Starting /dee2/code/volunteer_pipeline.sh SRR7169985 current disk space = 3050312056832 free memory = 1579355320 SRR7169985 SRAfilesize 1e468610bf903ad4ba7dd15b6d36dd79 SRR7169985.sra SRR7169985.sra file validated SRR7169985 is paired end SRR7169985 is conventional basespace SRR7169985 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169985_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.44375 34.0 34.0 34.0 33.0 34.0 2 33.60275 34.0 34.0 34.0 33.0 34.0 3 33.6925 34.0 34.0 34.0 33.0 34.0 4 33.66775 34.0 34.0 34.0 33.0 34.0 5 33.68975 34.0 34.0 34.0 33.0 34.0 6 37.31175 38.0 38.0 38.0 36.0 38.0 7 37.6 38.0 38.0 38.0 38.0 38.0 8 37.73525 38.0 38.0 38.0 38.0 38.0 9 37.71275 38.0 38.0 38.0 38.0 38.0 10-14 37.68835 38.0 38.0 38.0 38.0 38.0 15-19 37.68965000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.638349999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.601350000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.504650000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.4196 38.0 38.0 38.0 38.0 38.0 40-44 36.90015 38.0 38.0 38.0 36.0 38.0 45-49 37.1075 38.0 38.0 38.0 36.4 38.0 50-54 37.11215 38.0 38.0 38.0 36.2 38.0 55-59 37.03195 38.0 38.0 38.0 36.0 38.0 60-64 36.96325 38.0 38.0 38.0 36.0 38.0 65-69 36.89659999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.66115 38.0 38.0 38.0 35.2 38.0 75-79 35.10485 38.0 38.0 38.0 30.8 38.0 80-84 34.92115 38.0 38.0 38.0 29.2 38.0 85-89 34.75495000000001 38.0 37.8 38.0 28.6 38.0 90-94 34.5421 38.0 37.2 38.0 27.2 38.0 95-99 34.393800000000006 38.0 37.0 38.0 25.2 38.0 100-104 34.37275 38.0 37.0 38.0 24.8 38.0 105-109 34.271249999999995 38.0 36.8 38.0 25.2 38.0 110-114 34.001850000000005 38.0 36.0 38.0 22.2 38.0 115-119 33.7164 38.0 35.8 38.0 15.0 38.0 120-124 33.53445 38.0 35.4 38.0 15.0 38.0 125-129 33.1462 38.0 35.0 38.0 14.8 38.0 130-134 32.82555 38.0 35.0 38.0 14.0 38.0 135-139 32.2178 38.0 34.0 38.0 13.2 38.0 140-144 31.707849999999997 38.0 33.0 38.0 6.4 38.0 145-149 31.103 38.0 32.2 38.0 2.0 38.0 150-151 27.287750000000003 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 3.0 11 2.0 12 3.0 13 5.0 14 8.0 15 6.0 16 19.0 17 17.0 18 46.0 19 130.0 20 9.0 21 9.0 22 13.0 23 11.0 24 22.0 25 21.0 26 12.0 27 14.0 28 25.0 29 35.0 30 33.0 31 36.0 32 64.0 33 83.0 34 111.0 35 225.0 36 661.0 37 2375.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.43605236656596 15.15609264853978 9.415911379657603 30.991943605236656 2 23.575 17.875 28.7 29.849999999999998 3 20.549999999999997 17.775 28.1 33.575 4 21.775 24.6 21.625 32.0 5 26.25 27.800000000000004 25.05 20.9 6 24.075 31.574999999999996 24.349999999999998 20.0 7 14.299999999999999 33.975 36.449999999999996 15.275 8 15.024999999999999 34.475 29.849999999999998 20.65 9 20.075000000000003 28.325 31.324999999999996 20.275000000000002 10-14 17.740000000000002 32.885 26.840000000000003 22.535 15-19 19.015 31.435000000000002 26.51 23.04 20-24 18.485 32.055 26.619999999999997 22.84 25-29 18.425 31.225 26.845000000000002 23.505000000000003 30-34 17.765 31.05 27.639999999999997 23.544999999999998 35-39 19.78 31.97 27.205000000000002 21.044999999999998 40-44 18.16 30.595 27.839999999999996 23.405 45-49 20.275000000000002 30.695 27.99 21.04 50-54 18.89 29.825000000000003 26.88 24.404999999999998 55-59 18.73 29.375 28.77 23.125 60-64 18.565 30.740000000000002 28.139999999999997 22.555 65-69 17.94 34.095 25.785000000000004 22.18 70-74 18.21 34.475 25.495 21.82 75-79 18.67 32.975 25.509999999999998 22.845 80-84 19.605 31.185000000000002 26.66 22.55 85-89 20.03 30.520000000000003 25.919999999999998 23.53 90-94 19.081484449341414 30.259928882656382 26.809235238142936 23.84935142985927 95-99 18.571929297481347 31.39552350908818 26.503429973461518 23.529117219968956 100-104 18.5 32.735 26.32 22.445 105-109 18.745 33.17 25.305 22.78 110-114 19.189999999999998 33.11 24.965 22.735 115-119 18.91 32.51 25.0 23.580000000000002 120-124 19.2 32.17 25.014999999999997 23.615 125-129 19.439999999999998 31.94 25.264999999999997 23.355 130-134 19.35967983991996 32.66133066533266 24.63231615807904 23.34667333666833 135-139 19.51878345255365 31.994397478865487 25.026261817818018 23.460557250762843 140-144 20.110055027513756 31.970985492746372 24.67233616808404 23.246623311655828 145-149 20.321176647155937 31.20216118865376 24.438441142628445 24.03822102156186 150-151 19.114889361170146 32.36654581822728 25.065633204150515 23.452931616452055 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 2.0 5 1.5 6 0.5 7 1.0 8 1.5 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 2.0 18 2.5 19 3.5 20 2.5 21 0.5 22 4.0 23 5.0 24 5.0 25 6.0 26 8.5 27 18.0 28 21.5 29 27.0 30 43.0 31 65.5 32 78.5 33 86.5 34 108.5 35 128.0 36 156.0 37 189.5 38 188.0 39 203.0 40 235.0 41 231.5 42 207.0 43 207.0 44 219.0 45 200.5 46 174.0 47 154.5 48 133.0 49 122.5 50 114.0 51 99.0 52 102.0 53 90.5 54 72.5 55 63.5 56 52.0 57 41.0 58 31.0 59 25.0 60 17.5 61 9.5 62 9.5 63 7.5 64 2.5 65 2.5 66 2.5 67 2.0 68 1.5 69 2.5 70 2.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.165 95-99 0.145 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.05 135-139 0.045 140-144 0.05 145-149 0.055 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.43835616438356 88.0 2 2.958904109589041 5.4 3 0.3013698630136986 0.8250000000000001 4 0.136986301369863 0.5 5 0.08219178082191782 0.375 6 0.0273972602739726 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0273972602739726 0.325 >50 0.0 0.0 >100 0.0273972602739726 4.425 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGAATGATCTCGTATGC 177 4.425 TruSeq Adapter, Index 2 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGAATGATCTCGTATGCC 13 0.325 TruSeq Adapter, Index 2 (97% over 35bp) GGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGG 6 0.15 No Hit GGCAGCATGATGAAAAGAAAAGGAAAGACAAAAAAGATACACACAGAAAG 5 0.125 No Hit GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 5 0.125 No Hit GGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2125 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.825 0.0 0.0 0.0 0.0 96-97 2.3625 0.0 0.0 0.0 0.0 98-99 2.75 0.0 0.0 0.0 0.0 100-101 3.075 0.0 0.0 0.0 0.0 102-103 3.5 0.0 0.0 0.0 0.0 104-105 3.975 0.0 0.0 0.0 0.0 106-107 4.4375 0.0 0.0 0.0 0.0 108-109 4.975 0.0 0.0 0.0 0.0 110-111 5.3375 0.0 0.0 0.0 0.0 112-113 5.875 0.0 0.0 0.0 0.0 114-115 6.574999999999999 0.0 0.0 0.0 0.0 116-117 7.375 0.0 0.0 0.0 0.0 118-119 8.0125 0.0 0.0 0.0 0.0 120-121 8.8 0.0 0.0 0.0 0.0 122-123 9.6 0.0 0.0 0.0 0.0 124-125 10.4875 0.0 0.0 0.0 0.0 126-127 11.5625 0.0 0.0 0.0 0.0 128-129 12.3375 0.0 0.0 0.0 0.0 130-131 13.2375 0.0 0.0 0.0 0.0 132-133 14.2 0.0 0.0 0.0 0.0 134-135 15.125 0.0 0.0 0.0 0.0 136-137 15.9625 0.0 0.0 0.0 0.0 138-139 16.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGATA 10 0.006830828 145.0 1 GATCATG 10 0.006830828 145.0 9 GATCGGA 100 2.1114429E-6 43.5 1 GAAGAGC 105 2.9547027E-6 41.42857 6 GGAAGAG 105 2.9547027E-6 41.42857 5 AAGAGCA 110 4.0695504E-6 39.545456 7 GAGCACA 110 4.0695504E-6 39.545456 9 AGAGCAC 110 4.0695504E-6 39.545456 8 TCGGAAG 115 5.5244836E-6 37.826088 3 CGGAAGA 115 5.5244836E-6 37.826088 4 ATCGGAA 115 5.5244836E-6 37.826088 2 TCTGCTT 45 8.383813E-7 25.777777 55-59 TGCTTGA 45 8.383813E-7 25.777777 55-59 CTGCTTG 45 8.383813E-7 25.777777 55-59 GTCTTCT 40 9.990927E-6 25.375 50-54 TGCCGTC 50 2.0994885E-6 23.199999 45-49 ATGCCGT 50 2.0994885E-6 23.199999 45-49 GCTTGAA 50 2.0994885E-6 23.199999 55-59 GCCGTCT 45 2.4877938E-5 22.555553 45-49 CGTCTTC 45 2.4877938E-5 22.555553 50-54 >>END_MODULE SRR7169985 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169985_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09175 34.0 33.0 34.0 33.0 34.0 2 33.11625 34.0 33.0 34.0 33.0 34.0 3 32.9855 34.0 33.0 34.0 33.0 34.0 4 32.84225 34.0 33.0 34.0 33.0 34.0 5 32.96 34.0 33.0 34.0 33.0 34.0 6 37.065 38.0 38.0 38.0 38.0 38.0 7 37.116 38.0 38.0 38.0 38.0 38.0 8 37.13675 38.0 38.0 38.0 38.0 38.0 9 37.116 38.0 38.0 38.0 38.0 38.0 10-14 36.91615 38.0 38.0 38.0 38.0 38.0 15-19 36.818949999999994 38.0 38.0 38.0 37.6 38.0 20-24 36.89185 38.0 38.0 38.0 38.0 38.0 25-29 36.89525 38.0 38.0 38.0 38.0 38.0 30-34 36.9413 38.0 38.0 38.0 38.0 38.0 35-39 36.80475 38.0 38.0 38.0 37.8 38.0 40-44 36.68765 38.0 38.0 38.0 37.4 38.0 45-49 36.61725 38.0 38.0 38.0 37.0 38.0 50-54 36.791700000000006 38.0 38.0 38.0 37.2 38.0 55-59 36.86035 38.0 38.0 38.0 37.4 38.0 60-64 36.7817 38.0 38.0 38.0 37.2 38.0 65-69 36.35615 38.0 38.0 38.0 36.0 38.0 70-74 35.248900000000006 38.0 38.0 38.0 33.8 38.0 75-79 35.15445 38.0 38.0 38.0 33.6 38.0 80-84 34.99055 38.0 38.0 38.0 32.6 38.0 85-89 34.6061 38.0 38.0 38.0 28.6 38.0 90-94 34.4781 38.0 38.0 38.0 26.8 38.0 95-99 34.73735 38.0 38.0 38.0 28.6 38.0 100-104 34.792550000000006 38.0 38.0 38.0 31.0 38.0 105-109 34.672200000000004 38.0 38.0 38.0 29.6 38.0 110-114 34.546949999999995 38.0 38.0 38.0 27.6 38.0 115-119 34.37835 38.0 38.0 38.0 25.6 38.0 120-124 34.162 38.0 37.0 38.0 23.0 38.0 125-129 33.67355 38.0 36.4 38.0 14.8 38.0 130-134 33.0006 38.0 35.8 38.0 11.0 38.0 135-139 32.198299999999996 38.0 34.8 38.0 2.0 38.0 140-144 31.428800000000003 38.0 33.4 38.0 2.0 38.0 145-149 30.99155 38.0 32.6 38.0 2.0 38.0 150-151 27.001625 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 13.0 4 2.0 5 1.0 6 0.0 7 4.0 8 1.0 9 4.0 10 0.0 11 0.0 12 2.0 13 4.0 14 8.0 15 11.0 16 23.0 17 97.0 18 44.0 19 24.0 20 10.0 21 2.0 22 5.0 23 8.0 24 17.0 25 18.0 26 9.0 27 27.0 28 30.0 29 27.0 30 41.0 31 43.0 32 58.0 33 92.0 34 90.0 35 152.0 36 407.0 37 2690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.27748559979965 21.98847983971951 12.59704482844979 21.136989732031054 2 28.35671342685371 29.884769539078153 26.20240480961924 15.556112224448897 3 21.42677085959163 26.695235694479457 33.17368288379128 18.704310562137636 4 23.987854251012145 31.857287449392715 21.837044534412957 22.317813765182187 5 30.007558578987148 33.005794910556816 21.038044847568656 15.948601662887377 6 27.171996978091162 34.47494333920927 22.059934525308485 16.293125157391085 7 21.08706592853548 27.856064418721694 34.37342727730247 16.683442375440364 8 24.358974358974358 29.788838612368025 23.906485671191554 21.945701357466064 9 26.48539778449144 25.654582074521652 26.812688821752268 21.04733131923464 10-14 25.49019607843137 28.385890438649685 25.540731756620172 20.583181726298765 15-19 26.119100668422117 26.43812031598137 27.374924042941057 20.067854972655457 20-24 26.801312799798033 28.336278717495585 25.321888412017167 19.540520070689222 25-29 25.799444304117202 29.022480424349585 26.08234402626926 19.095731245263956 30-34 25.705202603825 27.506686178533585 27.86496442448403 18.92314679315739 35-39 23.937031787811296 27.530876695687382 27.530876695687382 21.001214820813928 40-44 27.50330385280065 26.598556470468637 27.01026735793433 18.88787231879638 45-49 23.784140521880396 26.87074829931973 27.368260737130672 21.976850441669203 50-54 24.84095728567101 26.279915177219028 29.0417045339796 19.837423003130365 55-59 23.21401524713485 28.919069016004446 29.181602463775434 18.68531327308527 60-64 22.360499822937218 30.94045631608236 27.186725350331358 19.512318510649063 65-69 22.85685453352843 30.97028104344316 27.569504011302286 18.603360411726122 70-74 23.39421918908069 30.815937374548376 27.358490566037734 18.4313528703332 75-79 22.916248242619 30.6336613777867 27.2896163888331 19.160473990761197 80-84 23.848949919224555 30.139337641357027 27.509087237479807 18.50262520193861 85-89 23.60153256704981 29.650063856960408 27.816091954022987 18.932311621966793 90-94 23.371314700321904 29.0736293495478 28.802820499718973 18.752235450411323 95-99 23.37884818864312 29.737491812364592 28.210812717287247 18.672847281705042 100-104 23.161764705882355 29.547743755036258 28.278605962933117 19.01188557614827 105-109 23.374987403003125 30.409150458530686 27.491685982061874 18.72417615640431 110-114 23.82131487189853 29.774116933650006 27.924604578301075 18.479963616150386 115-119 23.67732850533092 30.06940253470127 27.83645141822571 18.416817541742102 120-124 23.743353065114878 30.455503160429416 27.65124912210294 18.149894652352764 125-129 24.280484084206243 30.290857317197194 27.306010373232994 18.122648225363573 130-134 24.50283359093251 30.247295208655334 26.908809891808342 18.341061308603813 135-139 25.352846205926777 29.19118795896047 27.331909796364773 18.12405603874798 140-144 25.918538736090703 29.419483518790678 27.183497795507034 17.47847994961159 145-149 25.780649130902937 29.564682356560528 27.324001435676564 17.33066707685997 150-151 24.77180527383367 31.83316430020284 26.191683569979716 17.203346855983774 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 3.5 2 3.0 3 2.5 4 4.0 5 3.5 6 3.0 7 4.0 8 2.0 9 1.0 10 1.5 11 0.5 12 1.0 13 1.5 14 0.5 15 2.0 16 3.0 17 2.0 18 2.0 19 1.5 20 2.5 21 2.5 22 1.5 23 1.0 24 2.5 25 2.5 26 2.5 27 5.0 28 8.0 29 13.5 30 16.0 31 26.0 32 49.0 33 56.5 34 57.0 35 80.0 36 106.0 37 126.0 38 151.5 39 171.5 40 211.5 41 227.5 42 237.0 43 258.0 44 244.0 45 244.0 46 235.0 47 215.0 48 199.5 49 171.0 50 134.5 51 107.5 52 96.5 53 99.0 54 100.0 55 84.0 56 63.5 57 43.0 58 27.5 59 22.0 60 17.0 61 11.5 62 9.0 63 6.0 64 4.0 65 2.5 66 0.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.8250000000000001 4 1.2 5 0.775 6 0.7250000000000001 7 0.65 8 0.5499999999999999 9 0.7000000000000001 10-14 1.06 15-19 1.26 20-24 0.975 25-29 1.0250000000000001 30-34 0.915 35-39 1.22 40-44 1.63 45-49 1.51 50-54 0.97 55-59 0.9650000000000001 60-64 1.165 65-69 0.905 70-74 0.36 75-79 0.42 80-84 0.96 85-89 2.125 90-94 2.145 95-99 0.765 100-104 0.72 105-109 0.77 110-114 1.055 115-119 0.58 120-124 0.33 125-129 1.67 130-134 2.9499999999999997 135-139 3.995 140-144 4.74 145-149 2.485 150-151 1.4000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 96.76535087719299 88.25 2 2.6589912280701755 4.8500000000000005 3 0.24671052631578946 0.675 4 0.10964912280701754 0.4 5 0.05482456140350877 0.25 6 0.08223684210526315 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05482456140350877 0.8250000000000001 >50 0.0 0.0 >100 0.027412280701754384 4.3 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 172 4.3 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 21 0.525 Illumina Single End PCR Primer 1 (100% over 50bp) CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 12 0.3 No Hit GGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCC 6 0.15 No Hit GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 6 0.15 No Hit GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 6 0.15 No Hit AATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGA 5 0.125 No Hit ATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 1.0375 0.0 0.0 0.0 0.0 92-93 1.4375 0.0 0.0 0.0 0.0 94-95 1.725 0.0 0.0 0.0 0.0 96-97 2.2375 0.0 0.0 0.0 0.0 98-99 2.5999999999999996 0.0 0.0 0.0 0.0 100-101 2.925 0.0 0.0 0.0 0.0 102-103 3.35 0.0 0.0 0.0 0.0 104-105 3.85 0.0 0.0 0.0 0.0 106-107 4.3375 0.0 0.0 0.0 0.0 108-109 4.9 0.0 0.0 0.0 0.0 110-111 5.2125 0.0 0.0 0.0 0.0 112-113 5.725 0.0 0.0 0.0 0.0 114-115 6.375 0.0 0.0 0.0 0.0 116-117 7.1375 0.0 0.0 0.0 0.0 118-119 7.75 0.0 0.0 0.0 0.0 120-121 8.45 0.0 0.0 0.0 0.0 122-123 9.2 0.0 0.0 0.0 0.0 124-125 10.024999999999999 0.0 0.0 0.0 0.0 126-127 10.95 0.0 0.0 0.0 0.0 128-129 11.6625 0.0 0.0 0.0 0.0 130-131 12.5625 0.0 0.0 0.0 0.0 132-133 13.375 0.0 0.0 0.0 0.0 134-135 14.25 0.0 0.0 0.0 0.0 136-137 15.175 0.0 0.0 0.0 0.0 138-139 16.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGGT 10 0.006703373 145.84416 8 AAGAGCG 105 2.809562E-6 41.66976 7 AGAGCGT 105 2.809562E-6 41.66976 8 GATCGGA 105 3.0815208E-6 41.135532 1 GAGCGTC 110 3.869849E-6 39.77568 9 TCGGAAG 110 4.2441097E-6 39.265736 3 CGGAAGA 110 4.2441097E-6 39.265736 4 ATCGGAA 110 4.2441097E-6 39.265736 2 GAAGAGC 115 5.2536598E-6 38.046303 6 GGAAGAG 130 1.4636917E-5 32.804283 5 CATTAAA 45 8.900133E-7 25.595442 50-54 TCATTAA 45 8.900133E-7 25.595442 50-54 CCGTATC 40 9.920646E-6 25.390827 45-49 CGTATCA 40 9.920646E-6 25.390827 45-49 TATCATT 40 1.0538803E-5 25.195515 50-54 GTCGCCG 50 1.9895524E-6 23.335066 40-44 GGTCGCC 50 1.9895524E-6 23.335066 40-44 TTAAAAA 50 2.03542E-6 23.27461 55-59 ATCATTA 50 2.2283475E-6 23.035896 50-54 GTATCAT 40 3.1001458E-4 21.596155 50-54 >>END_MODULE Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554306 spots for SRR7169985.sra Written 554306 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra Read 554291 spots for SRR7169985.sra Written 554291 spots for SRR7169985.sra SRR ids: ['SRR7169985.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0jtfe9_m SRR7169985.sra spots: 11085835 blocks: [[1, 554291], [554292, 1108582], [1108583, 1662873], [1662874, 2217164], [2217165, 2771455], [2771456, 3325746], [3325747, 3880037], [3880038, 4434328], [4434329, 4988619], [4988620, 5542910], [5542911, 6097201], [6097202, 6651492], [6651493, 7205783], [7205784, 7760074], [7760075, 8314365], [8314366, 8868656], [8868657, 9422947], [9422948, 9977238], [9977239, 10531529], [10531530, 11085835]] SRR7169985 file size 3734925 SRR7169985 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169985 SRR7169985_1.fastq SRR7169985_2.fastq Input file: SRR7169985_1.fastq Paired file: SRR7169985_2.fastq trimmed: SRR7169985-trimmed-pair1.fastq, SRR7169985-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:46:05 2025 >> started Wed Feb 12 06:46:17 2025 >> done (11.585s) 11085835 read pairs processed; of these: 22175 ( 0.20%) short read pairs filtered out after trimming by size control 552846 ( 4.99%) empty read pairs filtered out after trimming by size control 10510814 (94.81%) read pairs available; of these: 6500798 (61.85%) trimmed read pairs available after processing 4010016 (38.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 19 0.00% 20 12 0.00% 21 14 0.00% 22 27 0.00% 23 22 0.00% 24 26 0.00% 25 25 0.00% 26 30 0.00% 27 32 0.00% 28 21 0.00% 29 36 0.00% 30 28 0.00% 31 57 0.00% 32 73 0.00% 33 53 0.00% 34 56 0.00% 35 61 0.00% 36 66 0.00% 37 71 0.00% 38 84 0.00% 39 95 0.00% 40 101 0.00% 41 129 0.00% 42 159 0.00% 43 151 0.00% 44 209 0.00% 45 260 0.00% 46 291 0.00% 47 312 0.00% 48 357 0.00% 49 383 0.00% 50 427 0.00% 51 425 0.00% 52 514 0.00% 53 535 0.01% 54 549 0.01% 55 609 0.01% 56 658 0.01% 57 724 0.01% 58 807 0.01% 59 836 0.01% 60 905 0.01% 61 1057 0.01% 62 1223 0.01% 63 1341 0.01% 64 1478 0.01% 65 1811 0.02% 66 2512 0.02% 67 3031 0.03% 68 3822 0.04% 69 8695 0.08% 70 22053 0.21% 71 14634 0.14% 72 8648 0.08% 73 6808 0.06% 74 5945 0.06% 75 6009 0.06% 76 6107 0.06% 77 6231 0.06% 78 6553 0.06% 79 7038 0.07% 80 7453 0.07% 81 8052 0.08% 82 9428 0.09% 83 10570 0.10% 84 12450 0.12% 85 13799 0.13% 86 15105 0.14% 87 16246 0.15% 88 17818 0.17% 89 19158 0.18% 90 19653 0.19% 91 20260 0.19% 92 21237 0.20% 93 23031 0.22% 94 24184 0.23% 95 26528 0.25% 96 27235 0.26% 97 28148 0.27% 98 29262 0.28% 99 28903 0.27% 100 30762 0.29% 101 31712 0.30% 102 33416 0.32% 103 34485 0.33% 104 36421 0.35% 105 38785 0.37% 106 40199 0.38% 107 40845 0.39% 108 42003 0.40% 109 43150 0.41% 110 43026 0.41% 111 43067 0.41% 112 44711 0.43% 113 48028 0.46% 114 49030 0.47% 115 51054 0.49% 116 52212 0.50% 117 52480 0.50% 118 52516 0.50% 119 52722 0.50% 120 53200 0.51% 121 53540 0.51% 122 54921 0.52% 123 57018 0.54% 124 59325 0.56% 125 60271 0.57% 126 60967 0.58% 127 62583 0.60% 128 64136 0.61% 129 64114 0.61% 130 65205 0.62% 131 65660 0.62% 132 67930 0.65% 133 69748 0.66% 134 72520 0.69% 135 75598 0.72% 136 76732 0.73% 137 79600 0.76% 138 82833 0.79% 139 85147 0.81% 140 86655 0.82% 141 90906 0.86% 142 96433 0.92% 143 102398 0.97% 144 111052 1.06% 145 123329 1.17% 146 143547 1.37% 147 182619 1.74% 148 253294 2.41% 149 463768 4.41% 150 2151345 20.47% 151 4010016 38.15% 10510814 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=2.9 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=56.15 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.3 sequence=TTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAGTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=34 prefix-density=0.34 prefix-fanout=2.8 sequence=GGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=229.48 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=15.8 sequence=TGAAGATGATTCCCACCAAGCCTATGGTTGTTGAGACCTTTTCTGCCTATCCTCCTCTTGGTCGTTTTGCAGTGAGGGACATGCGTCAGACCGTGGCGGTTGGTGTCATTAAGAGTGTTGAGAAGAAGGATCCATCTGGTGCCAAGGTCACCAAGTCTGCAGTAAAGAAAAAGTGAAGTGTTTGCTTAGTTACAGTTTAGACTAGTTTATGTCTGCTTTTCTGCCTGTTTGATTTTATCTTCTCTTC SRR7169985 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:47:09 Started mapping on | Feb 12 06:47:09 Finished on | Feb 12 06:50:30 Mapping speed, Million of reads per hour | 188.25 Number of input reads | 10510814 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 8453410 Uniquely mapped reads % | 80.43% Average mapped length | 283.49 Number of splices: Total | 5022803 Number of splices: Annotated (sjdb) | 4891919 Number of splices: GT/AG | 4933338 Number of splices: GC/AG | 63494 Number of splices: AT/AC | 4348 Number of splices: Non-canonical | 21623 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.68 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169958 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 59621 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.25% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1899382 1899382 1899382 N_multimapping 169958 169958 169958 N_noFeature 262831 8300895 340618 N_ambiguous 114750 821 39541 UnstrandedReadsAssigned:8075829 PositiveStrandReadsAssigned:151694 NegativeStrandReadsAssigned:8073251 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=132 echo kmer=127 SRR7169985 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169985-trimmed-pair1.fastq SRR7169985-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,510,814 reads, 8,142,170 reads pseudoaligned [quant] estimated average fragment length: 190.144 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7169985.ke.tsv 34699 SRR7169985.se.tsv 87100 total ==> SRR7169985.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.86 194 11.792 Potri.005G024800.1.v4.1 1035 845.856 25 3.28555 Potri.004G059700.1.v4.1 961 771.86 2 0.288042 Potri.007G009000.2.v4.1 1416 1226.86 0 0 Potri.003G141000.2.v4.1 2943 2753.86 145 5.85317 Potri.016G087400.1.v4.1 270 100.971 1052 1158.2 Potri.015G069301.1.v4.1 564 375.559 0 0 Potri.010G195200.1.v4.1 1773 1583.86 39 2.73724 Potri.012G127500.1.v4.1 977 787.86 4931 695.745 ==> SRR7169985.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1020 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 448 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169985 completed mapping pipeline successfully