Starting /dee2/code/volunteer_pipeline.sh SRR7169979 current disk space = 3050366259200 free memory = 1050403140 SRR7169979 SRAfilesize 6b57aa09cc40e2c53561ee39b4f25df2 SRR7169979.sra SRR7169979.sra file validated SRR7169979 is paired end SRR7169979 is conventional basespace SRR7169979 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169979_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86 34.0 34.0 34.0 33.0 34.0 2 33.415 34.0 34.0 34.0 33.0 34.0 3 33.567 34.0 34.0 34.0 33.0 34.0 4 33.5805 34.0 34.0 34.0 33.0 34.0 5 33.51525 34.0 34.0 34.0 33.0 34.0 6 37.28275 38.0 38.0 38.0 36.0 38.0 7 37.53775 38.0 38.0 38.0 37.0 38.0 8 37.6715 38.0 38.0 38.0 38.0 38.0 9 37.68975 38.0 38.0 38.0 38.0 38.0 10-14 37.63225 38.0 38.0 38.0 38.0 38.0 15-19 37.60375 38.0 38.0 38.0 38.0 38.0 20-24 37.575050000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.49865 38.0 38.0 38.0 38.0 38.0 30-34 37.472300000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.357150000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.24585 38.0 38.0 38.0 37.0 38.0 45-49 37.1118 38.0 38.0 38.0 36.6 38.0 50-54 37.1021 38.0 38.0 38.0 36.4 38.0 55-59 37.01395 38.0 38.0 38.0 36.2 38.0 60-64 37.00145 38.0 38.0 38.0 36.0 38.0 65-69 36.956500000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.86805 38.0 38.0 38.0 36.0 38.0 75-79 36.59255 38.0 38.0 38.0 35.2 38.0 80-84 36.42595000000001 38.0 38.0 38.0 34.4 38.0 85-89 36.301750000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.0901 38.0 38.0 38.0 34.2 38.0 95-99 35.901250000000005 38.0 38.0 38.0 33.4 38.0 100-104 35.7347 38.0 37.6 38.0 31.8 38.0 105-109 35.55745 38.0 37.2 38.0 30.2 38.0 110-114 35.42110000000001 38.0 37.0 38.0 30.2 38.0 115-119 35.251450000000006 38.0 37.0 38.0 29.0 38.0 120-124 35.33565 38.0 37.0 38.0 30.6 38.0 125-129 35.15304999999999 38.0 36.6 38.0 29.8 38.0 130-134 34.4972 38.0 35.6 38.0 25.8 38.0 135-139 33.750299999999996 38.0 35.0 38.0 20.2 38.0 140-144 33.7581 38.0 35.0 38.0 21.8 38.0 145-149 33.180699999999995 38.0 34.2 38.0 17.0 38.0 150-151 29.030124999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 5.0 11 1.0 12 0.0 13 1.0 14 4.0 15 6.0 16 5.0 17 6.0 18 4.0 19 12.0 20 9.0 21 12.0 22 11.0 23 11.0 24 11.0 25 22.0 26 25.0 27 29.0 28 28.0 29 31.0 30 55.0 31 55.0 32 67.0 33 110.0 34 120.0 35 231.0 36 562.0 37 2563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.21488871834229 13.149143003325658 11.84446149910463 34.79150677922742 2 23.1 13.425 32.05 31.424999999999997 3 19.475 19.650000000000002 26.6 34.275 4 22.025 25.974999999999998 23.65 28.349999999999998 5 22.7 30.95 24.15 22.2 6 19.6 33.6 25.85 20.95 7 15.024999999999999 28.675 37.7 18.6 8 17.825 27.05 31.3 23.825 9 17.95 25.650000000000002 33.175 23.225 10-14 19.29 29.995 27.195000000000004 23.52 15-19 19.695 29.15 27.279999999999998 23.875 20-24 19.994999999999997 29.26 27.83 22.915 25-29 19.735 29.360000000000003 26.345000000000002 24.560000000000002 30-34 19.744999999999997 28.89 26.985 24.38 35-39 19.77 28.52 27.735 23.974999999999998 40-44 20.29 28.485 27.439999999999998 23.785 45-49 20.463301145744733 28.74868664632011 26.922499624756092 23.865512583179065 50-54 19.919999999999998 28.575 27.435 24.07 55-59 20.62 28.189999999999998 27.339999999999996 23.849999999999998 60-64 19.744999999999997 28.694999999999997 27.365000000000002 24.195 65-69 20.43 28.660000000000004 27.405 23.505000000000003 70-74 19.825 28.67 27.58 23.925 75-79 20.84 28.694999999999997 27.034999999999997 23.43 80-84 20.419999999999998 28.244999999999997 27.334999999999997 24.0 85-89 19.946901768271303 28.472674447728295 27.019986975905425 24.560436808094977 90-94 19.89636784384747 28.317738203038534 27.729147801589697 24.056746151524298 95-99 19.856086147033665 28.611684194635938 27.398983545514017 24.133246112816384 100-104 20.208291608251553 28.31964750650911 27.34328059282996 24.128780292409374 105-109 20.562056205620564 28.132813281328133 27.022702270227022 24.282428242824285 110-114 20.79 28.205000000000002 27.1 23.905 115-119 21.01710171017102 28.297829782978294 26.58265826582658 24.102410241024103 120-124 21.12 28.65 27.084999999999997 23.145 125-129 21.310655327663834 28.3591795897949 26.62831415707854 23.70185092546273 130-134 21.472577009767093 28.524918607563237 26.73678938141748 23.26571500125219 135-139 21.178479931682322 28.43723313407344 26.32742251469332 24.056864419550912 140-144 21.226840260390585 28.502754131196795 26.499749624436653 23.770655983975963 145-149 21.175999198637683 27.79224681959331 26.219573274566766 24.812180707202245 150-151 21.1125 29.275000000000002 25.412499999999998 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 3.0 25 4.5 26 5.5 27 9.0 28 14.0 29 19.5 30 22.5 31 22.5 32 28.5 33 39.5 34 56.0 35 72.5 36 76.5 37 83.5 38 118.5 39 157.0 40 181.0 41 211.0 42 229.0 43 261.5 44 274.0 45 256.0 46 259.5 47 257.0 48 240.5 49 216.5 50 184.0 51 152.5 52 129.0 53 104.5 54 77.5 55 52.5 56 34.5 57 29.5 58 25.5 59 20.0 60 17.5 61 12.0 62 6.0 63 4.5 64 6.0 65 4.5 66 3.5 67 4.0 68 2.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.065 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.185 90-94 0.61 95-99 0.635 100-104 0.13999999999999999 105-109 0.01 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.05 130-134 0.17500000000000002 135-139 0.46499999999999997 140-144 0.15 145-149 0.16999999999999998 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.8594539939332658 1.7000000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02527805864509606 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGACATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.7625000000000002 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.2249999999999996 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.7750000000000004 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.1875 0.0 0.0 0.0 0.0 124-125 5.75 0.0 0.0 0.0 0.0 126-127 6.175 0.0 0.0 0.0 0.0 128-129 6.862500000000001 0.0 0.0 0.0 0.0 130-131 7.55 0.0 0.0 0.0 0.0 132-133 8.2625 0.0 0.0 0.0 0.0 134-135 8.775 0.0 0.0 0.0 0.0 136-137 9.575 0.0 0.0 0.0 0.0 138-139 10.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169979 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169979_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5715 33.0 33.0 34.0 31.0 34.0 2 31.92025 34.0 33.0 34.0 31.0 34.0 3 31.93875 34.0 33.0 34.0 31.0 34.0 4 31.75875 34.0 33.0 34.0 31.0 34.0 5 31.61825 34.0 33.0 34.0 31.0 34.0 6 35.64275 38.0 38.0 38.0 34.0 38.0 7 35.82275 38.0 38.0 38.0 34.0 38.0 8 35.723 38.0 38.0 38.0 34.0 38.0 9 35.9085 38.0 38.0 38.0 35.0 38.0 10-14 35.78415 38.0 38.0 38.0 35.0 38.0 15-19 35.6768 38.0 38.0 38.0 35.0 38.0 20-24 35.69385 38.0 38.0 38.0 35.0 38.0 25-29 35.8548 38.0 38.0 38.0 35.8 38.0 30-34 35.8666 38.0 38.0 38.0 36.0 38.0 35-39 35.720299999999995 38.0 38.0 38.0 35.2 38.0 40-44 35.64945 38.0 38.0 38.0 35.4 38.0 45-49 35.54474999999999 38.0 38.0 38.0 34.2 38.0 50-54 35.6943 38.0 38.0 38.0 34.6 38.0 55-59 35.70135 38.0 38.0 38.0 34.8 38.0 60-64 35.6967 38.0 38.0 38.0 34.6 38.0 65-69 35.7188 38.0 38.0 38.0 34.8 38.0 70-74 35.62975 38.0 38.0 38.0 34.6 38.0 75-79 35.51135 38.0 38.0 38.0 34.0 38.0 80-84 35.45435 38.0 38.0 38.0 33.8 38.0 85-89 35.08485 38.0 38.0 38.0 32.2 38.0 90-94 34.650400000000005 38.0 38.0 38.0 28.2 38.0 95-99 35.01195 38.0 38.0 38.0 29.0 38.0 100-104 35.1378 38.0 38.0 38.0 32.0 38.0 105-109 35.0575 38.0 38.0 38.0 31.2 38.0 110-114 34.92885 38.0 38.0 38.0 30.6 38.0 115-119 34.65885 38.0 38.0 38.0 27.6 38.0 120-124 34.47345 38.0 37.2 38.0 25.8 38.0 125-129 34.0862 38.0 36.4 38.0 21.2 38.0 130-134 32.93485 38.0 35.6 38.0 8.8 38.0 135-139 31.92875 38.0 34.8 38.0 2.0 38.0 140-144 31.179750000000002 38.0 33.8 38.0 2.0 38.0 145-149 30.51125 38.0 32.2 38.0 2.0 38.0 150-151 27.29225 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 148.0 3 5.0 4 5.0 5 0.0 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 8.0 13 6.0 14 4.0 15 8.0 16 8.0 17 13.0 18 10.0 19 6.0 20 11.0 21 11.0 22 6.0 23 11.0 24 15.0 25 20.0 26 26.0 27 22.0 28 27.0 29 29.0 30 51.0 31 45.0 32 93.0 33 120.0 34 120.0 35 169.0 36 378.0 37 2618.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.07782710890572 20.29250457038391 15.931052494123794 25.698615826586575 2 25.91649694501018 27.39307535641548 28.818737270875765 17.871690427698574 3 22.940723633564282 28.25250192455735 28.38080574801129 20.425968693867077 4 23.734095040249287 33.80940015580369 23.007011165930926 19.4494936380161 5 25.286757038581857 35.45359749739312 22.288842544316996 16.970802919708028 6 21.590023382696806 35.697583787996884 24.369966224993505 18.34242660431281 7 20.80745341614907 23.65424430641822 36.387163561076605 19.151138716356108 8 22.541407867494826 25.284679089026913 26.91511387163561 25.25879917184265 9 22.642967542503865 23.90520350334879 29.18598660484286 24.26584234930448 10-14 24.66791199667912 28.051058530510588 25.762764632627643 21.51826484018265 15-19 24.366248503461556 27.411378897506637 27.348914684295455 20.87345791473635 20-24 23.796180987961808 28.23266915732669 27.168949771689498 20.802200083022 25-29 24.12138101873355 28.10032512772875 26.76368890953192 21.01460494400578 30-34 24.391752577319586 27.74742268041237 27.108247422680414 20.75257731958763 35-39 24.42384380340774 27.997306955305817 26.77507897871459 20.80377026257186 40-44 24.44594735199251 28.00957236499844 26.568515242950784 20.975965040058266 45-49 24.505826050769873 27.668539325842694 27.189970869746148 20.635663753641282 50-54 23.847944142746318 27.773467804499614 27.28213085078873 21.09645720196535 55-59 24.37422424493173 27.906495655771618 26.77906495655772 20.940215142738932 60-64 24.561040037292173 28.63210234629927 26.524058631584403 20.282798984824158 65-69 24.721362229102166 27.88957688338493 27.37358101135191 20.015479876160992 70-74 24.12111880934052 28.006158583525785 27.138824736977163 20.733897870156532 75-79 24.297961907695466 28.2714718414703 27.419272036552183 20.011294214282046 80-84 23.830815088909446 28.219755370541677 27.423167848699766 20.52626169184911 85-89 24.426323767706865 27.489415085463385 28.163713344832992 19.92054780199676 90-94 24.194823678245744 27.352274524273888 27.631648305308104 20.82125349217226 95-99 23.950795947901593 28.452553235476536 27.604920405209842 19.991730411412032 100-104 24.071498480399733 27.58460825220213 27.625817750991605 20.718075516406532 105-109 24.253692800330544 27.646937299865716 27.39386427022002 20.70550562958372 110-114 24.194132560666425 27.960883737776165 27.73322295234646 20.11176074921095 115-119 25.105203736015604 27.573642615210918 27.56851072564918 19.752642923124295 120-124 24.98722012064206 27.64032307535017 27.43073305387997 19.9417237501278 125-129 25.071447129124447 28.178747726682257 27.21745908028059 19.532346063912705 130-134 25.542517280180032 27.28393077211595 27.66436264266195 19.509189305042064 135-139 25.03423719528896 27.953985209531634 27.378800328677073 19.632977266502326 140-144 26.13800779076238 27.223149693934335 26.538675570395103 20.100166944908178 145-149 26.000964785335263 28.268210323203085 26.456557860320522 19.274267031141125 150-151 26.523437500000004 27.239583333333332 27.044270833333332 19.192708333333332 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 85.0 1 47.5 2 6.5 3 3.5 4 3.0 5 2.0 6 4.0 7 3.5 8 1.5 9 2.5 10 2.0 11 3.0 12 4.0 13 1.5 14 0.5 15 1.5 16 1.0 17 1.0 18 2.0 19 2.5 20 1.5 21 0.5 22 1.0 23 2.0 24 4.5 25 4.5 26 3.5 27 3.5 28 4.5 29 7.0 30 8.5 31 11.0 32 16.5 33 23.0 34 36.0 35 56.5 36 57.0 37 70.0 38 101.0 39 120.0 40 158.5 41 215.0 42 258.0 43 255.5 44 272.5 45 294.5 46 272.5 47 275.5 48 269.0 49 220.0 50 172.0 51 149.5 52 123.5 53 99.0 54 76.0 55 51.5 56 39.5 57 28.0 58 23.5 59 21.0 60 14.5 61 11.0 62 11.0 63 6.5 64 3.5 65 3.0 66 2.5 67 2.0 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.275 2 1.7999999999999998 3 2.5749999999999997 4 3.7249999999999996 5 4.1000000000000005 6 3.775 7 3.4000000000000004 8 3.4000000000000004 9 2.9499999999999997 10-14 3.64 15-19 3.945 20-24 3.64 25-29 3.115 30-34 3.0 35-39 3.4549999999999996 40-44 3.8899999999999997 45-49 3.88 50-54 3.325 55-59 3.32 60-64 3.465 65-69 3.1 70-74 2.5749999999999997 75-79 2.605 80-84 2.71 85-89 4.345000000000001 90-94 5.1450000000000005 95-99 3.26 100-104 2.935 105-109 3.19 110-114 3.3649999999999998 115-119 2.5700000000000003 120-124 2.19 125-129 3.775 130-134 6.6850000000000005 135-139 8.725 140-144 10.15 145-149 6.715 150-151 4.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70062370062371 94.95 2 1.1434511434511436 2.1999999999999997 3 0.02598752598752599 0.075 4 0.02598752598752599 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07796257796257797 0.8750000000000001 >50 0.02598752598752599 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 72 1.7999999999999998 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 11 0.27499999999999997 Illumina Single End PCR Primer 1 (100% over 50bp) NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6124999999999998 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.55 0.0 0.0 0.0 0.0 112-113 2.975 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.199999999999999 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 5.1 0.0 0.0 0.0 0.0 124-125 5.6625 0.0 0.0 0.0 0.0 126-127 6.05 0.0 0.0 0.0 0.0 128-129 6.7125 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.9 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.149999999999999 0.0 0.0 0.0 0.0 138-139 9.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784541 spots for SRR7169979.sra Written 784541 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra Read 784531 spots for SRR7169979.sra Written 784531 spots for SRR7169979.sra SRR ids: ['SRR7169979.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lq95vsgp SRR7169979.sra spots: 15690630 blocks: [[1, 784531], [784532, 1569062], [1569063, 2353593], [2353594, 3138124], [3138125, 3922655], [3922656, 4707186], [4707187, 5491717], [5491718, 6276248], [6276249, 7060779], [7060780, 7845310], [7845311, 8629841], [8629842, 9414372], [9414373, 10198903], [10198904, 10983434], [10983435, 11767965], [11767966, 12552496], [12552497, 13337027], [13337028, 14121558], [14121559, 14906089], [14906090, 15690630]] SRR7169979 file size 5295339 SRR7169979 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169979 SRR7169979_1.fastq SRR7169979_2.fastq Input file: SRR7169979_1.fastq Paired file: SRR7169979_2.fastq trimmed: SRR7169979-trimmed-pair1.fastq, SRR7169979-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:27:16 2025 >> started Wed Feb 12 06:27:32 2025 >> done (16.380s) 15690630 read pairs processed; of these: 39864 ( 0.25%) short read pairs filtered out after trimming by size control 71125 ( 0.45%) empty read pairs filtered out after trimming by size control 15579641 (99.29%) read pairs available; of these: 7539480 (48.39%) trimmed read pairs available after processing 8040161 (51.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 9 0.00% 23 10 0.00% 24 14 0.00% 25 6 0.00% 26 7 0.00% 27 12 0.00% 28 10 0.00% 29 23 0.00% 30 23 0.00% 31 12 0.00% 32 20 0.00% 33 15 0.00% 34 19 0.00% 35 35 0.00% 36 20 0.00% 37 28 0.00% 38 26 0.00% 39 27 0.00% 40 43 0.00% 41 32 0.00% 42 48 0.00% 43 53 0.00% 44 59 0.00% 45 69 0.00% 46 78 0.00% 47 93 0.00% 48 97 0.00% 49 96 0.00% 50 126 0.00% 51 158 0.00% 52 170 0.00% 53 198 0.00% 54 175 0.00% 55 173 0.00% 56 233 0.00% 57 262 0.00% 58 286 0.00% 59 344 0.00% 60 354 0.00% 61 466 0.00% 62 496 0.00% 63 549 0.00% 64 650 0.00% 65 699 0.00% 66 899 0.01% 67 963 0.01% 68 1234 0.01% 69 2011 0.01% 70 3850 0.02% 71 2922 0.02% 72 2355 0.02% 73 2225 0.01% 74 2301 0.01% 75 2572 0.02% 76 2728 0.02% 77 3013 0.02% 78 3416 0.02% 79 3592 0.02% 80 4022 0.03% 81 4575 0.03% 82 5229 0.03% 83 6141 0.04% 84 8287 0.05% 85 9870 0.06% 86 10353 0.07% 87 11075 0.07% 88 11684 0.07% 89 12111 0.08% 90 12728 0.08% 91 13531 0.09% 92 14548 0.09% 93 15731 0.10% 94 16756 0.11% 95 17803 0.11% 96 19161 0.12% 97 20318 0.13% 98 20666 0.13% 99 21249 0.14% 100 22660 0.15% 101 23239 0.15% 102 24913 0.16% 103 26414 0.17% 104 27640 0.18% 105 29919 0.19% 106 30557 0.20% 107 31632 0.20% 108 32812 0.21% 109 33384 0.21% 110 34667 0.22% 111 35708 0.23% 112 36755 0.24% 113 39439 0.25% 114 40817 0.26% 115 42408 0.27% 116 43865 0.28% 117 44550 0.29% 118 45981 0.30% 119 46286 0.30% 120 48046 0.31% 121 48925 0.31% 122 50044 0.32% 123 52032 0.33% 124 55278 0.35% 125 56316 0.36% 126 58483 0.38% 127 60462 0.39% 128 61497 0.39% 129 62935 0.40% 130 64679 0.42% 131 66362 0.43% 132 68345 0.44% 133 72092 0.46% 134 73934 0.47% 135 78670 0.50% 136 81912 0.53% 137 85951 0.55% 138 91199 0.59% 139 95818 0.62% 140 100480 0.64% 141 106193 0.68% 142 113889 0.73% 143 122350 0.79% 144 133188 0.85% 145 148953 0.96% 146 176161 1.13% 147 221726 1.42% 148 302993 1.94% 149 558513 3.58% 150 3232144 20.75% 151 8040161 51.61% 15579641 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=52.69 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.3 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=47 prefix-density=0.24 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=55.57 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.0 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7169979 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:28:32 Started mapping on | Feb 12 06:28:33 Finished on | Feb 12 06:29:58 Mapping speed, Million of reads per hour | 659.84 Number of input reads | 15579641 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 13124483 Uniquely mapped reads % | 84.24% Average mapped length | 288.46 Number of splices: Total | 12094635 Number of splices: Annotated (sjdb) | 11880377 Number of splices: GT/AG | 11914772 Number of splices: GC/AG | 140499 Number of splices: AT/AC | 9915 Number of splices: Non-canonical | 29449 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 257365 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 25041 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.90% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2230805 2230805 2230805 N_multimapping 257365 257365 257365 N_noFeature 273692 12978641 324002 N_ambiguous 196256 1470 99704 UnstrandedReadsAssigned:12654535 PositiveStrandReadsAssigned:144372 NegativeStrandReadsAssigned:12700777 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169979 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169979-trimmed-pair1.fastq SRR7169979-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,579,641 reads, 14,222,329 reads pseudoaligned [quant] estimated average fragment length: 211.395 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR7169979.ke.tsv 34699 SRR7169979.se.tsv 87100 total ==> SRR7169979.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.61 269 9.88883 Potri.005G024800.1.v4.1 1035 824.605 23 1.85344 Potri.004G059700.1.v4.1 961 750.622 11 0.973795 Potri.007G009000.2.v4.1 1416 1205.61 0 0 Potri.003G141000.2.v4.1 2943 2732.61 234.066 5.6919 Potri.016G087400.1.v4.1 270 93.1441 2157.84 1539.43 Potri.015G069301.1.v4.1 564 355.977 0 0 Potri.010G195200.1.v4.1 1773 1562.61 8 0.340202 Potri.012G127500.1.v4.1 977 766.616 4585 397.427 ==> SRR7169979.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 981 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 234 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7169979 completed mapping pipeline successfully