1.0 8 1.0 9 1.0 10 6.0 11 2.0 12 1.0 13 3.0 14 9.0 15 9.0 16 10.0 17 33.0 18 27.0 19 18.0 20 10.0 21 7.0 22 8.0 23 12.0 24 14.0 25 15.0 26 14.0 27 20.0 28 27.0 29 21.0 30 41.0 31 42.0 32 92.0 33 113.0 34 87.0 35 152.0 36 383.0 37 2744.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.56749311294766 20.66115702479339 18.081642875031303 22.68970698722765 2 26.033575544976195 27.637183663242293 28.413931345527438 17.91530944625407 3 22.345523329129886 29.230769230769234 30.668348045397227 17.755359394703657 4 25.158508749682984 30.991630738016738 25.18387014963226 18.66599036266802 5 27.020901536136993 33.744648703097454 22.890959456056407 16.343490304709142 6 23.02847064751827 34.76946334089191 25.069286974048875 17.132779037540942 7 21.49321266968326 24.132730015082956 34.967320261437905 19.40673705379588 8 23.07306050715541 27.014812955059003 26.387145367813208 23.524981169972385 9 24.622356495468278 26.132930513595166 28.77643504531722 20.468277945619334 10-14 24.551019375727222 28.319927151312797 25.95740375373097 21.17164971922902 15-19 24.113619071772764 27.40552878518894 28.00913010398174 20.471722039056555 20-24 24.437591628330217 28.66892472574693 27.08154289469693 19.811940751225922 25-29 24.48029942845582 28.663193566334535 26.700723281574025 20.15578372363563 30-34 24.63760795999798 28.400424263851708 27.10237890802566 19.859588868124654 35-39 24.037730108017648 27.516608347279277 27.394898321415894 21.050763223287188 40-44 25.222567024469654 27.527089586406877 27.53726407895406 19.713079310169405 45-49 24.275693809088136 26.654467825556573 27.77777777777778 21.292060587577513 50-54 23.85645691180187 27.915087187263076 28.026282537275716 20.202173363659337 55-59 23.88172858225929 28.076825878190547 28.253727571392467 19.787717968157693 60-64 23.331475193837733 29.10859980742918 27.8974306998429 19.662494298890184 65-69 22.657038982023835 28.852757018784086 27.893354877802462 20.596849121389617 70-74 23.900065218481913 29.072392514925 27.336577534741384 19.690964731851704 75-79 23.237951807228914 29.01104417670683 27.941767068273094 19.809236947791163 80-84 23.39683662640861 28.69270807013998 27.60624589418364 20.304209409267777 85-89 23.78491763020567 28.890821651488796 27.949452573416554 19.37480814488898 90-94 23.445807770961142 28.24130879345603 28.624744376278116 19.688139059304703 95-99 23.43214357733414 28.32224238757814 28.206291591046583 20.039322444041137 100-104 23.72078968573731 28.958501208702657 28.32896857373086 18.991740531829173 105-109 23.16532258064516 29.19858870967742 28.160282258064516 19.475806451612904 110-114 23.7360190293031 28.655296320664004 27.95181942405992 19.656865225972975 115-119 23.828203580768456 28.92275196137598 28.263930798632064 18.985113659223497 120-124 23.479831426851295 28.496889424041743 28.642384105960268 19.380895043146698 125-129 24.341937783208596 28.975103100656792 27.45277735349524 19.230181762639376 130-134 24.764273132317893 28.401201947984667 27.81577038648845 19.018754533208995 135-139 24.788525193085693 28.219408395943884 27.904166447748647 19.087899963221773 140-144 24.936359779380567 28.90857021637675 27.354688162918965 18.800381841323716 145-149 25.24052065647991 28.322271955548693 28.01358234295416 18.423625045017236 150-151 26.089165502349804 28.48977518099835 27.892798170964056 17.528261145687793 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 2.0 3 5.0 4 6.0 5 4.5 6 4.0 7 3.0 8 3.5 9 2.0 10 1.0 11 1.5 12 1.0 13 1.0 14 1.0 15 0.5 16 1.5 17 2.5 18 1.5 19 1.0 20 3.0 21 3.5 22 1.5 23 1.0 24 4.0 25 6.0 26 6.5 27 5.5 28 3.0 29 9.0 30 19.0 31 27.0 32 35.5 33 42.0 34 55.0 35 84.5 36 104.5 37 119.5 38 143.0 39 160.5 40 194.5 41 219.5 42 234.5 43 249.5 44 249.0 45 253.0 46 249.0 47 226.0 48 205.5 49 188.0 50 166.0 51 146.0 52 115.5 53 95.0 54 77.5 55 64.0 56 56.5 57 35.0 58 21.0 59 15.0 60 12.5 61 12.0 62 7.5 63 5.5 64 7.0 65 4.5 66 3.0 67 3.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.22499999999999998 3 0.8750000000000001 4 1.425 5 0.7250000000000001 6 0.775 7 0.5499999999999999 8 0.42500000000000004 9 0.7000000000000001 10-14 1.165 15-19 1.425 20-24 1.095 25-29 1.145 30-34 1.005 35-39 1.405 40-44 1.7149999999999999 45-49 1.63 50-54 1.075 55-59 1.075 60-64 1.335 65-69 0.98 70-74 0.335 75-79 0.4 80-84 1.055 85-89 2.27 90-94 2.1999999999999997 95-99 0.8200000000000001 100-104 0.72 105-109 0.8 110-114 1.205 115-119 0.58 120-124 0.33999999999999997 125-129 1.7950000000000002 130-134 3.49 135-139 4.835 140-144 5.72 145-149 2.815 150-151 1.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.94270833333333 94.025 2 1.7447916666666667 3.35 3 0.18229166666666666 0.525 4 0.052083333333333336 0.2 5 0.026041666666666668 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026041666666666668 0.325 >50 0.026041666666666668 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 58 1.4500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 13 0.325 Illumina Single End PCR Primer 1 (100% over 50bp) CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.725 0.0 0.0 0.0 0.0 114-115 3.0250000000000004 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.7875 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.6 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.2875 0.0 0.0 0.0 0.0 130-131 6.8625 0.0 0.0 0.0 0.0 132-133 7.4 0.0 0.0 0.0 0.0 134-135 7.9 0.0 0.0 0.0 0.0 136-137 8.5625 0.0 0.0 0.0 0.0 138-139 9.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 105 6.05049E-6 13.654762 60-64 >>END_MODULE Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612210 spots for SRR7169978.sra Written 612210 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra Read 612200 spots for SRR7169978.sra Written 612200 spots for SRR7169978.sra SRR ids: ['SRR7169978.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t2ea34id SRR7169978.sra spots: 12244010 blocks: [[1, 612200], [612201, 1224400], [1224401, 1836600], [1836601, 2448800], [2448801, 3061000], [3061001, 3673200], [3673201, 4285400], [4285401, 4897600], [4897601, 5509800], [5509801, 6122000], [6122001, 6734200], [6734201, 7346400], [7346401, 7958600], [7958601, 8570800], [8570801, 9183000], [9183001, 9795200], [9795201, 10407400], [10407401, 11019600], [11019601, 11631800], [11631801, 12244010]] SRR7169978 file size 4127392 SRR7169978 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169978 SRR7169978_1.fastq SRR7169978_2.fastq Input file: SRR7169978_1.fastq Paired file: SRR7169978_2.fastq trimmed: SRR7169978-trimmed-pair1.fastq, SRR7169978-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:07:23 2025 >> started Wed Feb 12 07:07:36 2025 >> done (12.955s) 12244010 read pairs processed; of these: 40881 ( 0.33%) short read pairs filtered out after trimming by size control 263487 ( 2.15%) empty read pairs filtered out after trimming by size control 11939642 (97.51%) read pairs available; of these: 6567433 (55.01%) trimmed read pairs available after processing 5372209 (44.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 17 0.00% 20 8 0.00% 21 14 0.00% 22 26 0.00% 23 17 0.00% 24 29 0.00% 25 18 0.00% 26 21 0.00% 27 28 0.00% 28 32 0.00% 29 23 0.00% 30 40 0.00% 31 25 0.00% 32 33 0.00% 33 40 0.00% 34 35 0.00% 35 31 0.00% 36 32 0.00% 37 40 0.00% 38 37 0.00% 39 50 0.00% 40 52 0.00% 41 62 0.00% 42 74 0.00% 43 93 0.00% 44 105 0.00% 45 174 0.00% 46 106 0.00% 47 139 0.00% 48 161 0.00% 49 191 0.00% 50 214 0.00% 51 220 0.00% 52 242 0.00% 53 235 0.00% 54 264 0.00% 55 272 0.00% 56 269 0.00% 57 277 0.00% 58 360 0.00% 59 366 0.00% 60 427 0.00% 61 417 0.00% 62 493 0.00% 63 606 0.01% 64 702 0.01% 65 923 0.01% 66 1562 0.01% 67 3081 0.03% 68 5072 0.04% 69 8084 0.07% 70 10250 0.09% 71 7317 0.06% 72 5063 0.04% 73 3904 0.03% 74 3265 0.03% 75 3045 0.03% 76 2849 0.02% 77 3008 0.03% 78 2976 0.02% 79 3215 0.03% 80 3363 0.03% 81 3848 0.03% 82 4421 0.04% 83 4841 0.04% 84 7001 0.06% 85 8204 0.07% 86 8801 0.07% 87 9367 0.08% 88 10064 0.08% 89 10895 0.09% 90 11175 0.09% 91 11259 0.09% 92 11846 0.10% 93 12686 0.11% 94 13429 0.11% 95 14515 0.12% 96 15067 0.13% 97 15923 0.13% 98 16408 0.14% 99 17163 0.14% 100 18080 0.15% 101 18912 0.16% 102 19967 0.17% 103 21056 0.18% 104 22502 0.19% 105 23833 0.20% 106 24687 0.21% 107 25618 0.21% 108 27005 0.23% 109 27874 0.23% 110 27657 0.23% 111 28800 0.24% 112 29792 0.25% 113 31248 0.26% 114 32634 0.27% 115 34283 0.29% 116 35370 0.30% 117 35600 0.30% 118 35989 0.30% 119 36830 0.31% 120 38023 0.32% 121 38254 0.32% 122 39707 0.33% 123 41652 0.35% 124 43818 0.37% 125 44557 0.37% 126 46874 0.39% 127 48267 0.40% 128 49422 0.41% 129 50619 0.42% 130 52136 0.44% 131 53468 0.45% 132 55844 0.47% 133 57794 0.48% 134 60480 0.51% 135 64176 0.54% 136 68025 0.57% 137 70840 0.59% 138 74961 0.63% 139 80086 0.67% 140 83327 0.70% 141 88961 0.75% 142 95316 0.80% 143 104306 0.87% 144 114888 0.96% 145 131628 1.10% 146 158293 1.33% 147 209699 1.76% 148 304925 2.55% 149 581009 4.87% 150 2777326 23.26% 151 5372209 44.99% 11939642 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=27 prefix-density=0.22 prefix-fanout=3.2 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=43.62 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=12.1 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=3.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=157.90 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169978 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:08:36 Started mapping on | Feb 12 07:08:37 Finished on | Feb 12 07:10:49 Mapping speed, Million of reads per hour | 325.63 Number of input reads | 11939642 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 9234361 Uniquely mapped reads % | 77.34% Average mapped length | 283.53 Number of splices: Total | 6938481 Number of splices: Annotated (sjdb) | 6792977 Number of splices: GT/AG | 6824511 Number of splices: GC/AG | 82146 Number of splices: AT/AC | 5946 Number of splices: Non-canonical | 25878 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.63 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 198333 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 39023 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.59% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2527371 2527371 2527371 N_multimapping 198333 198333 198333 N_noFeature 221018 9096303 276643 N_ambiguous 152257 1774 68506 UnstrandedReadsAssigned:8861086 PositiveStrandReadsAssigned:136284 NegativeStrandReadsAssigned:8889212 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=138 echo kmer=133 SRR7169978 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169978-trimmed-pair1.fastq SRR7169978-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,939,642 reads, 10,119,226 reads pseudoaligned [quant] estimated average fragment length: 207.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52401 SRR7169978.ke.tsv 34699 SRR7169978.se.tsv 87100 total ==> SRR7169978.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.68 142 6.88703 Potri.005G024800.1.v4.1 1035 828.678 25 2.65081 Potri.004G059700.1.v4.1 961 754.687 10 1.16428 Potri.007G009000.2.v4.1 1416 1209.68 0 0 Potri.003G141000.2.v4.1 2943 2736.68 153 4.91239 Potri.016G087400.1.v4.1 270 92.8437 1427 1350.51 Potri.015G069301.1.v4.1 564 359.028 0 0 Potri.010G195200.1.v4.1 1773 1566.68 27 1.51429 Potri.012G127500.1.v4.1 977 770.678 3252 370.768 ==> SRR7169978.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 877 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169978 completed mapping pipeline successfully