Starting /dee2/code/volunteer_pipeline.sh SRR7169981 current disk space = 3050013073408 free memory = 1581421216 SRR7169981 SRAfilesize 1b495d6728addfed17127520885fec19 SRR7169981.sra SRR7169981.sra file validated SRR7169981 is paired end SRR7169981 is conventional basespace SRR7169981 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169981_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83025 34.0 33.0 34.0 33.0 34.0 2 33.37875 34.0 34.0 34.0 33.0 34.0 3 33.52525 34.0 34.0 34.0 33.0 34.0 4 33.524 34.0 34.0 34.0 33.0 34.0 5 33.37975 34.0 34.0 34.0 33.0 34.0 6 37.26875 38.0 38.0 38.0 36.0 38.0 7 37.49675 38.0 38.0 38.0 37.0 38.0 8 37.58825 38.0 38.0 38.0 38.0 38.0 9 37.6545 38.0 38.0 38.0 38.0 38.0 10-14 37.593849999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.63355 38.0 38.0 38.0 38.0 38.0 20-24 37.544799999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.4222 38.0 38.0 38.0 38.0 38.0 30-34 37.4522 38.0 38.0 38.0 38.0 38.0 35-39 37.25885000000001 38.0 38.0 38.0 37.4 38.0 40-44 37.207100000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.036249999999995 38.0 38.0 38.0 36.2 38.0 50-54 37.08225 38.0 38.0 38.0 36.4 38.0 55-59 36.966899999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.975 38.0 38.0 38.0 36.0 38.0 65-69 36.9083 38.0 38.0 38.0 36.0 38.0 70-74 36.771699999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.468849999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.314350000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.293150000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.09385 38.0 38.0 38.0 33.6 38.0 95-99 35.9621 38.0 38.0 38.0 33.4 38.0 100-104 35.6865 38.0 37.2 38.0 31.2 38.0 105-109 35.5202 38.0 37.0 38.0 30.0 38.0 110-114 35.41795 38.0 37.0 38.0 29.8 38.0 115-119 35.1663 38.0 36.6 38.0 28.4 38.0 120-124 35.26324999999999 38.0 36.6 38.0 29.2 38.0 125-129 34.95075 38.0 36.0 38.0 28.2 38.0 130-134 34.299600000000005 38.0 35.2 38.0 23.8 38.0 135-139 33.467349999999996 38.0 34.2 38.0 17.4 38.0 140-144 33.489850000000004 38.0 34.8 38.0 18.6 38.0 145-149 32.8096 38.0 34.2 38.0 13.2 38.0 150-151 28.445124999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 3.0 12 2.0 13 2.0 14 1.0 15 5.0 16 4.0 17 9.0 18 11.0 19 10.0 20 4.0 21 9.0 22 11.0 23 16.0 24 17.0 25 21.0 26 19.0 27 31.0 28 37.0 29 45.0 30 58.0 31 70.0 32 85.0 33 95.0 34 132.0 35 225.0 36 561.0 37 2515.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.32686414708887 13.1511746680286 9.269662921348315 32.252298263534215 2 22.675 15.7 32.300000000000004 29.325000000000003 3 19.25 21.025 27.55 32.175 4 21.25 27.224999999999998 24.05 27.474999999999998 5 21.5 32.225 24.8 21.475 6 20.325 35.075 24.85 19.75 7 15.15 27.650000000000002 40.1 17.1 8 17.325 27.650000000000002 30.025000000000002 25.0 9 16.900000000000002 26.125 33.75 23.225 10-14 19.575 30.795 26.91 22.720000000000002 15-19 19.485 30.049999999999997 27.185 23.28 20-24 19.509999999999998 29.935000000000002 27.045 23.51 25-29 19.400000000000002 29.599999999999998 27.115000000000002 23.885 30-34 19.384999999999998 29.94 26.715 23.96 35-39 19.52 29.705 27.075 23.7 40-44 19.66 29.609999999999996 26.834999999999997 23.895 45-49 20.16903380676135 29.120824164832964 26.835367073414684 23.874774954991 50-54 20.105 29.125 27.29 23.48 55-59 19.68 29.360000000000003 26.625 24.335 60-64 19.365 29.4 27.325 23.91 65-69 19.525000000000002 28.985 27.22 24.27 70-74 19.950000000000003 28.884999999999998 26.99 24.175 75-79 20.085 28.875 27.47 23.57 80-84 20.19 28.64 27.425 23.745 85-89 20.36323610346725 28.953819982988943 26.962525641667085 23.72041827187672 90-94 20.199939716668343 28.468803375866575 28.19250477243042 23.13875213503466 95-99 20.57286432160804 28.64824120603015 26.77889447236181 24.0 100-104 20.300150075037518 28.609304652326163 26.848424212106053 24.242121060530263 105-109 20.361018050902548 28.671433571678584 27.121356067803394 23.84619230961548 110-114 20.745 28.849999999999998 26.495 23.91 115-119 20.57602880144007 28.33641682084104 26.526326316315817 24.56122806140307 120-124 20.599999999999998 28.605000000000004 26.44 24.355 125-129 21.46714671467147 27.92279227922792 26.832683268326836 23.77737773777378 130-134 21.063691399409617 28.058237854605494 26.026917496372644 24.85115324961225 135-139 21.064779968889557 27.929148477093683 26.51914295749912 24.486928596517636 140-144 21.347808685211124 28.432059235541324 25.765459275565338 24.454672803682207 145-149 21.206965572457968 28.112489991993595 26.090872698158527 24.589671737389914 150-151 21.125 28.1125 26.5875 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.0 24 1.5 25 5.0 26 7.0 27 6.5 28 11.0 29 25.5 30 33.0 31 34.5 32 42.5 33 51.0 34 62.0 35 79.5 36 91.0 37 109.5 38 137.0 39 157.0 40 169.5 41 192.5 42 227.5 43 253.0 44 265.5 45 274.0 46 261.5 47 247.0 48 220.5 49 206.0 50 188.5 51 133.0 52 105.0 53 94.5 54 84.0 55 62.0 56 34.0 57 26.5 58 26.0 59 18.0 60 13.5 61 9.5 62 6.0 63 5.0 64 4.0 65 2.5 66 2.0 67 1.5 68 2.0 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.065 90-94 0.47000000000000003 95-99 0.5 100-104 0.05 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.01 130-134 0.065 135-139 0.35500000000000004 140-144 0.06 145-149 0.08 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01315789473685 97.82499999999999 2 0.9109311740890688 1.7999999999999998 3 0.05060728744939271 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025303643724696356 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCCTGATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 18 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.3625 0.0 0.0 0.0 0.0 98-99 1.7374999999999998 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 2.9000000000000004 0.0 0.0 0.0 0.0 108-109 3.2125 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 4.0 0.0 0.0 0.0 0.0 114-115 4.4125 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.8625 0.0 0.0 0.0 0.0 122-123 6.3625 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.2 0.0 0.0 0.0 0.0 128-129 7.737500000000001 0.0 0.0 0.0 0.0 130-131 8.3 0.0 0.0 0.0 0.0 132-133 8.9375 0.0 0.0 0.0 0.0 134-135 9.587499999999999 0.0 0.0 0.0 0.0 136-137 10.3 0.0 0.0 0.0 0.0 138-139 11.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGGC 10 0.006836113 144.9625 7 TTTTTTT 35 0.0028412784 64.54731 1 >>END_MODULE SRR7169981 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169981_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.81375 33.0 33.0 34.0 32.0 34.0 2 32.132 34.0 33.0 34.0 31.0 34.0 3 32.18475 34.0 33.0 34.0 32.0 34.0 4 31.9585 34.0 33.0 34.0 32.0 34.0 5 31.90925 34.0 33.0 34.0 32.0 34.0 6 35.94475 38.0 38.0 38.0 35.0 38.0 7 35.994 38.0 38.0 38.0 35.0 38.0 8 35.9975 38.0 38.0 38.0 35.0 38.0 9 36.0435 38.0 38.0 38.0 35.0 38.0 10-14 35.9685 38.0 38.0 38.0 35.6 38.0 15-19 35.8742 38.0 38.0 38.0 35.2 38.0 20-24 35.91945 38.0 38.0 38.0 35.0 38.0 25-29 36.0932 38.0 38.0 38.0 35.8 38.0 30-34 36.0997 38.0 38.0 38.0 36.0 38.0 35-39 35.99615 38.0 38.0 38.0 35.6 38.0 40-44 35.893299999999996 38.0 38.0 38.0 35.6 38.0 45-49 35.79065 38.0 38.0 38.0 34.2 38.0 50-54 35.954699999999995 38.0 38.0 38.0 35.4 38.0 55-59 35.9227 38.0 38.0 38.0 34.8 38.0 60-64 35.858050000000006 38.0 38.0 38.0 34.6 38.0 65-69 35.872749999999996 38.0 38.0 38.0 34.8 38.0 70-74 35.799400000000006 38.0 38.0 38.0 34.2 38.0 75-79 35.741699999999994 38.0 38.0 38.0 34.0 38.0 80-84 35.624700000000004 38.0 38.0 38.0 33.8 38.0 85-89 35.2199 38.0 38.0 38.0 31.2 38.0 90-94 34.823 38.0 38.0 38.0 28.6 38.0 95-99 35.2137 38.0 38.0 38.0 30.2 38.0 100-104 35.296200000000006 38.0 38.0 38.0 31.4 38.0 105-109 35.20335000000001 38.0 38.0 38.0 31.2 38.0 110-114 34.99415 38.0 38.0 38.0 29.6 38.0 115-119 34.7363 38.0 37.0 38.0 27.6 38.0 120-124 34.55965 38.0 37.0 38.0 27.2 38.0 125-129 34.10835 38.0 36.2 38.0 22.2 38.0 130-134 32.9815 38.0 35.0 38.0 11.4 38.0 135-139 32.019400000000005 38.0 34.4 38.0 2.0 38.0 140-144 31.16285 38.0 33.4 38.0 2.0 38.0 145-149 30.4321 38.0 32.2 38.0 2.0 38.0 150-151 26.86775 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 113.0 3 6.0 4 1.0 5 2.0 6 0.0 7 2.0 8 1.0 9 4.0 10 3.0 11 2.0 12 2.0 13 3.0 14 6.0 15 13.0 16 7.0 17 15.0 18 12.0 19 6.0 20 14.0 21 8.0 22 12.0 23 13.0 24 14.0 25 25.0 26 20.0 27 16.0 28 38.0 29 40.0 30 55.0 31 71.0 32 92.0 33 115.0 34 130.0 35 189.0 36 420.0 37 2530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.861067910834635 22.498703991705547 13.893208916537066 21.74701918092276 2 28.07906741003548 27.749619868220982 27.952356817029905 16.218955904713635 3 22.55427841634738 30.01277139208174 30.140485312899106 17.292464878671776 4 25.354655661594016 33.45370131545009 22.801134898117102 18.390508124838792 5 24.974120082815734 36.67184265010352 20.341614906832298 18.012422360248447 6 21.915332989158493 37.22250903458957 24.006195147134747 16.855962829117193 7 22.102287329735287 22.56489334361347 35.363659727576454 19.969159599074786 8 24.26111539450013 25.777435106656387 25.417630429195583 24.543819069647903 9 22.623622854214705 26.851140148603637 27.95285677683833 22.572380220343323 10-14 24.231026843217066 28.98140038126642 25.699417795867895 21.088154979648614 15-19 23.815673916412667 28.217182414630365 27.292452342821715 20.674691326135246 20-24 24.22837120626578 28.23723398773638 26.737775029628487 20.79661977636935 25-29 24.344703770197487 27.950756604257503 27.18132854578097 20.523211079764042 30-34 24.801394085387727 27.697196453282764 27.184665060734968 20.316744400594537 35-39 23.64927446742822 27.89441185551096 27.55480086446434 20.901512812596483 40-44 24.7185208139655 28.04978824501601 26.732775539716968 20.498915401301517 45-49 24.736515809051458 27.536681132465386 27.557346559206447 20.169456499276713 50-54 24.532374100719426 27.97533401849949 27.430626927029806 20.061664953751286 55-59 24.315156498946394 28.288019735827724 27.27553065734697 20.121293107878913 60-64 24.502289212408044 28.010700138896034 27.141313853593292 20.345696795102626 65-69 24.413892166418712 28.010054891499514 27.46626994305648 20.109782999025292 70-74 23.911932979158156 28.07008581937066 27.34981610134859 20.6681651001226 75-79 24.64723926380368 27.781186094069533 27.213701431492844 20.357873210633947 80-84 23.861892583120202 28.21994884910486 27.595907928388748 20.322250639386187 85-89 24.156545209176787 27.86255579777847 27.608221737776397 20.37267725526835 90-94 24.50036622371037 27.40922883750131 27.581877158104007 20.508527780684314 95-99 24.386984012748677 28.484038451652697 26.905875700406106 20.223101835192516 100-104 25.0922131147541 27.86885245901639 27.003073770491802 20.035860655737707 105-109 24.534113660865547 28.00965141947739 27.49114430925612 19.965090610400946 110-114 24.82779891024982 27.295157808162845 27.814331242932045 20.062712038655288 115-119 25.026830888741248 27.47483007103797 27.525936525783205 19.972402514437572 120-124 24.584903738412958 28.073749618009575 27.274116328817357 20.06723031476011 125-129 25.264625393710954 27.76888521712191 27.30934063097021 19.657148758196932 130-134 25.371865703357415 27.677433064173396 27.183382915427114 19.767318317042072 135-139 26.269076739906914 28.157809286719342 26.36648987985713 19.206624093516613 140-144 25.531565103024988 27.800306882946074 26.819377466023674 19.848750548005263 145-149 26.18895966029724 27.537154989384288 26.65074309978769 19.623142250530787 150-151 25.99198655809745 28.499418379216753 26.819180560940932 18.68941450174486 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 65.0 1 40.0 2 9.0 3 2.5 4 1.5 5 2.0 6 1.5 7 1.0 8 3.5 9 2.5 10 1.5 11 1.5 12 1.0 13 1.0 14 1.0 15 1.5 16 1.0 17 1.0 18 1.5 19 2.0 20 1.0 21 0.5 22 0.5 23 3.5 24 5.0 25 3.5 26 3.5 27 4.5 28 6.5 29 7.0 30 9.5 31 10.5 32 12.5 33 21.5 34 27.5 35 34.5 36 51.0 37 78.0 38 109.0 39 143.0 40 180.0 41 211.0 42 247.5 43 268.5 44 286.5 45 304.5 46 298.5 47 298.5 48 266.0 49 208.5 50 179.5 51 154.5 52 122.0 53 88.5 54 64.5 55 55.5 56 36.5 57 18.0 58 17.0 59 14.0 60 9.0 61 5.0 62 4.5 63 5.5 64 3.0 65 2.5 66 2.5 67 1.0 68 0.0 69 0.5 70 1.5 71 2.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.55 2 1.35 3 2.125 4 3.075 5 3.4000000000000004 6 3.15 7 2.725 8 2.725 9 2.4250000000000003 10-14 2.955 15-19 3.215 20-24 2.965 25-29 2.5250000000000004 30-34 2.445 35-39 2.83 40-44 3.19 45-49 3.2199999999999998 50-54 2.7 55-59 2.715 60-64 2.8049999999999997 65-69 2.535 70-74 2.12 75-79 2.1999999999999997 80-84 2.25 85-89 3.6700000000000004 90-94 4.43 95-99 2.735 100-104 2.4 105-109 2.605 110-114 2.73 115-119 2.165 120-124 1.83 125-129 3.1649999999999996 130-134 5.88 135-139 7.61 140-144 8.76 145-149 5.800000000000001 150-151 3.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.94193548387096 95.85000000000001 2 0.8774193548387097 1.7000000000000002 3 0.025806451612903226 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025806451612903226 0.15 7 0.05161290322580645 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.05161290322580645 0.525 >50 0.025806451612903226 1.35 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 54 1.35 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.7374999999999998 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.2249999999999996 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.95 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 4.05 0.0 0.0 0.0 0.0 114-115 4.4875 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.300000000000001 0.0 0.0 0.0 0.0 120-121 5.8125 0.0 0.0 0.0 0.0 122-123 6.2125 0.0 0.0 0.0 0.0 124-125 6.5875 0.0 0.0 0.0 0.0 126-127 7.0125 0.0 0.0 0.0 0.0 128-129 7.5625 0.0 0.0 0.0 0.0 130-131 8.1125 0.0 0.0 0.0 0.0 132-133 8.8 0.0 0.0 0.0 0.0 134-135 9.4375 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 10.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTTA 10 0.0068998937 144.44156 9 >>END_MODULE Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722097 spots for SRR7169981.sra Written 722097 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra Read 722078 spots for SRR7169981.sra Written 722078 spots for SRR7169981.sra SRR ids: ['SRR7169981.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3vv5kmkf SRR7169981.sra spots: 14441579 blocks: [[1, 722078], [722079, 1444156], [1444157, 2166234], [2166235, 2888312], [2888313, 3610390], [3610391, 4332468], [4332469, 5054546], [5054547, 5776624], [5776625, 6498702], [6498703, 7220780], [7220781, 7942858], [7942859, 8664936], [8664937, 9387014], [9387015, 10109092], [10109093, 10831170], [10831171, 11553248], [11553249, 12275326], [12275327, 12997404], [12997405, 13719482], [13719483, 14441579]] SRR7169981 file size 4872076 SRR7169981 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169981 SRR7169981_1.fastq SRR7169981_2.fastq Input file: SRR7169981_1.fastq Paired file: SRR7169981_2.fastq trimmed: SRR7169981-trimmed-pair1.fastq, SRR7169981-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:26:31 2025 >> started Wed Feb 12 07:26:46 2025 >> done (15.129s) 14441579 read pairs processed; of these: 26649 ( 0.18%) short read pairs filtered out after trimming by size control 73502 ( 0.51%) empty read pairs filtered out after trimming by size control 14341428 (99.31%) read pairs available; of these: 7224103 (50.37%) trimmed read pairs available after processing 7117325 (49.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 8 0.00% 21 9 0.00% 22 15 0.00% 23 12 0.00% 24 13 0.00% 25 10 0.00% 26 22 0.00% 27 20 0.00% 28 13 0.00% 29 19 0.00% 30 16 0.00% 31 28 0.00% 32 32 0.00% 33 22 0.00% 34 34 0.00% 35 35 0.00% 36 35 0.00% 37 34 0.00% 38 51 0.00% 39 42 0.00% 40 51 0.00% 41 81 0.00% 42 47 0.00% 43 76 0.00% 44 108 0.00% 45 85 0.00% 46 121 0.00% 47 124 0.00% 48 147 0.00% 49 172 0.00% 50 189 0.00% 51 264 0.00% 52 258 0.00% 53 256 0.00% 54 286 0.00% 55 299 0.00% 56 338 0.00% 57 300 0.00% 58 439 0.00% 59 454 0.00% 60 554 0.00% 61 670 0.00% 62 767 0.01% 63 858 0.01% 64 955 0.01% 65 1044 0.01% 66 1303 0.01% 67 1725 0.01% 68 2145 0.01% 69 2866 0.02% 70 3812 0.03% 71 2764 0.02% 72 2575 0.02% 73 2708 0.02% 74 3035 0.02% 75 3231 0.02% 76 3503 0.02% 77 3881 0.03% 78 4162 0.03% 79 4612 0.03% 80 5120 0.04% 81 6070 0.04% 82 6854 0.05% 83 7558 0.05% 84 9301 0.06% 85 10648 0.07% 86 11215 0.08% 87 11881 0.08% 88 12571 0.09% 89 12923 0.09% 90 13919 0.10% 91 14842 0.10% 92 16025 0.11% 93 17514 0.12% 94 18774 0.13% 95 19790 0.14% 96 20719 0.14% 97 21218 0.15% 98 21414 0.15% 99 22521 0.16% 100 23609 0.16% 101 24840 0.17% 102 26486 0.18% 103 27981 0.20% 104 29516 0.21% 105 30857 0.22% 106 32306 0.23% 107 32575 0.23% 108 33093 0.23% 109 33237 0.23% 110 34205 0.24% 111 35481 0.25% 112 37099 0.26% 113 39912 0.28% 114 41032 0.29% 115 43004 0.30% 116 43535 0.30% 117 44531 0.31% 118 44681 0.31% 119 45021 0.31% 120 45963 0.32% 121 47370 0.33% 122 48611 0.34% 123 51048 0.36% 124 53431 0.37% 125 54595 0.38% 126 57320 0.40% 127 58418 0.41% 128 59342 0.41% 129 59923 0.42% 130 61139 0.43% 131 62966 0.44% 132 65100 0.45% 133 68609 0.48% 134 71854 0.50% 135 75103 0.52% 136 78645 0.55% 137 81569 0.57% 138 86414 0.60% 139 90720 0.63% 140 93948 0.66% 141 100394 0.70% 142 107121 0.75% 143 115485 0.81% 144 127508 0.89% 145 143020 1.00% 146 168508 1.17% 147 214474 1.50% 148 292349 2.04% 149 539977 3.77% 150 3007556 20.97% 151 7117325 49.63% 14341428 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=293.47 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=18.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=17.76 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=7.4 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=156.21 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.6 sequence=GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCC SRR7169981 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:27:27 Started mapping on | Feb 12 07:27:27 Finished on | Feb 12 07:28:43 Mapping speed, Million of reads per hour | 679.33 Number of input reads | 14341428 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13548211 Uniquely mapped reads % | 94.47% Average mapped length | 289.44 Number of splices: Total | 11300546 Number of splices: Annotated (sjdb) | 11084892 Number of splices: GT/AG | 11127295 Number of splices: GC/AG | 135106 Number of splices: AT/AC | 10055 Number of splices: Non-canonical | 28090 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261730 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 20952 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554500 554500 554500 N_multimapping 261730 261730 261730 N_noFeature 277021 13355787 363910 N_ambiguous 160701 824 54656 UnstrandedReadsAssigned:13110489 PositiveStrandReadsAssigned:191600 NegativeStrandReadsAssigned:13129645 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169981 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169981-trimmed-pair1.fastq SRR7169981-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,341,428 reads, 13,095,847 reads pseudoaligned [quant] estimated average fragment length: 213.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7169981.ke.tsv 34699 SRR7169981.se.tsv 87100 total ==> SRR7169981.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.01 241 8.77029 Potri.005G024800.1.v4.1 1035 822.009 36 2.87675 Potri.004G059700.1.v4.1 961 748.026 24 2.10752 Potri.007G009000.2.v4.1 1416 1203.01 0 0 Potri.003G141000.2.v4.1 2943 2730.01 247 5.94305 Potri.016G087400.1.v4.1 270 91.2584 1664.89 1198.37 Potri.015G069301.1.v4.1 564 352.978 0 0 Potri.010G195200.1.v4.1 1773 1560.01 16.5037 0.694912 Potri.012G127500.1.v4.1 977 764.02 5962 512.582 ==> SRR7169981.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 921 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7169981 completed mapping pipeline successfully