Starting /dee2/code/volunteer_pipeline.sh SRR7169986 current disk space = 3050097487872 free memory = 1484518920 SRR7169986 SRAfilesize 5b5cb503e8ab1c34c954f361b2f69441 SRR7169986.sra SRR7169986.sra file validated SRR7169986 is paired end SRR7169986 is conventional basespace SRR7169986 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169986_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2375 34.0 33.0 34.0 33.0 34.0 2 33.49675 34.0 34.0 34.0 33.0 34.0 3 33.53775 34.0 34.0 34.0 33.0 34.0 4 33.53075 34.0 34.0 34.0 33.0 34.0 5 33.5015 34.0 34.0 34.0 33.0 34.0 6 37.1955 38.0 38.0 38.0 36.0 38.0 7 37.473 38.0 38.0 38.0 37.0 38.0 8 37.50925 38.0 38.0 38.0 38.0 38.0 9 37.551 38.0 38.0 38.0 38.0 38.0 10-14 37.5067 38.0 38.0 38.0 37.6 38.0 15-19 37.48255 38.0 38.0 38.0 38.0 38.0 20-24 37.48035 38.0 38.0 38.0 37.8 38.0 25-29 37.4453 38.0 38.0 38.0 38.0 38.0 30-34 37.440250000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.36155 38.0 38.0 38.0 37.4 38.0 40-44 37.2226 38.0 38.0 38.0 37.0 38.0 45-49 37.1753 38.0 38.0 38.0 36.0 38.0 50-54 37.14595 38.0 38.0 38.0 36.2 38.0 55-59 37.1045 38.0 38.0 38.0 36.0 38.0 60-64 37.0606 38.0 38.0 38.0 36.0 38.0 65-69 36.982800000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.945949999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.87595 38.0 38.0 38.0 35.8 38.0 80-84 36.762350000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.6536 38.0 38.0 38.0 35.0 38.0 90-94 36.51535 38.0 38.0 38.0 34.2 38.0 95-99 36.2905 38.0 38.0 38.0 33.8 38.0 100-104 36.28705 38.0 37.8 38.0 34.0 38.0 105-109 36.2374 38.0 38.0 38.0 34.0 38.0 110-114 36.0618 38.0 37.4 38.0 33.2 38.0 115-119 35.86995 38.0 37.2 38.0 32.2 38.0 120-124 35.72195000000001 38.0 36.8 38.0 32.0 38.0 125-129 35.46655 38.0 36.4 38.0 30.2 38.0 130-134 34.90435 38.0 35.6 38.0 28.4 38.0 135-139 34.5151 38.0 35.0 38.0 26.4 38.0 140-144 34.42105 38.0 35.0 38.0 25.8 38.0 145-149 33.600899999999996 38.0 34.8 38.0 19.4 38.0 150-151 29.71725 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 2.0 13 1.0 14 2.0 15 1.0 16 0.0 17 5.0 18 2.0 19 9.0 20 1.0 21 5.0 22 4.0 23 6.0 24 12.0 25 13.0 26 15.0 27 32.0 28 13.0 29 42.0 30 53.0 31 65.0 32 71.0 33 94.0 34 136.0 35 229.0 36 627.0 37 2555.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.396877360866284 12.767564845127172 9.141274238227147 33.6942835557794 2 23.825 15.0 30.3 30.875000000000004 3 21.0 20.75 25.45 32.800000000000004 4 21.575 27.625 24.474999999999998 26.325 5 22.025 31.775 24.425 21.775 6 20.525 33.975 25.75 19.75 7 15.15 26.424999999999997 38.925 19.5 8 17.65 25.874999999999996 31.5 24.975 9 18.525 25.6 33.025 22.85 10-14 19.555 29.744999999999997 26.979999999999997 23.72 15-19 20.244999999999997 28.9 27.26 23.595 20-24 20.215 29.125 26.924999999999997 23.735 25-29 20.0 29.354999999999997 27.150000000000002 23.494999999999997 30-34 20.03 28.544999999999998 27.445000000000004 23.98 35-39 19.98 28.194999999999997 27.345000000000002 24.48 40-44 20.48 28.689999999999998 26.815 24.015 45-49 20.800200050012503 28.447111777944485 26.811702925731435 23.940985246311577 50-54 19.875 28.345 27.625 24.154999999999998 55-59 20.69 27.589999999999996 27.744999999999997 23.974999999999998 60-64 19.73 28.749999999999996 27.145000000000003 24.375 65-69 20.0 28.444999999999997 27.3 24.255 70-74 20.735 27.74 27.185 24.34 75-79 19.86 28.360000000000003 27.700000000000003 24.08 80-84 20.599999999999998 27.875 27.655 23.87 85-89 20.536026801340068 27.931396569828493 27.466373318665934 24.066203310165506 90-94 20.363599939900837 28.567135774027147 27.17483848349777 23.894425802574247 95-99 20.28934545637213 27.889687044758126 27.633495755261965 24.187471743607777 100-104 20.725725725725724 27.972972972972972 27.347347347347345 23.953953953953956 105-109 20.901045052252613 27.621381069053452 26.75133756687834 24.72623631181559 110-114 21.049209841968395 27.550510102020404 27.490498099619927 23.909781956391278 115-119 20.565 27.905 27.675 23.855 120-124 20.595 27.905 27.105 24.395 125-129 20.585 27.455000000000002 27.845 24.115000000000002 130-134 20.87884557570899 27.467682132478206 27.277282292814913 24.376189998997898 135-139 21.23938282153088 28.10976529124994 26.300447303613613 24.35040458360557 140-144 21.29471890971039 27.833450245515586 27.076861408958813 23.79496943581521 145-149 21.28586450353012 27.79029592909719 26.608582444544588 24.3152571228281 150-151 21.477684710588825 27.028378547318415 27.040880110013752 24.453056632079008 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 4.0 26 4.5 27 2.5 28 6.0 29 11.5 30 18.5 31 24.5 32 27.0 33 35.5 34 48.5 35 68.0 36 81.5 37 92.0 38 114.5 39 140.0 40 181.5 41 222.5 42 244.5 43 246.5 44 256.0 45 263.0 46 259.5 47 261.0 48 235.5 49 221.5 50 191.5 51 147.5 52 127.5 53 101.5 54 86.0 55 74.0 56 57.0 57 36.5 58 25.0 59 22.5 60 15.0 61 10.0 62 6.5 63 3.5 64 3.5 65 3.0 66 3.0 67 3.5 68 2.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.025 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.165 95-99 0.46499999999999997 100-104 0.1 105-109 0.005 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.21 135-139 0.515 140-144 0.21 145-149 0.145 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 3.0875000000000004 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.5625 0.0 0.0 0.0 0.0 132-133 6.075 0.0 0.0 0.0 0.0 134-135 6.6625 0.0 0.0 0.0 0.0 136-137 7.25 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169986 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169986_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.26025 33.0 33.0 34.0 32.0 34.0 2 32.30125 34.0 33.0 34.0 32.0 34.0 3 32.2695 34.0 33.0 34.0 32.0 34.0 4 31.92725 34.0 33.0 34.0 32.0 34.0 5 31.8635 34.0 33.0 34.0 31.0 34.0 6 36.081 38.0 38.0 38.0 35.0 38.0 7 36.12825 38.0 38.0 38.0 35.0 38.0 8 36.1165 38.0 38.0 38.0 35.0 38.0 9 36.11975 38.0 38.0 38.0 35.0 38.0 10-14 36.006800000000005 38.0 38.0 38.0 35.0 38.0 15-19 35.7727 38.0 38.0 38.0 34.4 38.0 20-24 35.9551 38.0 38.0 38.0 35.0 38.0 25-29 36.0433 38.0 38.0 38.0 35.8 38.0 30-34 36.05030000000001 38.0 38.0 38.0 35.4 38.0 35-39 35.999100000000006 38.0 38.0 38.0 35.6 38.0 40-44 35.809799999999996 38.0 38.0 38.0 34.8 38.0 45-49 35.7544 38.0 38.0 38.0 34.2 38.0 50-54 35.940000000000005 38.0 38.0 38.0 34.8 38.0 55-59 35.92659999999999 38.0 38.0 38.0 34.4 38.0 60-64 35.9195 38.0 38.0 38.0 34.4 38.0 65-69 35.8691 38.0 38.0 38.0 34.2 38.0 70-74 35.79995 38.0 38.0 38.0 34.2 38.0 75-79 35.7672 38.0 38.0 38.0 34.0 38.0 80-84 35.66005 38.0 38.0 38.0 33.6 38.0 85-89 35.24305 38.0 38.0 38.0 31.8 38.0 90-94 34.93555 38.0 38.0 38.0 28.8 38.0 95-99 35.294149999999995 38.0 38.0 38.0 30.6 38.0 100-104 35.338849999999994 38.0 38.0 38.0 32.0 38.0 105-109 35.12215 38.0 38.0 38.0 30.2 38.0 110-114 34.970299999999995 38.0 37.8 38.0 28.6 38.0 115-119 34.67985 38.0 37.0 38.0 27.0 38.0 120-124 34.6545 38.0 36.8 38.0 27.4 38.0 125-129 34.23765 38.0 36.0 38.0 24.4 38.0 130-134 33.48895 38.0 35.6 38.0 17.2 38.0 135-139 32.34765 38.0 34.4 38.0 6.4 38.0 140-144 31.621199999999998 38.0 33.6 38.0 2.0 38.0 145-149 31.003999999999998 38.0 32.6 38.0 2.0 38.0 150-151 27.413625 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 107.0 3 7.0 4 3.0 5 1.0 6 1.0 7 3.0 8 2.0 9 2.0 10 1.0 11 3.0 12 4.0 13 4.0 14 3.0 15 6.0 16 5.0 17 17.0 18 9.0 19 8.0 20 6.0 21 14.0 22 14.0 23 13.0 24 15.0 25 25.0 26 21.0 27 25.0 28 33.0 29 29.0 30 42.0 31 70.0 32 88.0 33 129.0 34 125.0 35 201.0 36 456.0 37 2508.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.96569250317662 22.66836086404066 12.299872935196952 24.066073697585768 2 26.94063926940639 27.95535261288686 28.462709284627092 16.641298833079652 3 22.131773085728824 28.618672093614855 29.99236835410837 19.257186466547953 4 23.630753407045514 33.73617896631525 22.885060426844948 19.748007199794294 5 24.748905485449395 35.51377800669586 21.83878444501674 17.89853206283801 6 21.295111338622984 36.242641412848734 23.701049398515487 18.7611978500128 7 21.218326081392373 23.598669055541336 35.346813411824925 19.836191451241362 8 21.61817253700868 27.23328228688106 26.64624808575804 24.502297090352222 9 21.08094262295082 25.512295081967213 29.713114754098363 23.693647540983605 10-14 24.11474905060043 28.74884532484861 25.572205686133636 21.564199938417325 15-19 23.759305210918114 28.406741108354012 26.969602977667495 20.86435070306038 20-24 22.92137138164648 28.608088688154382 26.914391295421886 21.55614863477725 25-29 23.785388829160908 28.33666103517125 27.092612501919827 20.785337633748018 30-34 24.168503049249217 28.26320914262287 26.930764105980625 20.637523702147288 35-39 23.658674333829648 28.818606561585458 27.037018021255836 20.485701083329054 40-44 24.553525343243525 28.120161040569837 26.77815629193765 20.548157324248994 45-49 23.787933432943483 28.069452315935905 27.317223968262144 20.825390282858468 50-54 23.390975135577612 28.67082779085235 26.946689859817862 20.991507213752175 55-59 23.859038057675562 27.92091379398658 27.316498488961738 20.903549659376118 60-64 23.603151862464184 28.085345886205488 27.21551371264838 21.095988538681947 65-69 23.784447057620532 27.36847487090342 27.54742062477632 21.29965744669973 70-74 24.022772327555533 28.09434249987292 27.098053169318355 20.78483200325319 75-79 24.460029476038013 27.290745540478735 27.051887991055544 21.197336992427708 80-84 24.0294614086236 27.717252314459618 27.333640223006494 20.919646053910284 85-89 24.491064491064492 27.557627557627555 27.09142709142709 20.85988085988086 90-94 23.967329102070543 27.442513786286547 27.322859223806056 21.267297887836854 95-99 24.090325891711572 27.677700795483705 27.421093148575824 20.81088016422889 100-104 24.122426038526392 27.80644831638649 27.540749067497828 20.53037657758929 105-109 24.070941616689733 28.130606386795836 27.146445230406478 20.65200676610795 110-114 24.163035119200206 27.280184568059475 27.510894642399386 21.04588567034094 115-119 24.906892505484414 28.049589306668025 26.75373705423193 20.28978113361563 120-124 24.570559918925767 27.81352926273119 27.266278185964023 20.349632632379024 125-129 25.242768329651135 27.580537429995378 26.830396136258543 20.34629810409495 130-134 25.453589271627663 27.499342624244015 26.92611096502761 20.12095713910071 135-139 25.49219462475189 27.101550346011482 27.34295370420042 20.06330132503621 140-144 26.007703575109858 28.00412304019964 26.452557912439644 19.535615472250857 145-149 25.828372754569877 28.077753779697623 26.0706948322183 20.023178633514195 150-151 25.84472530306938 28.320866649471238 26.192932679907145 19.641475367552232 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 60.0 1 32.0 2 2.0 3 0.5 4 1.5 5 3.0 6 3.5 7 2.5 8 4.0 9 4.0 10 2.0 11 1.5 12 1.5 13 1.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 3.0 23 3.0 24 2.0 25 2.5 26 3.5 27 3.0 28 7.0 29 8.5 30 8.5 31 11.5 32 11.0 33 21.5 34 32.0 35 41.0 36 61.5 37 85.5 38 109.5 39 136.0 40 169.5 41 223.0 42 261.0 43 282.5 44 280.5 45 268.0 46 290.5 47 285.5 48 244.0 49 210.0 50 180.5 51 153.0 52 122.0 53 93.0 54 72.5 55 50.5 56 47.5 57 39.5 58 22.0 59 19.0 60 15.5 61 9.0 62 6.5 63 6.5 64 4.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.625 2 1.4500000000000002 3 1.725 4 2.775 5 2.9250000000000003 6 2.325 7 2.325 8 2.0500000000000003 9 2.4 10-14 2.5700000000000003 15-19 3.2800000000000002 20-24 2.58 25-29 2.335 30-34 2.435 35-39 2.6149999999999998 40-44 3.1300000000000003 45-49 2.955 50-54 2.27 55-59 2.385 60-64 2.2800000000000002 65-69 2.205 70-74 1.635 75-79 1.6150000000000002 80-84 2.245 85-89 3.4750000000000005 90-94 3.8899999999999997 95-99 2.5749999999999997 100-104 2.145 105-109 2.455 110-114 2.475 115-119 1.9949999999999999 120-124 1.325 125-129 2.685 130-134 4.925 135-139 6.795 140-144 7.835 145-149 5.085 150-151 3.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.61783439490446 97.75 2 0.2802547770700637 0.5499999999999999 3 0.05095541401273885 0.15 4 0.025477707006369425 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025477707006369425 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 58 1.4500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.2750000000000004 0.0 0.0 0.0 0.0 120-121 3.5875000000000004 0.0 0.0 0.0 0.0 122-123 3.9000000000000004 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 5.012499999999999 0.0 0.0 0.0 0.0 130-131 5.3875 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.5375 0.0 0.0 0.0 0.0 136-137 7.050000000000001 0.0 0.0 0.0 0.0 138-139 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATAT 10 0.007007068 143.74683 8 >>END_MODULE Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729155 spots for SRR7169986.sra Written 729155 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra Read 729143 spots for SRR7169986.sra Written 729143 spots for SRR7169986.sra SRR ids: ['SRR7169986.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oisew469 SRR7169986.sra spots: 14582872 blocks: [[1, 729143], [729144, 1458286], [1458287, 2187429], [2187430, 2916572], [2916573, 3645715], [3645716, 4374858], [4374859, 5104001], [5104002, 5833144], [5833145, 6562287], [6562288, 7291430], [7291431, 8020573], [8020574, 8749716], [8749717, 9478859], [9478860, 10208002], [10208003, 10937145], [10937146, 11666288], [11666289, 12395431], [12395432, 13124574], [13124575, 13853717], [13853718, 14582872]] SRR7169986 file size 4919956 SRR7169986 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169986 SRR7169986_1.fastq SRR7169986_2.fastq Input file: SRR7169986_1.fastq Paired file: SRR7169986_2.fastq trimmed: SRR7169986-trimmed-pair1.fastq, SRR7169986-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:01:41 2025 >> started Wed Feb 12 07:01:57 2025 >> done (15.048s) 14582872 read pairs processed; of these: 27745 ( 0.19%) short read pairs filtered out after trimming by size control 36618 ( 0.25%) empty read pairs filtered out after trimming by size control 14518509 (99.56%) read pairs available; of these: 7059946 (48.63%) trimmed read pairs available after processing 7458563 (51.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 8 0.00% 23 6 0.00% 24 9 0.00% 25 9 0.00% 26 8 0.00% 27 14 0.00% 28 12 0.00% 29 7 0.00% 30 15 0.00% 31 15 0.00% 32 15 0.00% 33 11 0.00% 34 14 0.00% 35 9 0.00% 36 13 0.00% 37 22 0.00% 38 25 0.00% 39 27 0.00% 40 29 0.00% 41 29 0.00% 42 37 0.00% 43 48 0.00% 44 47 0.00% 45 44 0.00% 46 65 0.00% 47 55 0.00% 48 56 0.00% 49 64 0.00% 50 86 0.00% 51 99 0.00% 52 117 0.00% 53 127 0.00% 54 120 0.00% 55 139 0.00% 56 154 0.00% 57 191 0.00% 58 208 0.00% 59 242 0.00% 60 244 0.00% 61 300 0.00% 62 330 0.00% 63 394 0.00% 64 433 0.00% 65 475 0.00% 66 542 0.00% 67 690 0.00% 68 834 0.01% 69 1316 0.01% 70 2049 0.01% 71 1480 0.01% 72 1307 0.01% 73 1351 0.01% 74 1533 0.01% 75 1774 0.01% 76 1744 0.01% 77 2020 0.01% 78 2127 0.01% 79 2392 0.02% 80 2722 0.02% 81 3119 0.02% 82 3566 0.02% 83 4082 0.03% 84 5554 0.04% 85 6613 0.05% 86 6943 0.05% 87 7380 0.05% 88 7831 0.05% 89 8288 0.06% 90 8537 0.06% 91 9400 0.06% 92 10209 0.07% 93 10828 0.07% 94 11674 0.08% 95 12576 0.09% 96 13169 0.09% 97 13733 0.09% 98 14149 0.10% 99 14729 0.10% 100 15494 0.11% 101 16676 0.11% 102 17395 0.12% 103 18563 0.13% 104 19742 0.14% 105 20768 0.14% 106 21597 0.15% 107 22110 0.15% 108 23172 0.16% 109 23834 0.16% 110 24534 0.17% 111 25586 0.18% 112 26969 0.19% 113 28523 0.20% 114 29695 0.20% 115 31041 0.21% 116 32262 0.22% 117 33235 0.23% 118 33683 0.23% 119 34253 0.24% 120 35484 0.24% 121 36726 0.25% 122 37963 0.26% 123 39482 0.27% 124 41768 0.29% 125 43212 0.30% 126 45284 0.31% 127 46923 0.32% 128 47615 0.33% 129 49376 0.34% 130 51067 0.35% 131 52562 0.36% 132 55331 0.38% 133 58270 0.40% 134 61443 0.42% 135 65344 0.45% 136 68355 0.47% 137 73040 0.50% 138 78343 0.54% 139 85129 0.59% 140 89504 0.62% 141 97069 0.67% 142 105952 0.73% 143 114207 0.79% 144 129241 0.89% 145 147447 1.02% 146 177682 1.22% 147 231066 1.59% 148 327473 2.26% 149 611740 4.21% 150 3256075 22.43% 151 7458563 51.37% 14518509 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=7 fanout-score=208.44 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=25.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.5 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=256.91 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=26.6 sequence=AAGAAGAAGAAG SRR7169986 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:02:38 Started mapping on | Feb 12 07:02:38 Finished on | Feb 12 07:04:08 Mapping speed, Million of reads per hour | 580.74 Number of input reads | 14518509 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13620738 Uniquely mapped reads % | 93.82% Average mapped length | 292.40 Number of splices: Total | 12740115 Number of splices: Annotated (sjdb) | 12515151 Number of splices: GT/AG | 12547839 Number of splices: GC/AG | 151198 Number of splices: AT/AC | 10856 Number of splices: Non-canonical | 30222 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261170 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 40779 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 661196 661196 661196 N_multimapping 261170 261170 261170 N_noFeature 251138 13464205 323307 N_ambiguous 136108 919 51116 UnstrandedReadsAssigned:13233492 PositiveStrandReadsAssigned:155614 NegativeStrandReadsAssigned:13246315 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169986 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169986-trimmed-pair1.fastq SRR7169986-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,518,509 reads, 13,207,335 reads pseudoaligned [quant] estimated average fragment length: 227.351 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7169986.ke.tsv 34699 SRR7169986.se.tsv 87100 total ==> SRR7169986.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.65 227 8.41306 Potri.005G024800.1.v4.1 1035 808.649 34 2.7919 Potri.004G059700.1.v4.1 961 734.665 4 0.361536 Potri.007G009000.2.v4.1 1416 1189.65 0 0 Potri.003G141000.2.v4.1 2943 2716.65 244 5.96399 Potri.016G087400.1.v4.1 270 84.505 1641 1289.46 Potri.015G069301.1.v4.1 564 341.164 0 0 Potri.010G195200.1.v4.1 1773 1546.65 7 0.30053 Potri.012G127500.1.v4.1 977 750.66 8533 754.813 ==> SRR7169986.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 900 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169986 completed mapping pipeline successfully