Starting /dee2/code/volunteer_pipeline.sh SRR7169982 current disk space = 3050243043328 free memory = 1478385412 SRR7169982 SRAfilesize 42e5e33424cff1d50c28ae77382ef787 SRR7169982.sra SRR7169982.sra file validated SRR7169982 is paired end SRR7169982 is conventional basespace SRR7169982 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169982_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12875 34.0 34.0 34.0 33.0 34.0 2 33.53925 34.0 34.0 34.0 33.0 34.0 3 33.5645 34.0 34.0 34.0 33.0 34.0 4 33.65025 34.0 34.0 34.0 33.0 34.0 5 33.58125 34.0 34.0 34.0 33.0 34.0 6 37.437 38.0 38.0 38.0 37.0 38.0 7 37.571 38.0 38.0 38.0 38.0 38.0 8 37.7065 38.0 38.0 38.0 38.0 38.0 9 37.66325 38.0 38.0 38.0 38.0 38.0 10-14 37.6741 38.0 38.0 38.0 38.0 38.0 15-19 37.64815 38.0 38.0 38.0 38.0 38.0 20-24 37.64065 38.0 38.0 38.0 38.0 38.0 25-29 37.62820000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.6052 38.0 38.0 38.0 38.0 38.0 35-39 37.5322 38.0 38.0 38.0 38.0 38.0 40-44 37.39639999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.1896 38.0 38.0 38.0 37.0 38.0 50-54 37.26100000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.23055 38.0 38.0 38.0 37.0 38.0 60-64 37.1822 38.0 38.0 38.0 36.4 38.0 65-69 37.135000000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.05945 38.0 38.0 38.0 36.0 38.0 75-79 37.0096 38.0 38.0 38.0 36.0 38.0 80-84 36.901650000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.688649999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.430099999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.2652 38.0 38.0 38.0 34.0 38.0 100-104 36.374199999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.29885 38.0 38.0 38.0 34.0 38.0 110-114 36.15755 38.0 38.0 38.0 33.6 38.0 115-119 35.9072 38.0 37.2 38.0 32.6 38.0 120-124 35.75935 38.0 37.0 38.0 32.6 38.0 125-129 35.3549 38.0 36.2 38.0 30.6 38.0 130-134 35.0589 38.0 35.8 38.0 28.6 38.0 135-139 34.55245 38.0 35.2 38.0 26.8 38.0 140-144 34.43805 38.0 35.0 38.0 27.2 38.0 145-149 33.85435 38.0 35.0 38.0 21.4 38.0 150-151 30.32075 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 2.0 14 1.0 15 5.0 16 5.0 17 6.0 18 7.0 19 3.0 20 3.0 21 6.0 22 8.0 23 8.0 24 10.0 25 8.0 26 23.0 27 16.0 28 25.0 29 23.0 30 35.0 31 51.0 32 68.0 33 74.0 34 122.0 35 234.0 36 526.0 37 2728.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.23744292237443 13.064434297311008 10.527650938609842 34.17047184170472 2 23.0 16.650000000000002 32.275 28.075 3 19.725 21.825 26.575 31.874999999999996 4 22.25 29.95 22.725 25.074999999999996 5 21.675 33.225 24.575 20.525 6 19.675 34.775 25.6 19.950000000000003 7 14.774999999999999 26.775 40.375 18.075 8 18.45 24.224999999999998 31.324999999999996 26.0 9 18.3 24.9 31.874999999999996 24.925 10-14 19.82 29.56 26.93 23.69 15-19 19.794999999999998 28.515 27.58 24.11 20-24 20.055 28.815 27.55 23.580000000000002 25-29 19.985 28.985 27.250000000000004 23.78 30-34 20.150000000000002 28.255000000000003 27.245 24.349999999999998 35-39 19.695 28.244999999999997 27.500000000000004 24.560000000000002 40-44 20.15104531359408 28.458537561268383 27.558267480244076 23.83214964489347 45-49 20.15453313933069 28.32271336109578 27.33430334654558 24.188450153027947 50-54 20.529105821164233 28.765753150630125 27.285457091418287 23.419683936787358 55-59 20.335 28.59 27.084999999999997 23.990000000000002 60-64 20.095 28.749999999999996 27.315 23.84 65-69 20.47 27.985 27.565 23.98 70-74 20.51 28.115000000000002 27.589999999999996 23.785 75-79 20.165 27.85 27.744999999999997 24.240000000000002 80-84 20.237023702370237 28.91289128912891 26.732673267326735 24.117411741174116 85-89 20.411336844745424 27.75018811136193 27.845497868071234 23.99297717582142 90-94 20.555331586373715 28.300745817375528 27.368474097964118 23.775448498286636 95-99 20.293361560562527 28.11129593225465 27.395534049095215 24.199808458087606 100-104 20.784687077216013 28.38602996442351 27.293681415042343 23.535601543318137 105-109 20.482048204820483 27.912791279127912 27.257725772577256 24.34743474347435 110-114 20.890290921836662 28.135796905512994 27.414751389514798 23.559160783135546 115-119 20.676202860858258 28.018405521656497 27.123136941082326 24.18225467640292 120-124 21.025 28.275 26.985 23.715 125-129 21.325 28.21 26.75 23.715 130-134 21.315010782887807 27.42865740508551 27.228045538893625 24.028286273133055 135-139 21.419588510488456 28.391770209769103 26.299109613159615 23.889531666582826 140-144 21.593133564222256 27.992772172865532 26.37654971640817 24.03754454650404 145-149 21.341616151495415 28.54566404488753 26.581834577425983 23.530885226191074 150-151 20.599999999999998 28.4125 26.724999999999998 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 1.5 25 0.5 26 2.5 27 7.0 28 10.0 29 14.5 30 18.5 31 25.5 32 33.5 33 37.5 34 47.5 35 64.5 36 86.0 37 111.0 38 133.5 39 150.5 40 176.5 41 222.0 42 246.0 43 243.5 44 260.5 45 266.0 46 266.0 47 252.5 48 226.0 49 209.0 50 172.0 51 145.5 52 134.5 53 110.0 54 83.0 55 54.0 56 34.5 57 32.5 58 23.0 59 14.0 60 17.5 61 14.0 62 7.5 63 11.0 64 7.5 65 3.0 66 5.5 67 6.0 68 3.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.03 45-49 0.345 50-54 0.02 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.325 90-94 0.7799999999999999 95-99 0.8049999999999999 100-104 0.215 105-109 0.01 110-114 0.145 115-119 0.03 120-124 0.0 125-129 0.0 130-134 0.305 135-139 0.605 140-144 0.385 145-149 0.19499999999999998 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.7125 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.887499999999999 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.512499999999999 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169982 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169982_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9845 33.0 33.0 34.0 32.0 34.0 2 32.1235 34.0 33.0 34.0 32.0 34.0 3 32.13825 34.0 33.0 34.0 32.0 34.0 4 31.83225 34.0 33.0 34.0 31.0 34.0 5 31.84025 34.0 33.0 34.0 32.0 34.0 6 35.977 38.0 38.0 38.0 34.0 38.0 7 36.036 38.0 38.0 38.0 35.0 38.0 8 36.0915 38.0 38.0 38.0 35.0 38.0 9 36.11725 38.0 38.0 38.0 36.0 38.0 10-14 36.0222 38.0 38.0 38.0 35.8 38.0 15-19 35.8072 38.0 38.0 38.0 34.8 38.0 20-24 35.942899999999995 38.0 38.0 38.0 35.2 38.0 25-29 36.0156 38.0 38.0 38.0 36.0 38.0 30-34 35.99885 38.0 38.0 38.0 36.0 38.0 35-39 35.9486 38.0 38.0 38.0 36.0 38.0 40-44 35.75585 38.0 38.0 38.0 35.2 38.0 45-49 35.6837 38.0 38.0 38.0 34.6 38.0 50-54 35.9024 38.0 38.0 38.0 35.0 38.0 55-59 35.8289 38.0 38.0 38.0 35.2 38.0 60-64 35.82235 38.0 38.0 38.0 34.8 38.0 65-69 35.7768 38.0 38.0 38.0 34.2 38.0 70-74 35.78335 38.0 38.0 38.0 34.6 38.0 75-79 35.67115 38.0 38.0 38.0 34.0 38.0 80-84 35.5578 38.0 38.0 38.0 33.2 38.0 85-89 35.1717 38.0 38.0 38.0 32.2 38.0 90-94 34.7161 38.0 38.0 38.0 27.8 38.0 95-99 35.15265 38.0 38.0 38.0 30.2 38.0 100-104 35.1432 38.0 38.0 38.0 30.6 38.0 105-109 35.0702 38.0 38.0 38.0 30.2 38.0 110-114 34.8565 38.0 38.0 38.0 28.6 38.0 115-119 34.71665 38.0 37.4 38.0 27.6 38.0 120-124 34.4191 38.0 37.0 38.0 24.4 38.0 125-129 34.01835 38.0 36.2 38.0 20.4 38.0 130-134 33.03529999999999 38.0 35.4 38.0 11.4 38.0 135-139 31.95015 38.0 34.4 38.0 2.0 38.0 140-144 31.041500000000003 38.0 32.6 38.0 2.0 38.0 145-149 30.6091 38.0 31.4 38.0 2.0 38.0 150-151 27.030749999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 122.0 3 11.0 4 3.0 5 2.0 6 5.0 7 1.0 8 1.0 9 1.0 10 3.0 11 5.0 12 1.0 13 5.0 14 4.0 15 4.0 16 10.0 17 2.0 18 5.0 19 8.0 20 10.0 21 9.0 22 12.0 23 8.0 24 17.0 25 22.0 26 20.0 27 34.0 28 42.0 29 44.0 30 41.0 31 74.0 32 82.0 33 142.0 34 128.0 35 162.0 36 447.0 37 2513.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.082219938335044 20.91469681397739 13.566289825282633 25.436793422404936 2 26.692111959287534 25.776081424936386 30.203562340966922 17.32824427480916 3 21.114519427402865 28.936605316973413 30.035787321063395 19.913087934560327 4 24.35367114788004 33.89348500517063 23.00930713547053 18.7435367114788 5 24.68305304010349 35.29107373868047 22.095730918499353 17.93014230271669 6 21.05939830290563 35.81897660066855 23.810748264335306 19.31087683209051 7 20.982257649781435 21.445101568526614 38.90460272563641 18.66803805605554 8 23.021582733812952 25.15416238437821 27.363823227132578 24.46043165467626 9 21.76818298637882 25.006425083526086 30.043690567977382 23.181701362117707 10-14 23.47485572959604 28.390354492992582 26.865210222588626 21.269579554822755 15-19 23.514479614567684 27.58638553592706 28.078537014971765 20.82059783453349 20-24 23.649484536082475 28.144329896907216 27.01546391752577 21.190721649484537 25-29 23.242519441726323 28.562599783694704 27.408971519802233 20.78590925477674 30-34 23.677023754315453 27.160302983459577 27.649817076312672 21.512856185912298 35-39 23.92505032777577 27.79125587157384 27.084086099210243 21.199607701440147 40-44 23.68093707888463 27.54224111122629 28.05017103762828 20.726650772260808 45-49 23.784821289619753 27.851844166623437 27.753281112206256 20.61005343155055 50-54 23.58485706927633 27.962915271697142 27.380891063610612 21.071336595415914 55-59 23.646386069754264 27.505022925145532 27.45350574416568 21.395085260934522 60-64 23.495465787304205 27.684460016488043 28.086356141797197 20.733718054410552 65-69 23.513680312692863 27.710347665089486 27.684632791606667 21.091339230610988 70-74 23.791250959324636 27.51087234586851 27.909951394218467 20.787925300588388 75-79 23.623982386974554 27.709794685371975 27.576672981414163 21.089549946239313 80-84 24.36101825662124 27.518642324505016 27.83234764721008 20.287991771663666 85-89 23.99186186029527 27.560123115446817 27.972246856904377 20.47576816735354 90-94 24.15151833560996 27.566460018913524 27.571713775349377 20.71030787012714 95-99 24.179735864630622 28.18303755674783 27.06355757325629 20.57366900536525 100-104 24.413942011104258 27.529302899444787 27.858317910754675 20.198437178696278 105-109 24.39314120442103 27.326722446028302 27.817374238198532 20.462762111352134 110-114 24.22222222222222 27.416020671834623 27.695090439276488 20.666666666666668 115-119 24.62717268332819 27.60979121670266 27.37323871233158 20.38979738763756 120-124 24.86583184257603 27.31408126756964 27.3498594428827 20.470227446971634 125-129 24.975336206448933 27.98172283088426 26.84459213874033 20.198348823926477 130-134 25.012019872856456 28.24937229552861 26.49714194134302 20.24146589027192 135-139 25.249822530442856 27.35761480915197 26.817015235078905 20.57554742532627 140-144 25.16114692153812 27.91175816848189 26.744832184929983 20.18226272505001 145-149 25.6044835868695 27.73952495329597 26.890846010141445 19.76514544969309 150-151 25.906668399844012 27.8434940855323 27.21955024047836 19.030287274145326 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 79.0 1 43.5 2 6.0 3 4.5 4 3.5 5 2.0 6 2.5 7 2.0 8 0.5 9 1.0 10 1.5 11 1.5 12 2.0 13 1.0 14 0.5 15 1.5 16 1.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.5 23 3.0 24 2.5 25 4.0 26 5.5 27 6.5 28 6.5 29 8.0 30 10.0 31 15.0 32 22.5 33 24.0 34 36.5 35 59.5 36 72.5 37 95.0 38 127.0 39 142.5 40 174.5 41 214.0 42 250.0 43 273.5 44 267.5 45 277.5 46 276.0 47 253.0 48 229.0 49 193.0 50 162.0 51 146.0 52 126.0 53 99.5 54 75.0 55 54.5 56 37.5 57 27.5 58 23.5 59 18.5 60 13.0 61 8.0 62 9.0 63 10.5 64 8.5 65 4.0 66 1.0 67 1.0 68 3.0 69 3.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.7 2 1.7500000000000002 3 2.1999999999999997 4 3.3000000000000003 5 3.375 6 2.775 7 2.775 8 2.7 9 2.725 10-14 2.96 15-19 3.485 20-24 3.0 25-29 2.915 30-34 2.965 35-39 3.1350000000000002 40-44 3.53 45-49 3.615 50-54 2.9250000000000003 55-59 2.945 60-64 2.96 65-69 2.78 70-74 2.275 75-79 2.3449999999999998 80-84 2.775 85-89 4.154999999999999 90-94 4.83 95-99 3.08 100-104 2.74 105-109 3.19 110-114 3.25 115-119 2.77 120-124 2.175 125-129 3.705 130-134 6.404999999999999 135-139 8.434999999999999 140-144 10.02 145-149 6.325 150-151 3.8375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.20226453937211 96.375 2 0.5918682449819866 1.15 3 0.07720020586721565 0.22499999999999998 4 0.0514668039114771 0.2 5 0.02573340195573855 0.125 6 0.0 0.0 7 0.02573340195573855 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02573340195573855 1.7500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 70 1.7500000000000002 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 3.8499999999999996 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.25 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.5375 0.0 0.0 0.0 0.0 138-139 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775321 spots for SRR7169982.sra Written 775321 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra Read 775304 spots for SRR7169982.sra Written 775304 spots for SRR7169982.sra SRR ids: ['SRR7169982.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qmvr7ucs SRR7169982.sra spots: 15506097 blocks: [[1, 775304], [775305, 1550608], [1550609, 2325912], [2325913, 3101216], [3101217, 3876520], [3876521, 4651824], [4651825, 5427128], [5427129, 6202432], [6202433, 6977736], [6977737, 7753040], [7753041, 8528344], [8528345, 9303648], [9303649, 10078952], [10078953, 10854256], [10854257, 11629560], [11629561, 12404864], [12404865, 13180168], [13180169, 13955472], [13955473, 14730776], [14730777, 15506097]] SRR7169982 file size 5232807 SRR7169982 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169982 SRR7169982_1.fastq SRR7169982_2.fastq Input file: SRR7169982_1.fastq Paired file: SRR7169982_2.fastq trimmed: SRR7169982-trimmed-pair1.fastq, SRR7169982-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:38:51 2025 >> started Wed Feb 12 06:39:07 2025 >> done (15.865s) 15506097 read pairs processed; of these: 23725 ( 0.15%) short read pairs filtered out after trimming by size control 33960 ( 0.22%) empty read pairs filtered out after trimming by size control 15448412 (99.63%) read pairs available; of these: 7424269 (48.06%) trimmed read pairs available after processing 8024143 (51.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 6 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 2 0.00% 26 5 0.00% 27 6 0.00% 28 12 0.00% 29 12 0.00% 30 10 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 11 0.00% 35 12 0.00% 36 18 0.00% 37 14 0.00% 38 22 0.00% 39 27 0.00% 40 24 0.00% 41 38 0.00% 42 43 0.00% 43 28 0.00% 44 28 0.00% 45 41 0.00% 46 43 0.00% 47 54 0.00% 48 76 0.00% 49 81 0.00% 50 96 0.00% 51 98 0.00% 52 119 0.00% 53 125 0.00% 54 143 0.00% 55 152 0.00% 56 150 0.00% 57 207 0.00% 58 231 0.00% 59 240 0.00% 60 278 0.00% 61 331 0.00% 62 362 0.00% 63 440 0.00% 64 485 0.00% 65 508 0.00% 66 533 0.00% 67 686 0.00% 68 791 0.01% 69 936 0.01% 70 1163 0.01% 71 1132 0.01% 72 1274 0.01% 73 1503 0.01% 74 1570 0.01% 75 1744 0.01% 76 1928 0.01% 77 2057 0.01% 78 2234 0.01% 79 2525 0.02% 80 2834 0.02% 81 3360 0.02% 82 3884 0.03% 83 4362 0.03% 84 5675 0.04% 85 6664 0.04% 86 6891 0.04% 87 7320 0.05% 88 7651 0.05% 89 8133 0.05% 90 8702 0.06% 91 9373 0.06% 92 10316 0.07% 93 11431 0.07% 94 12122 0.08% 95 12889 0.08% 96 13214 0.09% 97 13922 0.09% 98 14171 0.09% 99 14875 0.10% 100 15972 0.10% 101 16896 0.11% 102 18085 0.12% 103 19529 0.13% 104 20373 0.13% 105 21585 0.14% 106 22436 0.15% 107 22472 0.15% 108 23257 0.15% 109 24038 0.16% 110 24846 0.16% 111 25804 0.17% 112 27583 0.18% 113 29166 0.19% 114 30979 0.20% 115 32173 0.21% 116 33006 0.21% 117 33669 0.22% 118 34044 0.22% 119 34409 0.22% 120 35332 0.23% 121 36886 0.24% 122 38453 0.25% 123 40564 0.26% 124 42854 0.28% 125 44836 0.29% 126 46309 0.30% 127 47564 0.31% 128 48398 0.31% 129 48939 0.32% 130 51504 0.33% 131 52586 0.34% 132 55459 0.36% 133 59268 0.38% 134 62628 0.41% 135 65792 0.43% 136 69850 0.45% 137 73383 0.48% 138 79130 0.51% 139 84996 0.55% 140 88703 0.57% 141 96824 0.63% 142 106173 0.69% 143 115643 0.75% 144 130950 0.85% 145 151370 0.98% 146 183823 1.19% 147 234330 1.52% 148 343592 2.22% 149 658889 4.27% 150 3516435 22.76% 151 8024143 51.94% 15448412 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=37 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=98.33 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=15.4 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=11 fanout-score=54.66 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.3 sequence=TGTTGGTGGTGG SRR7169982 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:39:57 Started mapping on | Feb 12 06:39:57 Finished on | Feb 12 06:41:39 Mapping speed, Million of reads per hour | 545.24 Number of input reads | 15448412 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14159819 Uniquely mapped reads % | 91.66% Average mapped length | 292.66 Number of splices: Total | 13059055 Number of splices: Annotated (sjdb) | 12824072 Number of splices: GT/AG | 12872287 Number of splices: GC/AG | 147743 Number of splices: AT/AC | 10787 Number of splices: Non-canonical | 28238 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288369 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 400408 % of reads mapped to too many loci | 2.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1019931 1019931 1019931 N_multimapping 288369 288369 288369 N_noFeature 330485 13983341 401870 N_ambiguous 162983 1011 57143 UnstrandedReadsAssigned:13666351 PositiveStrandReadsAssigned:175467 NegativeStrandReadsAssigned:13700806 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169982 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169982-trimmed-pair1.fastq SRR7169982-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,448,412 reads, 13,896,493 reads pseudoaligned [quant] estimated average fragment length: 234.403 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7169982.ke.tsv 34699 SRR7169982.se.tsv 87100 total ==> SRR7169982.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.6 244 9.59212 Potri.005G024800.1.v4.1 1035 801.597 27 2.36305 Potri.004G059700.1.v4.1 961 727.643 12 1.15699 Potri.007G009000.2.v4.1 1416 1182.6 0 0 Potri.003G141000.2.v4.1 2943 2709.6 337.042 8.7266 Potri.016G087400.1.v4.1 270 84.6691 1346 1115.28 Potri.015G069301.1.v4.1 564 335.884 0 0 Potri.010G195200.1.v4.1 1773 1539.6 15 0.683517 Potri.012G127500.1.v4.1 977 743.628 2433 229.536 ==> SRR7169982.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1747 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169982 completed mapping pipeline successfully