Starting /dee2/code/volunteer_pipeline.sh SRR7169980 current disk space = 3050069581824 free memory = 1421315736 SRR7169980 SRAfilesize 950505af2d44377f491b2a7967658bef SRR7169980.sra SRR7169980.sra file validated SRR7169980 is paired end SRR7169980 is conventional basespace SRR7169980 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169980_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6535 34.0 33.0 34.0 33.0 34.0 2 33.3685 34.0 34.0 34.0 33.0 34.0 3 33.50175 34.0 34.0 34.0 33.0 34.0 4 33.5525 34.0 34.0 34.0 33.0 34.0 5 33.46025 34.0 34.0 34.0 33.0 34.0 6 37.21925 38.0 37.0 38.0 36.0 38.0 7 37.5235 38.0 38.0 38.0 37.0 38.0 8 37.5815 38.0 38.0 38.0 38.0 38.0 9 37.67875 38.0 38.0 38.0 38.0 38.0 10-14 37.6338 38.0 38.0 38.0 38.0 38.0 15-19 37.65375 38.0 38.0 38.0 38.0 38.0 20-24 37.6061 38.0 38.0 38.0 38.0 38.0 25-29 37.452600000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.470800000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.330650000000006 38.0 38.0 38.0 37.4 38.0 40-44 37.2294 38.0 38.0 38.0 37.0 38.0 45-49 37.1402 38.0 38.0 38.0 36.8 38.0 50-54 37.0976 38.0 38.0 38.0 36.4 38.0 55-59 37.0193 38.0 38.0 38.0 36.2 38.0 60-64 37.03335 38.0 38.0 38.0 36.0 38.0 65-69 37.012950000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.789300000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.27329999999999 38.0 38.0 38.0 34.4 38.0 80-84 36.0918 38.0 38.0 38.0 33.8 38.0 85-89 35.978300000000004 38.0 38.0 38.0 33.6 38.0 90-94 35.82195 38.0 38.0 38.0 33.4 38.0 95-99 35.634699999999995 38.0 38.0 38.0 32.6 38.0 100-104 35.519349999999996 38.0 37.4 38.0 31.2 38.0 105-109 35.260400000000004 38.0 37.4 38.0 29.8 38.0 110-114 35.114599999999996 38.0 37.0 38.0 28.6 38.0 115-119 34.869600000000005 38.0 36.6 38.0 27.2 38.0 120-124 34.956399999999995 38.0 36.6 38.0 28.0 38.0 125-129 34.723800000000004 38.0 36.0 38.0 27.4 38.0 130-134 34.02185 38.0 35.2 38.0 21.0 38.0 135-139 33.30945 38.0 34.8 38.0 16.2 38.0 140-144 33.31565 38.0 34.8 38.0 14.8 38.0 145-149 32.6375 38.0 34.2 38.0 11.2 38.0 150-151 28.557875000000003 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 2.0 10 1.0 11 0.0 12 4.0 13 1.0 14 4.0 15 4.0 16 6.0 17 6.0 18 30.0 19 24.0 20 7.0 21 6.0 22 9.0 23 14.0 24 14.0 25 16.0 26 26.0 27 32.0 28 45.0 29 41.0 30 46.0 31 65.0 32 81.0 33 93.0 34 134.0 35 218.0 36 530.0 37 2539.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.25584983286192 14.32244793005914 8.794034456158395 31.627667780920543 2 24.375 14.7 30.55 30.375000000000004 3 20.225 17.9 25.775 36.1 4 21.975 25.1 23.474999999999998 29.45 5 23.724999999999998 30.15 22.7 23.425 6 22.05 32.275 24.8 20.875 7 14.2 31.225 38.4 16.175 8 17.299999999999997 29.95 29.025000000000002 23.724999999999998 9 18.675 27.150000000000002 32.4 21.775 10-14 19.445 30.955 27.51 22.09 15-19 19.725 29.455 27.544999999999998 23.275000000000002 20-24 19.835 29.445 27.275 23.445 25-29 19.375 29.25 27.705000000000002 23.669999999999998 30-34 19.17 28.89 27.765 24.175 35-39 19.515 28.65 28.02 23.815 40-44 19.775000000000002 28.685 27.66 23.880000000000003 45-49 20.344240968678072 28.184729310517366 27.52927048934254 23.941759231462022 50-54 19.66 28.599999999999998 27.58 24.16 55-59 20.22 28.244999999999997 27.79 23.745 60-64 19.66 28.915000000000003 27.084999999999997 24.34 65-69 19.564999999999998 29.365000000000002 26.58 24.490000000000002 70-74 19.39 29.759999999999998 27.205000000000002 23.645 75-79 20.23 28.96 27.115000000000002 23.695 80-84 19.81 28.999999999999996 26.655 24.535 85-89 20.326506084430868 28.288847713956635 27.282287545695826 24.10235865591667 90-94 19.906382122005233 27.818602778337027 27.491443527280047 24.783571572377696 95-99 20.35442783063988 27.478225847052308 27.58898454412727 24.57836177818054 100-104 20.64183438470011 29.16791829378192 26.37428657254431 23.815960748973666 105-109 19.87198719871987 29.182918291829186 26.332633263326333 24.61246124612461 110-114 21.25 28.73 26.68 23.34 115-119 20.776038801940096 28.48142407120356 26.981349067453376 23.761188059402972 120-124 20.669999999999998 28.999999999999996 26.39 23.94 125-129 20.838335334133653 28.726490596238495 26.445578231292515 23.989595838335333 130-134 21.027335536197057 28.251727245419044 26.52948833483529 24.191448883548613 135-139 21.369711586775196 27.665561250125613 26.620440156768165 24.344287006331022 140-144 20.79202963853009 28.36187043156103 26.34925403023931 24.49684589966957 145-149 21.209996494215456 28.522061401312165 25.857665147493364 24.410276956979015 150-151 21.1625 27.8375 26.3625 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 0.0 24 2.0 25 5.0 26 7.5 27 8.5 28 12.0 29 21.5 30 22.5 31 25.0 32 37.0 33 42.5 34 49.5 35 68.5 36 85.0 37 116.5 38 144.5 39 153.5 40 178.5 41 197.0 42 220.5 43 252.5 44 265.5 45 268.5 46 248.5 47 244.5 48 243.0 49 205.5 50 168.5 51 148.5 52 130.0 53 111.0 54 95.5 55 66.5 56 41.0 57 28.5 58 20.0 59 14.5 60 10.0 61 8.0 62 6.0 63 3.0 64 2.0 65 3.0 66 4.0 67 1.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.06999999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.155 90-94 0.66 95-99 0.685 100-104 0.13 105-109 0.01 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.04 130-134 0.13 135-139 0.49 140-144 0.13 145-149 0.165 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.92802450229709 96.89999999999999 2 1.046452271567126 2.0500000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 1.05 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCCATGATCTCGTATGC 42 1.05 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 2.9875 0.0 0.0 0.0 0.0 112-113 3.4000000000000004 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.275 0.0 0.0 0.0 0.0 118-119 4.7 0.0 0.0 0.0 0.0 120-121 5.2625 0.0 0.0 0.0 0.0 122-123 5.725 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.5875 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.737500000000001 0.0 0.0 0.0 0.0 132-133 8.2625 0.0 0.0 0.0 0.0 134-135 9.0625 0.0 0.0 0.0 0.0 136-137 9.625 0.0 0.0 0.0 0.0 138-139 10.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAATT 10 0.0068343505 144.975 3 AAAAGCA 10 0.0068343505 144.975 4 TTTTTTT 55 0.0025189708 15.8154545 40-44 >>END_MODULE SRR7169980 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169980_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.48725 33.0 33.0 34.0 31.0 34.0 2 31.88425 34.0 33.0 34.0 31.0 34.0 3 31.8785 34.0 33.0 34.0 31.0 34.0 4 31.674 34.0 33.0 34.0 31.0 34.0 5 31.54275 34.0 33.0 34.0 31.0 34.0 6 35.66525 38.0 38.0 38.0 34.0 38.0 7 35.8025 38.0 38.0 38.0 34.0 38.0 8 35.767 38.0 38.0 38.0 34.0 38.0 9 35.80525 38.0 38.0 38.0 35.0 38.0 10-14 35.70909999999999 38.0 38.0 38.0 34.6 38.0 15-19 35.5803 38.0 38.0 38.0 34.0 38.0 20-24 35.61475 38.0 38.0 38.0 34.0 38.0 25-29 35.80185 38.0 38.0 38.0 35.2 38.0 30-34 35.7949 38.0 38.0 38.0 34.8 38.0 35-39 35.66155 38.0 38.0 38.0 34.4 38.0 40-44 35.53615 38.0 38.0 38.0 34.2 38.0 45-49 35.415099999999995 38.0 38.0 38.0 33.4 38.0 50-54 35.6212 38.0 38.0 38.0 34.2 38.0 55-59 35.583499999999994 38.0 38.0 38.0 34.0 38.0 60-64 35.52255 38.0 38.0 38.0 33.8 38.0 65-69 35.43835 38.0 38.0 38.0 33.6 38.0 70-74 35.17285 38.0 38.0 38.0 31.6 38.0 75-79 35.0943 38.0 38.0 38.0 30.8 38.0 80-84 35.0654 38.0 38.0 38.0 30.8 38.0 85-89 34.65975 38.0 38.0 38.0 27.4 38.0 90-94 34.295550000000006 38.0 38.0 38.0 22.8 38.0 95-99 34.66665 38.0 38.0 38.0 26.8 38.0 100-104 34.6923 38.0 38.0 38.0 27.8 38.0 105-109 34.62985 38.0 38.0 38.0 27.2 38.0 110-114 34.5574 38.0 38.0 38.0 27.0 38.0 115-119 34.25105 38.0 37.0 38.0 23.2 38.0 120-124 34.0072 38.0 36.8 38.0 20.6 38.0 125-129 33.53745 38.0 36.0 38.0 16.0 38.0 130-134 32.39545 38.0 35.0 38.0 4.2 38.0 135-139 31.3761 38.0 34.0 38.0 2.0 38.0 140-144 30.615750000000002 38.0 32.8 38.0 2.0 38.0 145-149 29.8841 38.0 31.2 38.0 2.0 38.0 150-151 26.515375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 149.0 3 6.0 4 1.0 5 3.0 6 0.0 7 3.0 8 3.0 9 1.0 10 2.0 11 4.0 12 2.0 13 2.0 14 4.0 15 8.0 16 11.0 17 41.0 18 13.0 19 8.0 20 5.0 21 11.0 22 19.0 23 10.0 24 21.0 25 25.0 26 18.0 27 39.0 28 35.0 29 33.0 30 48.0 31 51.0 32 102.0 33 128.0 34 131.0 35 161.0 36 367.0 37 2535.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.78431372549019 21.88235294117647 13.30718954248366 24.026143790849673 2 27.042900919305414 28.421859039836566 26.78753830439224 17.747701736465782 3 21.415701415701417 30.038610038610038 28.08236808236808 20.463320463320464 4 23.39927121290994 33.23789692868297 23.243102550754816 20.119729307652264 5 25.95300261096606 34.75195822454308 21.85378590078329 17.44125326370757 6 22.90473711608537 36.80374804789172 23.086933888599688 17.204580947423217 7 22.058061171591497 22.965266977708655 37.01399688958009 17.962674961119752 8 22.498703991705547 27.371695178849144 26.827371695178847 23.302229134266458 9 23.102736189984512 24.264326277749095 30.22715539494063 22.40578213732576 10-14 24.63097713097713 28.565488565488568 25.634095634095633 21.16943866943867 15-19 24.425212449820137 26.92247536624785 27.480319065742144 21.171993118189874 20-24 24.57900207900208 28.60706860706861 26.070686070686072 20.743243243243242 25-29 24.1855414210363 28.808563450201675 25.933395387320303 21.07249974144172 30-34 24.06364622617141 28.15002324740404 27.13230355943586 20.65402696698869 35-39 23.525138795205727 28.127432158978884 27.068956571369274 21.278472474446115 40-44 24.4958574331718 27.924547965192016 26.611432442290656 20.96816215934553 45-49 24.549244398124024 27.644606565919748 26.722251172485667 21.083897863470558 50-54 23.953150912106135 27.974709784411278 27.026326699834165 21.045812603648425 55-59 24.04912426158151 28.07026634884444 27.458804021142086 20.42180536843196 60-64 23.994603289917492 28.69596803487105 27.05619843287842 20.25323024233304 65-69 24.070531051243602 28.160711515590258 27.04896840581209 20.719789027354054 70-74 24.10668314282772 28.323550612707237 27.036350530326438 20.533415714138606 75-79 24.545501364783437 27.836431992583822 27.39352114126796 20.224545501364783 80-84 24.31568637558637 27.733388318985515 27.76431774833754 20.18660755709057 85-89 24.80238705962414 28.225933099513167 26.891064230749095 20.080615610113593 90-94 24.829914034069933 27.96266019724698 26.950055376826114 20.25737039185697 95-99 24.203491685230276 27.876495881469204 27.208205978345333 20.71180645495519 100-104 24.287190082644628 28.057851239669425 27.1900826446281 20.464876033057852 105-109 24.782608695652176 27.51552795031056 27.54658385093168 20.15527950310559 110-114 24.204250907205807 28.310005184033177 27.537584240539136 19.948159668221876 115-119 24.74380761110253 28.245532725681034 26.92208661620063 20.08857304701581 120-124 24.99230374551052 27.93227296049256 27.234479220112878 19.840944073884042 125-129 25.445173383317716 27.137352910548785 27.47058210975737 19.946891596376133 130-134 25.348862172606268 28.536925719192784 26.819450407900387 19.29476170030056 135-139 25.529463403928453 28.080763744101834 27.005376934050258 19.384395917919456 140-144 26.23580494321977 27.64974393230906 26.85927410376308 19.255177020708082 145-149 25.80956984050266 28.521561677675745 26.556038880833466 19.11282960098813 150-151 26.115314375163056 28.385076963214196 26.284894338638143 19.21471432298461 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 93.0 1 53.0 2 9.5 3 5.0 4 3.5 5 1.5 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 0.5 12 1.5 13 2.5 14 2.5 15 3.0 16 3.0 17 2.5 18 1.0 19 2.0 20 2.0 21 0.0 22 0.5 23 2.0 24 4.0 25 2.5 26 2.0 27 3.5 28 3.5 29 5.5 30 7.5 31 9.5 32 18.5 33 22.0 34 26.5 35 41.0 36 54.0 37 68.0 38 104.0 39 138.0 40 162.0 41 208.5 42 242.0 43 263.5 44 290.5 45 295.0 46 286.5 47 276.0 48 261.0 49 229.5 50 182.5 51 142.0 52 121.5 53 101.0 54 74.5 55 56.5 56 41.5 57 28.0 58 20.5 59 15.0 60 11.0 61 9.5 62 5.0 63 5.5 64 4.5 65 3.0 66 3.0 67 2.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.375 2 2.1 3 2.875 4 3.95 5 4.25 6 3.95 7 3.55 8 3.55 9 3.15 10-14 3.8 15-19 4.095 20-24 3.8 25-29 3.3099999999999996 30-34 3.215 35-39 3.6350000000000002 40-44 4.045 45-49 4.05 50-54 3.52 55-59 3.51 60-64 3.6450000000000005 65-69 3.305 70-74 2.8899999999999997 75-79 2.915 80-84 3.005 85-89 4.485 90-94 5.195 95-99 3.485 100-104 3.2 105-109 3.4000000000000004 110-114 3.55 115-119 2.905 120-124 2.55 125-129 3.9699999999999998 130-134 6.84 135-139 8.870000000000001 140-144 10.18 145-149 6.895 150-151 4.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87257472469848 94.27499999999999 2 0.9438909281594127 1.7999999999999998 3 0.026219192448872573 0.075 4 0.0 0.0 5 0.0 0.0 6 0.026219192448872573 0.15 7 0.026219192448872573 0.17500000000000002 8 0.0 0.0 9 0.05243838489774515 0.44999999999999996 >10 0.026219192448872573 0.975 >50 0.026219192448872573 2.1 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 84 2.1 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 39 0.975 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.1375000000000002 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.3625 0.0 0.0 0.0 0.0 114-115 3.7 0.0 0.0 0.0 0.0 116-117 4.237500000000001 0.0 0.0 0.0 0.0 118-119 4.637499999999999 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 5.975 0.0 0.0 0.0 0.0 126-127 6.3625 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.3125 0.0 0.0 0.0 0.0 132-133 7.7875 0.0 0.0 0.0 0.0 134-135 8.537500000000001 0.0 0.0 0.0 0.0 136-137 9.1 0.0 0.0 0.0 0.0 138-139 9.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCCTT 10 0.0068116994 145.01332 8 CAGGAGA 10 0.0068116994 145.01332 9 GCTGTTG 20 0.0059230463 29.002666 45-49 >>END_MODULE Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827547 spots for SRR7169980.sra Written 827547 spots for SRR7169980.sra Read 827565 spots for SRR7169980.sra Written 827565 spots for SRR7169980.sra SRR ids: ['SRR7169980.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wg05lto6 SRR7169980.sra spots: 16550958 blocks: [[1, 827547], [827548, 1655094], [1655095, 2482641], [2482642, 3310188], [3310189, 4137735], [4137736, 4965282], [4965283, 5792829], [5792830, 6620376], [6620377, 7447923], [7447924, 8275470], [8275471, 9103017], [9103018, 9930564], [9930565, 10758111], [10758112, 11585658], [11585659, 12413205], [12413206, 13240752], [13240753, 14068299], [14068300, 14895846], [14895847, 15723393], [15723394, 16550958]] SRR7169980 file size 5586876 SRR7169980 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169980 SRR7169980_1.fastq SRR7169980_2.fastq Input file: SRR7169980_1.fastq Paired file: SRR7169980_2.fastq trimmed: SRR7169980-trimmed-pair1.fastq, SRR7169980-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:15:10 2025 >> started Wed Feb 12 07:15:29 2025 >> done (18.958s) 16550958 read pairs processed; of these: 27912 ( 0.17%) short read pairs filtered out after trimming by size control 203074 ( 1.23%) empty read pairs filtered out after trimming by size control 16319972 (98.60%) read pairs available; of these: 7954987 (48.74%) trimmed read pairs available after processing 8364985 (51.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 10 0.00% 21 7 0.00% 22 12 0.00% 23 11 0.00% 24 20 0.00% 25 19 0.00% 26 21 0.00% 27 19 0.00% 28 23 0.00% 29 20 0.00% 30 26 0.00% 31 11 0.00% 32 29 0.00% 33 21 0.00% 34 30 0.00% 35 26 0.00% 36 38 0.00% 37 37 0.00% 38 33 0.00% 39 58 0.00% 40 54 0.00% 41 63 0.00% 42 65 0.00% 43 72 0.00% 44 84 0.00% 45 123 0.00% 46 147 0.00% 47 167 0.00% 48 183 0.00% 49 216 0.00% 50 225 0.00% 51 243 0.00% 52 292 0.00% 53 294 0.00% 54 318 0.00% 55 330 0.00% 56 378 0.00% 57 418 0.00% 58 455 0.00% 59 521 0.00% 60 575 0.00% 61 628 0.00% 62 712 0.00% 63 877 0.01% 64 952 0.01% 65 1142 0.01% 66 1418 0.01% 67 2428 0.01% 68 2905 0.02% 69 3081 0.02% 70 4872 0.03% 71 3262 0.02% 72 2873 0.02% 73 2924 0.02% 74 3094 0.02% 75 3414 0.02% 76 3735 0.02% 77 3792 0.02% 78 4314 0.03% 79 4815 0.03% 80 5247 0.03% 81 6049 0.04% 82 6908 0.04% 83 7703 0.05% 84 9473 0.06% 85 11116 0.07% 86 11691 0.07% 87 12482 0.08% 88 13531 0.08% 89 14497 0.09% 90 14810 0.09% 91 15655 0.10% 92 16933 0.10% 93 18370 0.11% 94 19847 0.12% 95 21221 0.13% 96 22551 0.14% 97 23349 0.14% 98 24441 0.15% 99 25090 0.15% 100 26234 0.16% 101 26893 0.16% 102 28518 0.17% 103 30161 0.18% 104 31465 0.19% 105 33840 0.21% 106 34832 0.21% 107 35754 0.22% 108 36831 0.23% 109 38328 0.23% 110 38870 0.24% 111 40586 0.25% 112 41190 0.25% 113 43673 0.27% 114 45236 0.28% 115 46854 0.29% 116 48536 0.30% 117 49861 0.31% 118 50623 0.31% 119 50874 0.31% 120 51873 0.32% 121 53238 0.33% 122 54599 0.33% 123 56061 0.34% 124 58627 0.36% 125 59960 0.37% 126 62497 0.38% 127 63985 0.39% 128 65576 0.40% 129 67459 0.41% 130 69410 0.43% 131 70875 0.43% 132 72661 0.45% 133 75139 0.46% 134 78366 0.48% 135 81712 0.50% 136 85270 0.52% 137 89264 0.55% 138 94831 0.58% 139 100835 0.62% 140 105353 0.65% 141 111572 0.68% 142 118401 0.73% 143 126352 0.77% 144 137955 0.85% 145 154248 0.95% 146 181816 1.11% 147 228060 1.40% 148 311498 1.91% 149 577531 3.54% 150 3352889 20.54% 151 8364985 51.26% 16319972 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=40 prefix-density=0.32 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=99.24 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTGTTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGGCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.3 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=40.93 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=11.2 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7169980 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:16:12 Started mapping on | Feb 12 07:16:12 Finished on | Feb 12 07:17:49 Mapping speed, Million of reads per hour | 605.69 Number of input reads | 16319972 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15538348 Uniquely mapped reads % | 95.21% Average mapped length | 290.16 Number of splices: Total | 13113188 Number of splices: Annotated (sjdb) | 12887548 Number of splices: GT/AG | 12927092 Number of splices: GC/AG | 145466 Number of splices: AT/AC | 12099 Number of splices: Non-canonical | 28531 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271713 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 25579 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 531042 531042 531042 N_multimapping 271713 271713 271713 N_noFeature 293164 15289357 392466 N_ambiguous 216412 850 66252 UnstrandedReadsAssigned:15028772 PositiveStrandReadsAssigned:248141 NegativeStrandReadsAssigned:15079630 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169980 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169980-trimmed-pair1.fastq SRR7169980-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,319,972 reads, 15,022,986 reads pseudoaligned [quant] estimated average fragment length: 214.598 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR7169980.ke.tsv 34699 SRR7169980.se.tsv 87100 total ==> SRR7169980.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.4 245 8.46748 Potri.005G024800.1.v4.1 1035 821.402 36 2.73318 Potri.004G059700.1.v4.1 961 747.408 4 0.333752 Potri.007G009000.2.v4.1 1416 1202.4 0 0 Potri.003G141000.2.v4.1 2943 2729.4 220 5.02662 Potri.016G087400.1.v4.1 270 90.424 1658 1143.46 Potri.015G069301.1.v4.1 564 352.234 0 0 Potri.010G195200.1.v4.1 1773 1559.4 17 0.679849 Potri.012G127500.1.v4.1 977 763.408 2230 182.167 ==> SRR7169980.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1570 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169980 completed mapping pipeline successfully