Starting /dee2/code/volunteer_pipeline.sh SRR7169983 current disk space = 3050242490368 free memory = 967252540 SRR7169983 SRAfilesize 50df9fce1838aca40ffc0bf46075611b SRR7169983.sra SRR7169983.sra file validated SRR7169983 is paired end SRR7169983 is conventional basespace SRR7169983 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169983_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83175 34.0 33.0 34.0 33.0 34.0 2 33.359 34.0 33.0 34.0 33.0 34.0 3 33.37125 34.0 34.0 34.0 33.0 34.0 4 33.47825 34.0 34.0 34.0 33.0 34.0 5 33.5435 34.0 34.0 34.0 33.0 34.0 6 37.21325 38.0 38.0 38.0 36.0 38.0 7 37.52675 38.0 38.0 38.0 37.0 38.0 8 37.5365 38.0 38.0 38.0 38.0 38.0 9 37.5965 38.0 38.0 38.0 38.0 38.0 10-14 37.55835 38.0 38.0 38.0 38.0 38.0 15-19 37.4808 38.0 38.0 38.0 38.0 38.0 20-24 37.496500000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.47429999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.43749999999999 38.0 38.0 38.0 37.2 38.0 35-39 37.38215 38.0 38.0 38.0 37.0 38.0 40-44 37.23290000000001 38.0 38.0 38.0 36.4 38.0 45-49 37.086299999999994 38.0 38.0 38.0 36.0 38.0 50-54 37.05929999999999 38.0 38.0 38.0 36.0 38.0 55-59 37.0131 38.0 38.0 38.0 36.0 38.0 60-64 36.92475 38.0 38.0 38.0 35.8 38.0 65-69 36.86465 38.0 38.0 38.0 35.6 38.0 70-74 36.8245 38.0 38.0 38.0 35.0 38.0 75-79 36.6637 38.0 38.0 38.0 34.6 38.0 80-84 36.592600000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.47765 38.0 38.0 38.0 34.0 38.0 90-94 36.2729 38.0 38.0 38.0 34.0 38.0 95-99 36.1091 38.0 37.2 38.0 33.2 38.0 100-104 35.9642 38.0 37.0 38.0 32.4 38.0 105-109 35.7622 38.0 37.0 38.0 31.4 38.0 110-114 35.72895 38.0 37.0 38.0 31.2 38.0 115-119 35.4247 38.0 36.0 38.0 29.8 38.0 120-124 35.109899999999996 38.0 36.0 38.0 28.4 38.0 125-129 34.726150000000004 38.0 35.4 38.0 27.4 38.0 130-134 34.27065 38.0 35.0 38.0 24.2 38.0 135-139 33.8249 38.0 34.2 38.0 22.0 38.0 140-144 33.6188 38.0 34.2 38.0 21.8 38.0 145-149 32.55125 38.0 33.2 38.0 15.0 38.0 150-151 28.351 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 2.0 15 2.0 16 0.0 17 6.0 18 3.0 19 2.0 20 5.0 21 10.0 22 11.0 23 11.0 24 16.0 25 9.0 26 28.0 27 23.0 28 46.0 29 38.0 30 49.0 31 58.0 32 69.0 33 141.0 34 165.0 35 314.0 36 746.0 37 2241.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.25954198473283 14.30025445292621 7.0483460559796445 32.39185750636132 2 22.55 15.0 35.175 27.275 3 18.9 22.55 28.675 29.875 4 22.75 29.825000000000003 22.85 24.575 5 22.25 33.575 22.825 21.349999999999998 6 19.275000000000002 35.85 24.5 20.375 7 14.875 27.0 40.375 17.75 8 17.825 26.224999999999998 29.25 26.700000000000003 9 17.925 25.124999999999996 32.800000000000004 24.15 10-14 20.26 30.354999999999997 26.884999999999998 22.5 15-19 20.294999999999998 28.970000000000002 27.46 23.275000000000002 20-24 20.07 29.275000000000002 26.895000000000003 23.76 25-29 19.7 29.525000000000002 27.235 23.54 30-34 19.97 29.549999999999997 27.3 23.18 35-39 19.865 29.195 27.284999999999997 23.655 40-44 20.315 29.62 26.41 23.655 45-49 20.015 28.939999999999998 27.27 23.775 50-54 19.855 29.57 26.924999999999997 23.65 55-59 20.335 28.744999999999997 27.13 23.79 60-64 19.825 29.18 27.22 23.775 65-69 19.93 28.455000000000002 27.41 24.205 70-74 20.705000000000002 29.145 26.669999999999998 23.48 75-79 20.59 28.384999999999998 27.365000000000002 23.66 80-84 20.43 28.910000000000004 27.474999999999998 23.185 85-89 20.719143828765755 29.020804160832164 26.780356071214246 23.479695939187835 90-94 20.10322192714336 28.716740993135243 27.243573683419353 23.93646339630205 95-99 20.459677824057813 28.644552617052238 26.948361519546342 23.947408039343603 100-104 20.62 28.360000000000003 27.18 23.84 105-109 20.73 28.165000000000003 27.13 23.974999999999998 110-114 20.705000000000002 28.99 27.405 22.900000000000002 115-119 21.085 28.68 26.765 23.47 120-124 20.655 28.465 27.065 23.815 125-129 21.310000000000002 28.095 27.015 23.580000000000002 130-134 20.775 28.884999999999998 26.715 23.625 135-139 21.144515031764293 28.09264168875994 26.727027162223 24.035816117252764 140-144 20.49 28.13 26.705000000000002 24.675 145-149 20.965 28.915000000000003 26.445 23.674999999999997 150-151 20.974999999999998 27.8875 26.9625 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 4.0 26 6.5 27 9.0 28 9.5 29 9.5 30 13.0 31 24.0 32 37.0 33 41.0 34 52.5 35 71.0 36 83.0 37 109.0 38 148.0 39 174.0 40 200.5 41 222.0 42 245.0 43 267.5 44 266.5 45 257.5 46 265.0 47 252.5 48 221.0 49 196.5 50 163.0 51 140.0 52 122.5 53 94.0 54 68.0 55 61.0 56 45.5 57 26.5 58 19.5 59 13.5 60 13.0 61 11.5 62 7.5 63 4.0 64 1.5 65 5.5 66 6.0 67 3.5 68 3.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.215 95-99 0.365 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.045 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.7000000000000002 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.4749999999999996 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.0875 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.7 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAAGC 10 0.006832588 144.9875 3 >>END_MODULE SRR7169983 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169983_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.01875 33.0 33.0 34.0 32.0 34.0 2 32.24075 34.0 33.0 34.0 32.0 34.0 3 32.194 34.0 33.0 34.0 32.0 34.0 4 31.977 34.0 33.0 34.0 32.0 34.0 5 31.92 34.0 33.0 34.0 31.0 34.0 6 36.2325 38.0 38.0 38.0 35.0 38.0 7 36.2575 38.0 38.0 38.0 35.0 38.0 8 36.197 38.0 38.0 38.0 35.0 38.0 9 36.25725 38.0 38.0 38.0 36.0 38.0 10-14 36.18245 38.0 38.0 38.0 36.0 38.0 15-19 36.073899999999995 38.0 38.0 38.0 35.4 38.0 20-24 36.113800000000005 38.0 38.0 38.0 35.2 38.0 25-29 36.182249999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.17515 38.0 38.0 38.0 35.8 38.0 35-39 36.0519 38.0 38.0 38.0 35.6 38.0 40-44 35.9628 38.0 38.0 38.0 35.0 38.0 45-49 35.86555 38.0 38.0 38.0 34.2 38.0 50-54 36.02255 38.0 38.0 38.0 35.0 38.0 55-59 36.025600000000004 38.0 38.0 38.0 35.0 38.0 60-64 35.95899999999999 38.0 38.0 38.0 35.0 38.0 65-69 35.85 38.0 38.0 38.0 33.8 38.0 70-74 35.8531 38.0 38.0 38.0 34.0 38.0 75-79 35.6504 38.0 38.0 38.0 33.6 38.0 80-84 35.655150000000006 38.0 38.0 38.0 33.0 38.0 85-89 35.3249 38.0 38.0 38.0 32.2 38.0 90-94 34.9478 38.0 38.0 38.0 29.0 38.0 95-99 35.197250000000004 38.0 38.0 38.0 29.4 38.0 100-104 35.0673 38.0 37.8 38.0 29.4 38.0 105-109 34.969100000000005 38.0 37.4 38.0 28.4 38.0 110-114 34.7857 38.0 37.0 38.0 27.6 38.0 115-119 34.47985 38.0 36.8 38.0 24.8 38.0 120-124 34.12385 38.0 36.0 38.0 21.4 38.0 125-129 33.685500000000005 38.0 35.8 38.0 16.2 38.0 130-134 32.746849999999995 38.0 34.0 38.0 11.2 38.0 135-139 31.39345 38.0 32.4 38.0 2.0 38.0 140-144 30.4877 38.0 31.0 38.0 2.0 38.0 145-149 29.79175 38.0 29.2 38.0 2.0 38.0 150-151 25.220125000000003 33.0 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 91.0 3 11.0 4 1.0 5 3.0 6 4.0 7 1.0 8 1.0 9 1.0 10 4.0 11 7.0 12 4.0 13 4.0 14 3.0 15 2.0 16 10.0 17 14.0 18 4.0 19 15.0 20 12.0 21 10.0 22 12.0 23 19.0 24 21.0 25 30.0 26 24.0 27 38.0 28 36.0 29 49.0 30 55.0 31 79.0 32 89.0 33 144.0 34 154.0 35 207.0 36 491.0 37 2350.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.39964111766214 24.096385542168676 11.663675980517816 22.84029735965137 2 26.63788725241239 26.180802437785676 29.761300152361603 17.420010157440323 3 19.800969635111 29.344220464404184 32.253125797397296 18.601684103087525 4 24.370826913199796 34.69440164355419 23.52336928608115 17.41140215716487 5 23.71877414370332 36.62116919907288 21.71001802729848 17.950038629925317 6 20.862024993624075 37.36291762305534 23.029839326702373 18.74521805661821 7 21.308553971486763 22.301425661914458 36.787169042769854 19.602851323828922 8 21.246819338422394 23.994910941475826 27.175572519083968 27.582697201017815 9 21.486761710794298 25.789205702647656 28.793279022403258 23.930753564154784 10-14 23.157840984527397 29.1119848848491 26.048102946433133 21.68207118419037 15-19 23.5704037712646 27.75671244107399 27.485140397622466 21.187743390038943 20-24 22.47317322432294 27.96116504854369 27.823198773633113 21.742462953500254 25-29 23.33401367486478 27.84978058985611 27.375242371670577 21.44096336360853 30-34 22.909220872051463 27.698355968548967 28.29572143367712 21.096701725722454 35-39 23.385653663275217 27.404264021678 27.889973925047297 21.32010838999949 40-44 23.313670171838933 27.1967171069505 27.822518594511415 21.667094126699155 45-49 23.044950738916256 27.391215106732346 28.83825944170772 20.725574712643677 50-54 22.695505789930113 27.710044380962096 28.57215732285875 21.022292506249045 55-59 22.974353734545826 27.68468376417697 28.072953918463266 21.268008582813938 60-64 23.611821249616526 27.620411084978013 28.62767154105737 20.14009612434809 65-69 23.66525315485618 27.338680835845295 28.365605681295662 20.63046032800286 70-74 23.42635974740273 27.612548380525563 28.315339172947645 20.64575269912406 75-79 23.58864815379921 26.97080663208219 28.832265283287562 20.608279930831046 80-84 23.377682622215428 27.583218636896568 28.092980578070044 20.946118162817964 85-89 23.70073067819286 27.595965833076054 27.92013996089328 20.78316352783781 90-94 22.80874430169913 27.439908827186077 28.527766266058848 21.223580605055947 95-99 23.732883711424485 27.902105048027792 27.69262211322297 20.67238912732475 100-104 23.755414012738854 27.541401273885352 28.05095541401274 20.652229299363057 105-109 23.883723306426894 27.710227853274755 28.011648104628588 20.394400735669766 110-114 23.79003376649954 27.14621917527883 27.70387803131075 21.35986902691088 115-119 24.019407558733402 27.81409601634321 27.96220633299285 20.20429009193054 120-124 23.623806621978467 28.07231362990047 27.010968921389395 21.292910826731667 125-129 24.235897435897435 27.487179487179485 28.164102564102567 20.112820512820512 130-134 24.442696039863623 27.736690270128506 27.285601888276943 20.53501180173092 135-139 24.496248660235796 27.384780278670956 27.9903536977492 20.128617363344052 140-144 24.93883542652096 27.776871635948456 27.510465938128636 19.773826999401948 145-149 24.918720503408494 28.065023597273203 26.99003670686943 20.02621919244887 150-151 24.772406718810103 27.13168354917297 28.042056673932553 20.05385305808437 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 60.0 1 31.5 2 3.5 3 3.0 4 2.5 5 1.5 6 0.5 7 0.5 8 1.0 9 1.5 10 1.0 11 1.5 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 0.5 20 1.5 21 2.0 22 1.5 23 2.5 24 2.0 25 2.5 26 3.5 27 2.5 28 2.5 29 5.0 30 7.0 31 11.5 32 22.0 33 32.5 34 37.5 35 52.0 36 73.5 37 104.0 38 129.0 39 149.5 40 188.0 41 230.0 42 268.0 43 296.5 44 303.0 45 284.0 46 257.5 47 250.0 48 242.5 49 199.0 50 167.5 51 151.5 52 109.5 53 79.5 54 64.0 55 43.5 56 35.0 57 27.0 58 18.0 59 13.0 60 8.0 61 9.5 62 7.5 63 3.0 64 4.5 65 4.5 66 3.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.475 2 1.55 3 2.025 4 2.65 5 2.9250000000000003 6 1.975 7 1.7999999999999998 8 1.7500000000000002 9 1.7999999999999998 10-14 2.085 15-19 2.42 20-24 2.15 25-29 2.01 30-34 2.07 35-39 2.205 40-44 2.5250000000000004 45-49 2.56 50-54 1.9849999999999999 55-59 2.13 60-64 2.21 65-69 2.1350000000000002 70-74 1.82 75-79 1.69 80-84 1.915 85-89 2.83 90-94 3.4799999999999995 95-99 2.1399999999999997 100-104 1.875 105-109 2.13 110-114 2.27 115-119 2.1 120-124 1.54 125-129 2.5 130-134 4.675 135-139 6.7 140-144 8.035 145-149 4.65 150-151 2.5125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.43791517629023 97.3 2 0.45988758303525806 0.8999999999999999 3 0.0510986203372509 0.15 4 0.02554931016862545 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554931016862545 1.55 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 62 1.55 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.2999999999999998 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.7125000000000004 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.262499999999999 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.737500000000001 0.0 0.0 0.0 0.0 138-139 6.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687621 spots for SRR7169983.sra Written 687621 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra Read 687607 spots for SRR7169983.sra Written 687607 spots for SRR7169983.sra SRR ids: ['SRR7169983.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xxwk7om2 SRR7169983.sra spots: 13752154 blocks: [[1, 687607], [687608, 1375214], [1375215, 2062821], [2062822, 2750428], [2750429, 3438035], [3438036, 4125642], [4125643, 4813249], [4813250, 5500856], [5500857, 6188463], [6188464, 6876070], [6876071, 7563677], [7563678, 8251284], [8251285, 8938891], [8938892, 9626498], [9626499, 10314105], [10314106, 11001712], [11001713, 11689319], [11689320, 12376926], [12376927, 13064533], [13064534, 13752154]] SRR7169983 file size 4638453 SRR7169983 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169983 SRR7169983_1.fastq SRR7169983_2.fastq Input file: SRR7169983_1.fastq Paired file: SRR7169983_2.fastq trimmed: SRR7169983-trimmed-pair1.fastq, SRR7169983-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:00:35 2025 >> started Wed Feb 12 07:00:49 2025 >> done (14.253s) 13752154 read pairs processed; of these: 24887 ( 0.18%) short read pairs filtered out after trimming by size control 36495 ( 0.27%) empty read pairs filtered out after trimming by size control 13690772 (99.55%) read pairs available; of these: 6750169 (49.30%) trimmed read pairs available after processing 6940603 (50.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 6 0.00% 21 4 0.00% 22 13 0.00% 23 7 0.00% 24 12 0.00% 25 11 0.00% 26 17 0.00% 27 9 0.00% 28 9 0.00% 29 14 0.00% 30 13 0.00% 31 16 0.00% 32 18 0.00% 33 14 0.00% 34 14 0.00% 35 17 0.00% 36 16 0.00% 37 22 0.00% 38 21 0.00% 39 27 0.00% 40 45 0.00% 41 30 0.00% 42 27 0.00% 43 45 0.00% 44 28 0.00% 45 52 0.00% 46 47 0.00% 47 58 0.00% 48 74 0.00% 49 63 0.00% 50 80 0.00% 51 104 0.00% 52 93 0.00% 53 104 0.00% 54 128 0.00% 55 138 0.00% 56 141 0.00% 57 184 0.00% 58 194 0.00% 59 216 0.00% 60 244 0.00% 61 305 0.00% 62 366 0.00% 63 381 0.00% 64 379 0.00% 65 441 0.00% 66 474 0.00% 67 528 0.00% 68 627 0.00% 69 733 0.01% 70 950 0.01% 71 1033 0.01% 72 1106 0.01% 73 1207 0.01% 74 1392 0.01% 75 1523 0.01% 76 1620 0.01% 77 1776 0.01% 78 1918 0.01% 79 2102 0.02% 80 2434 0.02% 81 2757 0.02% 82 3169 0.02% 83 3618 0.03% 84 4956 0.04% 85 5806 0.04% 86 5946 0.04% 87 6231 0.05% 88 6612 0.05% 89 6805 0.05% 90 7412 0.05% 91 8154 0.06% 92 8825 0.06% 93 9284 0.07% 94 10121 0.07% 95 10933 0.08% 96 11234 0.08% 97 11347 0.08% 98 12052 0.09% 99 12563 0.09% 100 13277 0.10% 101 14098 0.10% 102 15325 0.11% 103 16408 0.12% 104 17472 0.13% 105 18225 0.13% 106 18690 0.14% 107 19122 0.14% 108 19725 0.14% 109 20184 0.15% 110 21474 0.16% 111 22361 0.16% 112 23587 0.17% 113 25240 0.18% 114 26156 0.19% 115 27102 0.20% 116 28215 0.21% 117 29236 0.21% 118 29514 0.22% 119 29810 0.22% 120 30907 0.23% 121 32351 0.24% 122 33769 0.25% 123 35629 0.26% 124 37612 0.27% 125 39426 0.29% 126 41152 0.30% 127 42474 0.31% 128 43239 0.32% 129 44613 0.33% 130 46016 0.34% 131 48327 0.35% 132 50937 0.37% 133 54017 0.39% 134 57072 0.42% 135 60527 0.44% 136 64458 0.47% 137 68367 0.50% 138 73444 0.54% 139 79670 0.58% 140 85458 0.62% 141 91894 0.67% 142 98595 0.72% 143 108542 0.79% 144 120720 0.88% 145 138780 1.01% 146 168269 1.23% 147 219595 1.60% 148 312939 2.29% 149 603665 4.41% 150 3210978 23.45% 151 6940603 50.70% 13690772 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=108.71 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.5 sequence=AAAAAAAGAGGGATCTAGCAGAGCACTGCCTCTATCCTGGCAATTCATGAGAAAACCATCACAAAAACGGCGACACAAGTACCGGCTAAAGCCACAAATGGGGAAATATTGATCCCTAAGGATGAATCGGGTACGTTGTTGGATGAAGGCTTGTAATTGGTGACGTTACTACCGGCCGGAGAAGTGGTAGTGCCATCAGAAGATGGAGTTCCGGAGGAGGGACTTGTGCTCGATCCTGCTGCTGCAACAGTGACTGCAACCTTCATGCCACTCCCACAGTGGCCAGGAACACCACAAATGAAATAATGAGTTCCGGCAGTCTTGAGGGCTATTGTGGTAGCACCACTGCTATCTGAAGTGATTGCATTGCCTGTAGTGCATGTGCTGTAGTCACTGGCTCTCACTTCATCTACCGTGTGGCCTCCTCCGTAGTTAAACACAAGGCTGTCGCCAACTGAAAAGGTCTTGCCACTAGTCCAGGTGCTATAATCCATACCAATTGCCCAGCCTG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.28 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=3.8 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=189.16 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=22.6 sequence=GAAGAAGAAGAAA SRR7169983 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:01:35 Started mapping on | Feb 12 07:01:35 Finished on | Feb 12 07:02:46 Mapping speed, Million of reads per hour | 694.18 Number of input reads | 13690772 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12938543 Uniquely mapped reads % | 94.51% Average mapped length | 292.60 Number of splices: Total | 11543139 Number of splices: Annotated (sjdb) | 11332210 Number of splices: GT/AG | 11377790 Number of splices: GC/AG | 130270 Number of splices: AT/AC | 9859 Number of splices: Non-canonical | 25220 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214603 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 28790 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 558293 558293 558293 N_multimapping 214603 214603 214603 N_noFeature 314172 12763059 387408 N_ambiguous 155608 600 52949 UnstrandedReadsAssigned:12468763 PositiveStrandReadsAssigned:174884 NegativeStrandReadsAssigned:12498186 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169983 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169983-trimmed-pair1.fastq SRR7169983-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,690,772 reads, 12,440,508 reads pseudoaligned [quant] estimated average fragment length: 237.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7169983.ke.tsv 34699 SRR7169983.se.tsv 87100 total ==> SRR7169983.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.13 234 10.5909 Potri.005G024800.1.v4.1 1035 798.132 17 1.71707 Potri.004G059700.1.v4.1 961 724.236 5 0.55655 Potri.007G009000.2.v4.1 1416 1179.13 0 0 Potri.003G141000.2.v4.1 2943 2706.13 173.028 5.15443 Potri.016G087400.1.v4.1 270 84.5056 1107.54 1056.55 Potri.015G069301.1.v4.1 564 333.183 0 0 Potri.010G195200.1.v4.1 1773 1536.13 15 0.787185 Potri.012G127500.1.v4.1 977 740.196 2743 298.74 ==> SRR7169983.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1001 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169983 completed mapping pipeline successfully