Starting /dee2/code/volunteer_pipeline.sh SRR7169984 current disk space = 3050262343680 free memory = 1484202300 SRR7169984 SRAfilesize 5b15dc627a43a238f3edb829b283e478 SRR7169984.sra SRR7169984.sra file validated SRR7169984 is paired end SRR7169984 is conventional basespace SRR7169984 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169984_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.49225 34.0 34.0 34.0 33.0 34.0 2 33.62275 34.0 34.0 34.0 33.0 34.0 3 33.719 34.0 34.0 34.0 33.0 34.0 4 33.707 34.0 34.0 34.0 33.0 34.0 5 33.70325 34.0 34.0 34.0 33.0 34.0 6 37.348 38.0 38.0 38.0 36.0 38.0 7 37.55625 38.0 38.0 38.0 37.0 38.0 8 37.61475 38.0 38.0 38.0 38.0 38.0 9 37.67775 38.0 38.0 38.0 38.0 38.0 10-14 37.646899999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.6106 38.0 38.0 38.0 38.0 38.0 20-24 37.564499999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.5109 38.0 38.0 38.0 38.0 38.0 30-34 37.46685000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.379149999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.0134 38.0 38.0 38.0 36.2 38.0 45-49 36.944849999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.941199999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.8932 38.0 38.0 38.0 35.4 38.0 60-64 36.7956 38.0 38.0 38.0 35.2 38.0 65-69 36.720349999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.57365 38.0 38.0 38.0 34.4 38.0 75-79 36.2259 38.0 38.0 38.0 34.0 38.0 80-84 36.08045 38.0 38.0 38.0 33.8 38.0 85-89 35.981399999999994 38.0 38.0 38.0 33.6 38.0 90-94 35.71490000000001 38.0 37.2 38.0 32.2 38.0 95-99 35.58255 38.0 37.0 38.0 31.2 38.0 100-104 35.518950000000004 38.0 37.0 38.0 31.2 38.0 105-109 35.274 38.0 36.8 38.0 30.4 38.0 110-114 34.86555 38.0 36.2 38.0 28.4 38.0 115-119 34.60625 38.0 36.0 38.0 27.0 38.0 120-124 34.32765 38.0 35.0 38.0 25.0 38.0 125-129 33.95845 38.0 34.8 38.0 22.6 38.0 130-134 33.5981 38.0 34.6 38.0 19.4 38.0 135-139 32.789199999999994 38.0 33.8 38.0 14.6 38.0 140-144 32.240500000000004 37.8 33.0 38.0 14.0 38.0 145-149 31.445299999999996 37.2 32.2 38.0 9.0 38.0 150-151 26.968874999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 4.0 12 4.0 13 2.0 14 8.0 15 8.0 16 5.0 17 9.0 18 17.0 19 22.0 20 15.0 21 12.0 22 15.0 23 13.0 24 15.0 25 20.0 26 24.0 27 18.0 28 26.0 29 31.0 30 46.0 31 66.0 32 63.0 33 112.0 34 154.0 35 334.0 36 986.0 37 1969.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.916540975364505 14.25339366515837 10.005027652086476 31.825037707390646 2 22.95 15.275 33.0 28.775000000000002 3 18.45 19.825 27.55 34.175 4 22.8 26.224999999999998 24.575 26.400000000000002 5 22.675 31.4 23.9 22.025 6 19.525000000000002 35.25 25.900000000000002 19.325 7 14.325 30.725 38.25 16.7 8 16.35 30.025000000000002 31.275 22.35 9 17.299999999999997 27.55 32.975 22.175 10-14 18.63 32.56 26.584999999999997 22.225 15-19 19.105 30.240000000000002 27.04 23.615 20-24 18.855 31.135 26.815 23.195 25-29 18.93 30.79 26.965 23.315 30-34 19.365 30.395 26.674999999999997 23.565 35-39 19.205 30.3 27.474999999999998 23.02 40-44 18.88 30.270000000000003 26.88 23.97 45-49 19.545 30.095 27.235 23.125 50-54 19.7 29.455 26.840000000000003 24.005000000000003 55-59 19.275000000000002 29.885 27.415 23.425 60-64 19.259999999999998 29.544999999999998 27.605 23.59 65-69 19.425 30.2 26.674999999999997 23.7 70-74 19.72 30.585 26.655 23.04 75-79 19.03 30.490000000000002 26.745 23.735 80-84 19.220000000000002 29.995 26.950000000000003 23.835 85-89 19.465 29.68 26.735 24.12 90-94 19.45542819960959 29.746233545222484 27.2235847640022 23.574753491165723 95-99 19.39648701396187 29.505079317419806 27.208126907871694 23.890306760746636 100-104 20.244999999999997 29.705 26.795 23.255 105-109 20.11 30.709999999999997 26.200000000000003 22.98 110-114 20.055 29.904999999999998 26.505000000000003 23.535 115-119 20.001000050002503 29.776488824441223 26.206310315515775 24.016200810040502 120-124 20.419083816763354 29.690938187637528 26.07021404280856 23.819763952790556 125-129 20.34 29.49 25.82 24.349999999999998 130-134 20.432151252938528 29.220227079477816 26.064122442855 24.283499224728654 135-139 20.89022255563891 29.262315578894725 25.786446611652913 24.06101525381345 140-144 20.031009302790835 29.208762628788637 26.347904371311394 24.412323697109134 145-149 20.414186383872742 28.81796808563854 26.19178630383673 24.576059226651996 150-151 20.665083135391924 29.741217652206526 25.753219152394045 23.8404800600075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 1.5 22 1.5 23 4.0 24 6.0 25 6.5 26 10.5 27 15.5 28 15.5 29 22.0 30 35.5 31 45.5 32 59.0 33 69.5 34 89.0 35 111.0 36 118.5 37 132.0 38 161.0 39 166.5 40 192.0 41 221.5 42 219.0 43 246.0 44 255.5 45 234.0 46 212.5 47 209.0 48 188.5 49 165.5 50 155.5 51 121.5 52 101.5 53 85.5 54 67.5 55 59.0 56 43.0 57 32.0 58 24.0 59 18.5 60 15.5 61 10.0 62 10.0 63 7.5 64 4.0 65 2.5 66 3.5 67 6.0 68 3.5 69 2.5 70 2.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.105 95-99 0.08499999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.02 125-129 0.0 130-134 0.034999999999999996 135-139 0.025 140-144 0.03 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.66769151934409 96.275 2 1.2810658467845248 2.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05124263387138099 1.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATGCTATCTCGTATGC 33 0.8250000000000001 TruSeq Adapter, Index 9 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACGATGCTATCTCGTATGCC 16 0.4 TruSeq Adapter, Index 9 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.425 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.1625 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.675 0.0 0.0 0.0 0.0 104-105 3.1875 0.0 0.0 0.0 0.0 106-107 3.7249999999999996 0.0 0.0 0.0 0.0 108-109 4.075 0.0 0.0 0.0 0.0 110-111 4.3875 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 114-115 5.2875 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.225 0.0 0.0 0.0 0.0 120-121 6.825 0.0 0.0 0.0 0.0 122-123 7.4625 0.0 0.0 0.0 0.0 124-125 8.0375 0.0 0.0 0.0 0.0 126-127 9.05 0.0 0.0 0.0 0.0 128-129 9.8375 0.0 0.0 0.0 0.0 130-131 10.525 0.0 0.0 0.0 0.0 132-133 11.175 0.0 0.0 0.0 0.0 134-135 11.75 0.0 0.0 0.0 0.0 136-137 12.7375 0.0 0.0 0.0 0.0 138-139 13.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTTC 10 0.006832588 144.9875 4 GATTCTA 10 0.006832588 144.9875 7 TTCTACC 10 0.006832588 144.9875 9 ATTCTAC 10 0.006832588 144.9875 8 ATTTTCC 10 0.006832588 144.9875 5 CGCGTCG 10 0.006832588 144.9875 145 >>END_MODULE SRR7169984 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169984_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.113 34.0 33.0 34.0 33.0 34.0 2 33.18475 34.0 33.0 34.0 33.0 34.0 3 33.11825 34.0 33.0 34.0 33.0 34.0 4 32.966 34.0 33.0 34.0 33.0 34.0 5 33.06175 34.0 33.0 34.0 33.0 34.0 6 37.27525 38.0 38.0 38.0 38.0 38.0 7 37.319 38.0 38.0 38.0 38.0 38.0 8 37.31425 38.0 38.0 38.0 38.0 38.0 9 37.30625 38.0 38.0 38.0 38.0 38.0 10-14 37.1294 38.0 38.0 38.0 38.0 38.0 15-19 37.036950000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.072950000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.06445 38.0 38.0 38.0 38.0 38.0 30-34 37.048249999999996 38.0 38.0 38.0 38.0 38.0 35-39 36.9491 38.0 38.0 38.0 38.0 38.0 40-44 36.89075 38.0 38.0 38.0 38.0 38.0 45-49 36.843199999999996 38.0 38.0 38.0 37.6 38.0 50-54 36.97165 38.0 38.0 38.0 37.6 38.0 55-59 36.959500000000006 38.0 38.0 38.0 37.6 38.0 60-64 36.89155 38.0 38.0 38.0 37.2 38.0 65-69 36.78365 38.0 38.0 38.0 37.2 38.0 70-74 36.47005 38.0 38.0 38.0 37.0 38.0 75-79 36.4021 38.0 38.0 38.0 36.6 38.0 80-84 36.32835 38.0 38.0 38.0 36.2 38.0 85-89 36.061150000000005 38.0 38.0 38.0 36.0 38.0 90-94 35.9048 38.0 38.0 38.0 35.0 38.0 95-99 36.06035 38.0 38.0 38.0 35.0 38.0 100-104 36.06355 38.0 38.0 38.0 35.0 38.0 105-109 35.9283 38.0 38.0 38.0 34.2 38.0 110-114 35.791199999999996 38.0 38.0 38.0 34.0 38.0 115-119 35.59445000000001 38.0 38.0 38.0 33.4 38.0 120-124 35.41435 38.0 38.0 38.0 33.0 38.0 125-129 34.94785 38.0 37.6 38.0 30.2 38.0 130-134 34.156000000000006 38.0 36.2 38.0 23.2 38.0 135-139 33.436449999999994 38.0 35.6 38.0 14.6 38.0 140-144 32.619299999999996 38.0 33.8 38.0 13.0 38.0 145-149 32.18495 38.0 33.0 38.0 4.2 38.0 150-151 28.068375000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 15.0 4 6.0 5 0.0 6 0.0 7 0.0 8 4.0 9 1.0 10 2.0 11 0.0 12 1.0 13 4.0 14 5.0 15 9.0 16 19.0 17 24.0 18 12.0 19 5.0 20 2.0 21 5.0 22 8.0 23 8.0 24 10.0 25 11.0 26 17.0 27 17.0 28 28.0 29 24.0 30 33.0 31 51.0 32 76.0 33 97.0 34 86.0 35 156.0 36 425.0 37 2813.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.115124153498876 22.37271131176323 13.569099573614245 20.943064961123653 2 28.876066231811336 27.92272955343703 27.596588058203714 15.604616156547918 3 20.33257747543462 30.284706475182666 30.032753842277653 19.349962207105065 4 25.0063211125158 32.33881163084703 24.020227560050568 18.6346396965866 5 25.409216821959202 36.53991437924956 20.926718710652228 17.124150088139007 6 21.180904522613066 37.08542713567839 24.597989949748744 17.1356783919598 7 22.29763700351936 22.27249874308698 35.822021116138764 19.607843137254903 8 24.371859296482413 26.180904522613062 26.70854271356784 22.738693467336685 9 22.130118060788746 27.0032655111781 29.891986937955288 20.97462949007787 10-14 24.90916431166734 28.97658457811869 25.973960436011307 20.140290674202667 15-19 24.670071294938563 27.789856904485006 27.911209991404156 19.62886180917227 20-24 24.94955609362389 28.848870056497177 26.472962066182404 19.72861178369653 25-29 24.772819063004846 28.841882067851373 26.549878836833603 19.83542003231018 30-34 23.85922452478193 28.114758231230773 27.802147935259413 20.223869308727878 35-39 24.115088996763753 28.398058252427184 27.14401294498382 20.342839805825243 40-44 24.850481500253423 27.156614292954888 27.263051191079573 20.729853015712113 45-49 24.57348250898598 27.504682832987392 26.93768035235154 20.984154305675087 50-54 24.036521388216304 28.435230024213077 27.592816787732044 19.93543179983858 55-59 24.437493693875492 28.120270406618907 28.130360205831906 19.3118756936737 60-64 24.026072457177506 28.214845131625488 27.84599060178869 19.913091809408318 65-69 23.96027625144931 28.734183596309926 27.443665876896706 19.861874275344054 70-74 24.25155716294957 28.124372111713885 27.838055053244926 19.786015672091622 75-79 23.881797165544274 28.173685797567593 28.143532013267663 19.800985023620466 80-84 23.888804802986733 28.5051208314414 28.010695726754452 19.595378638817415 85-89 24.378463572118562 27.347602826783262 27.754334231531853 20.519599369566322 90-94 24.430547081553794 27.806589383770593 28.65059995932479 19.112263575350823 95-99 24.188671638782502 27.459181616609555 28.426728482160858 19.925418262447085 100-104 24.676501686722723 28.019737173354812 27.803232465636174 19.50052867428629 105-109 24.595778975469702 27.889991437062413 28.020954011988113 19.493275575479778 110-114 24.189312051722396 28.058389736337002 28.760480856652187 18.99181735528841 115-119 24.856683093633713 27.84370914211003 28.04988434074223 19.24972342351403 120-124 24.981169972382627 27.602309816721064 27.948782324880746 19.467737886015566 125-129 25.546261089987325 28.05069708491762 27.53358681875792 18.869455006337134 130-134 25.153940886699505 28.427750410509034 27.832512315270936 18.585796387520524 135-139 25.877716123009904 27.983197635222734 27.614997666338226 18.524088575429136 140-144 25.71712210669314 28.48633679920581 27.091279586185273 18.705261507915775 145-149 26.08695652173913 28.774331987942574 27.083226894190975 18.055484596127318 150-151 25.51601874129416 29.049005951627198 26.80764847410409 18.627326832974546 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 3.5 2 3.0 3 3.5 4 3.5 5 3.0 6 2.5 7 1.5 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 1.5 16 2.0 17 2.5 18 3.0 19 2.0 20 2.0 21 2.0 22 2.0 23 2.0 24 2.0 25 2.0 26 3.5 27 5.5 28 5.0 29 6.0 30 12.5 31 19.0 32 22.5 33 33.5 34 50.5 35 58.0 36 72.0 37 105.0 38 134.5 39 151.5 40 185.5 41 233.5 42 255.0 43 276.5 44 300.5 45 290.5 46 271.5 47 245.5 48 213.0 49 191.5 50 171.5 51 134.5 52 107.0 53 95.0 54 72.0 55 56.0 56 45.0 57 34.0 58 27.5 59 18.0 60 9.5 61 9.0 62 8.5 63 6.5 64 5.0 65 4.5 66 2.5 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.35000000000000003 3 0.775 4 1.125 5 0.7250000000000001 6 0.5 7 0.5499999999999999 8 0.5 9 0.475 10-14 0.9199999999999999 15-19 1.115 20-24 0.88 25-29 0.96 30-34 0.835 35-39 1.1199999999999999 40-44 1.35 45-49 1.2349999999999999 50-54 0.88 55-59 0.89 60-64 1.045 65-69 0.815 70-74 0.45999999999999996 75-79 0.51 80-84 0.895 85-89 1.6549999999999998 90-94 1.66 95-99 0.7799999999999999 100-104 0.695 105-109 0.735 110-114 1.01 115-119 0.5700000000000001 120-124 0.42500000000000004 125-129 1.375 130-134 2.56 135-139 3.585 140-144 4.305 145-149 2.1350000000000002 150-151 1.2874999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61396303901438 96.05 2 1.257700205338809 2.45 3 0.07700205338809035 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051334702258726904 1.275 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 33 0.8250000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 18 0.44999999999999996 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.825 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.7 0.0 0.0 0.0 0.0 104-105 3.2625 0.0 0.0 0.0 0.0 106-107 3.8125 0.0 0.0 0.0 0.0 108-109 4.1625 0.0 0.0 0.0 0.0 110-111 4.4375 0.0 0.0 0.0 0.0 112-113 4.762499999999999 0.0 0.0 0.0 0.0 114-115 5.375 0.0 0.0 0.0 0.0 116-117 5.85 0.0 0.0 0.0 0.0 118-119 6.375 0.0 0.0 0.0 0.0 120-121 6.95 0.0 0.0 0.0 0.0 122-123 7.55 0.0 0.0 0.0 0.0 124-125 8.1375 0.0 0.0 0.0 0.0 126-127 9.037500000000001 0.0 0.0 0.0 0.0 128-129 9.7875 0.0 0.0 0.0 0.0 130-131 10.4375 0.0 0.0 0.0 0.0 132-133 11.1375 0.0 0.0 0.0 0.0 134-135 11.8 0.0 0.0 0.0 0.0 136-137 12.8 0.0 0.0 0.0 0.0 138-139 13.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAACTA 10 0.0068400395 144.91139 2 GAATTAG 10 0.0068400395 144.91139 2 AGCAACT 15 1.1428103E-4 144.91139 1 AGATGGG 20 0.005951074 28.982279 100-104 >>END_MODULE Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481924 spots for SRR7169984.sra Written 481924 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra Read 481915 spots for SRR7169984.sra Written 481915 spots for SRR7169984.sra SRR ids: ['SRR7169984.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mfiap7kg SRR7169984.sra spots: 9638309 blocks: [[1, 481915], [481916, 963830], [963831, 1445745], [1445746, 1927660], [1927661, 2409575], [2409576, 2891490], [2891491, 3373405], [3373406, 3855320], [3855321, 4337235], [4337236, 4819150], [4819151, 5301065], [5301066, 5782980], [5782981, 6264895], [6264896, 6746810], [6746811, 7228725], [7228726, 7710640], [7710641, 8192555], [8192556, 8674470], [8674471, 9156385], [9156386, 9638309]] SRR7169984 file size 3245112 SRR7169984 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169984 SRR7169984_1.fastq SRR7169984_2.fastq Input file: SRR7169984_1.fastq Paired file: SRR7169984_2.fastq trimmed: SRR7169984-trimmed-pair1.fastq, SRR7169984-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:49:34 2025 >> started Wed Feb 12 06:49:45 2025 >> done (10.444s) 9638309 read pairs processed; of these: 20970 ( 0.22%) short read pairs filtered out after trimming by size control 84839 ( 0.88%) empty read pairs filtered out after trimming by size control 9532500 (98.90%) read pairs available; of these: 5749438 (60.31%) trimmed read pairs available after processing 3783062 (39.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 13 0.00% 21 14 0.00% 22 20 0.00% 23 16 0.00% 24 19 0.00% 25 29 0.00% 26 29 0.00% 27 20 0.00% 28 24 0.00% 29 29 0.00% 30 33 0.00% 31 33 0.00% 32 38 0.00% 33 39 0.00% 34 33 0.00% 35 44 0.00% 36 41 0.00% 37 44 0.00% 38 52 0.00% 39 70 0.00% 40 64 0.00% 41 58 0.00% 42 83 0.00% 43 84 0.00% 44 88 0.00% 45 119 0.00% 46 140 0.00% 47 148 0.00% 48 168 0.00% 49 160 0.00% 50 201 0.00% 51 236 0.00% 52 235 0.00% 53 257 0.00% 54 246 0.00% 55 274 0.00% 56 328 0.00% 57 346 0.00% 58 387 0.00% 59 384 0.00% 60 461 0.00% 61 531 0.01% 62 653 0.01% 63 744 0.01% 64 798 0.01% 65 986 0.01% 66 1258 0.01% 67 1734 0.02% 68 2273 0.02% 69 4853 0.05% 70 8006 0.08% 71 4981 0.05% 72 3514 0.04% 73 2989 0.03% 74 2768 0.03% 75 3035 0.03% 76 2937 0.03% 77 3189 0.03% 78 3398 0.04% 79 3744 0.04% 80 4150 0.04% 81 4804 0.05% 82 5570 0.06% 83 6186 0.06% 84 7564 0.08% 85 8297 0.09% 86 8921 0.09% 87 9366 0.10% 88 10009 0.10% 89 10718 0.11% 90 11263 0.12% 91 12077 0.13% 92 13316 0.14% 93 14511 0.15% 94 15492 0.16% 95 16634 0.17% 96 17339 0.18% 97 17991 0.19% 98 18312 0.19% 99 18811 0.20% 100 19957 0.21% 101 20686 0.22% 102 22327 0.23% 103 23692 0.25% 104 24909 0.26% 105 26804 0.28% 106 27183 0.29% 107 27889 0.29% 108 28771 0.30% 109 29006 0.30% 110 29978 0.31% 111 30135 0.32% 112 32001 0.34% 113 34353 0.36% 114 35075 0.37% 115 36700 0.38% 116 36913 0.39% 117 38096 0.40% 118 38250 0.40% 119 39165 0.41% 120 38889 0.41% 121 40268 0.42% 122 41886 0.44% 123 43991 0.46% 124 46237 0.49% 125 46791 0.49% 126 48480 0.51% 127 49690 0.52% 128 50493 0.53% 129 51155 0.54% 130 51966 0.55% 131 52790 0.55% 132 54837 0.58% 133 57222 0.60% 134 60237 0.63% 135 63304 0.66% 136 65115 0.68% 137 67564 0.71% 138 71650 0.75% 139 74081 0.78% 140 76116 0.80% 141 81253 0.85% 142 85777 0.90% 143 94120 0.99% 144 104449 1.10% 145 118706 1.25% 146 141994 1.49% 147 186028 1.95% 148 266590 2.80% 149 493329 5.18% 150 2133698 22.38% 151 3783062 39.69% 9532500 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=44 prefix-density=0.14 prefix-fanout=1.9 sequence=TCTGACCTGGGCTGGCAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=319.63 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=25.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=8.46 fanout-score-rank=19 prefix-density=0.24 prefix-fanout=4.7 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=293.81 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=26.7 sequence=AAGAAGAAGAAG SRR7169984 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:50:30 Started mapping on | Feb 12 06:50:30 Finished on | Feb 12 06:51:28 Mapping speed, Million of reads per hour | 591.67 Number of input reads | 9532500 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 8881298 Uniquely mapped reads % | 93.17% Average mapped length | 286.67 Number of splices: Total | 6885049 Number of splices: Annotated (sjdb) | 6740593 Number of splices: GT/AG | 6767535 Number of splices: GC/AG | 89739 Number of splices: AT/AC | 5840 Number of splices: Non-canonical | 21935 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 179560 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 77588 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485186 485186 485186 N_multimapping 179560 179560 179560 N_noFeature 226711 8754078 291738 N_ambiguous 98563 738 35918 UnstrandedReadsAssigned:8556024 PositiveStrandReadsAssigned:126482 NegativeStrandReadsAssigned:8553642 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=139 echo kmer=135 SRR7169984 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169984-trimmed-pair1.fastq SRR7169984-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,532,500 reads, 8,601,015 reads pseudoaligned [quant] estimated average fragment length: 199.976 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7169984.ke.tsv 34699 SRR7169984.se.tsv 87100 total ==> SRR7169984.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1819.02 157 8.73217 Potri.005G024800.1.v4.1 1035 836.024 64 7.74502 Potri.004G059700.1.v4.1 961 762.034 1 0.132766 Potri.007G009000.2.v4.1 1416 1217.02 0 0 Potri.003G141000.2.v4.1 2943 2744.02 147 5.41989 Potri.016G087400.1.v4.1 270 96.4282 1099 1153.07 Potri.015G069301.1.v4.1 564 366.219 0 0 Potri.010G195200.1.v4.1 1773 1574.02 59 3.79229 Potri.012G127500.1.v4.1 977 778.029 6620 860.842 ==> SRR7169984.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 537 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169984 completed mapping pipeline successfully