Starting /dee2/code/volunteer_pipeline.sh SRR7169987 current disk space = 3049712050176 free memory = 1575781032 SRR7169987 SRAfilesize b67a6d849fc41e45b3f442a7ab21fb2f SRR7169987.sra SRR7169987.sra file validated SRR7169987 is paired end SRR7169987 is conventional basespace SRR7169987 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169987_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2775 34.0 34.0 34.0 33.0 34.0 2 33.5065 34.0 34.0 34.0 33.0 34.0 3 33.6035 34.0 34.0 34.0 33.0 34.0 4 33.6135 34.0 34.0 34.0 33.0 34.0 5 33.63975 34.0 34.0 34.0 33.0 34.0 6 37.24 38.0 38.0 38.0 36.0 38.0 7 37.56 38.0 38.0 38.0 37.0 38.0 8 37.55975 38.0 38.0 38.0 38.0 38.0 9 37.645 38.0 38.0 38.0 38.0 38.0 10-14 37.64735 38.0 38.0 38.0 38.0 38.0 15-19 37.65904999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.611 38.0 38.0 38.0 38.0 38.0 25-29 37.5675 38.0 38.0 38.0 38.0 38.0 30-34 37.53285 38.0 38.0 38.0 38.0 38.0 35-39 37.52354999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.084849999999996 38.0 38.0 38.0 36.2 38.0 45-49 37.32115 38.0 38.0 38.0 37.0 38.0 50-54 37.281 38.0 38.0 38.0 37.0 38.0 55-59 37.24035 38.0 38.0 38.0 37.0 38.0 60-64 37.2023 38.0 38.0 38.0 36.8 38.0 65-69 37.142250000000004 38.0 38.0 38.0 36.4 38.0 70-74 36.92005 38.0 38.0 38.0 35.8 38.0 75-79 34.8832 38.0 38.0 38.0 29.8 38.0 80-84 34.6357 38.0 38.0 38.0 28.8 38.0 85-89 34.5471 38.0 38.0 38.0 28.0 38.0 90-94 34.37435000000001 38.0 38.0 38.0 26.6 38.0 95-99 34.22765 38.0 37.6 38.0 25.0 38.0 100-104 34.197649999999996 38.0 37.2 38.0 23.6 38.0 105-109 34.11825 38.0 37.0 38.0 23.0 38.0 110-114 34.004900000000006 38.0 37.0 38.0 19.4 38.0 115-119 33.73405 38.0 36.4 38.0 15.0 38.0 120-124 33.5625 38.0 36.0 38.0 15.0 38.0 125-129 33.275099999999995 38.0 35.6 38.0 14.8 38.0 130-134 32.9774 38.0 35.2 38.0 14.0 38.0 135-139 32.5958 38.0 35.0 38.0 13.0 38.0 140-144 32.305600000000005 38.0 34.2 38.0 6.4 38.0 145-149 31.704050000000002 38.0 33.8 38.0 2.0 38.0 150-151 28.851875 36.5 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 3.0 13 3.0 14 4.0 15 4.0 16 11.0 17 9.0 18 51.0 19 191.0 20 13.0 21 5.0 22 8.0 23 7.0 24 8.0 25 20.0 26 20.0 27 11.0 28 24.0 29 14.0 30 40.0 31 39.0 32 48.0 33 63.0 34 115.0 35 192.0 36 515.0 37 2577.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.36030341340076 13.299620733249052 11.302149178255373 30.037926675094816 2 22.425 21.0 29.625 26.950000000000003 3 18.45 18.825 31.025000000000002 31.7 4 19.325 25.624999999999996 23.075000000000003 31.974999999999998 5 28.15 26.950000000000003 23.0 21.9 6 25.224999999999998 32.2 24.474999999999998 18.099999999999998 7 14.174999999999999 33.275 36.175000000000004 16.375 8 17.2 32.225 28.375 22.2 9 23.05 24.75 31.4 20.8 10-14 19.33 31.624999999999996 25.15 23.895 15-19 19.040000000000003 29.595 27.105 24.26 20-24 19.505 30.509999999999998 26.779999999999998 23.205000000000002 25-29 19.18 29.17 27.084999999999997 24.565 30-34 18.415 30.595 26.905 24.085 35-39 17.915 31.96 25.56 24.565 40-44 18.459999999999997 29.265 28.155 24.12 45-49 20.859171834366876 28.855771154230847 28.015603120624128 22.269453890778156 50-54 19.82 27.04 27.02 26.119999999999997 55-59 19.785 26.575 30.275000000000002 23.365 60-64 19.57 28.199999999999996 28.470000000000002 23.76 65-69 18.345 34.36 24.975 22.32 70-74 18.845 34.410000000000004 24.72 22.025 75-79 19.05 32.79 26.05 22.11 80-84 19.59 30.509999999999998 26.63 23.27 85-89 20.39825886826437 28.778706159003352 26.9975484064642 23.825486566268076 90-94 20.059189406099517 29.28370786516854 26.800762439807386 23.856340288924557 95-99 19.590731266927474 29.55662553917143 27.600561741398334 23.25208145250276 100-104 19.90898179635927 31.931386277255452 25.780156031206243 22.379475895179034 105-109 19.235 33.48 24.905 22.38 110-114 19.830000000000002 32.675 25.34 22.155 115-119 19.75895179035807 31.08121624324865 25.885177035407082 23.2746549309862 120-124 19.49 31.035 25.44 24.035 125-129 20.055 29.955 26.435 23.555 130-134 20.38630904723779 30.77962369895917 25.55044035228183 23.283626901521217 135-139 20.100200400801604 30.6813627254509 25.24048096192385 23.97795591182365 140-144 20.519363554488145 30.436305413789654 24.927449214450114 24.11688181727209 145-149 20.46944597367499 30.96942094990241 24.88363945748461 23.67749361893799 150-151 20.1625 30.7875 24.9125 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 2.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 1.5 24 2.0 25 2.5 26 4.5 27 9.5 28 15.5 29 19.0 30 25.5 31 40.5 32 51.0 33 58.0 34 68.0 35 83.0 36 110.0 37 135.5 38 152.0 39 175.0 40 215.0 41 230.0 42 230.0 43 250.5 44 249.5 45 254.0 46 261.0 47 221.5 48 189.5 49 178.5 50 159.0 51 131.0 52 99.5 53 83.5 54 70.5 55 53.5 56 38.0 57 26.0 58 25.5 59 17.0 60 8.0 61 7.0 62 6.5 63 6.5 64 4.0 65 3.5 66 4.0 67 3.5 68 2.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.065 90-94 0.32 95-99 0.31 100-104 0.02 105-109 0.0 110-114 0.0 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.08 135-139 0.2 140-144 0.06999999999999999 145-149 0.095 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80726484142043 91.125 2 1.1114123068582271 2.0500000000000003 3 0.0 0.0 4 0.05421523448088912 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.02710761724044456 6.625 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAAACATCTCGTATGC 265 6.625 TruSeq Adapter, Index 5 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.475 0.0 0.0 0.0 0.0 126-127 5.987500000000001 0.0 0.0 0.0 0.0 128-129 6.7 0.0 0.0 0.0 0.0 130-131 7.074999999999999 0.0 0.0 0.0 0.0 132-133 7.6625 0.0 0.0 0.0 0.0 134-135 8.1125 0.0 0.0 0.0 0.0 136-137 8.65 0.0 0.0 0.0 0.0 138-139 9.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 60 5.838956E-10 84.57605 6 GAGCACA 60 5.838956E-10 84.57605 9 CGGAAGA 60 5.838956E-10 84.57605 4 AGAGCAC 60 5.838956E-10 84.57605 8 GGAAGAG 60 5.838956E-10 84.57605 5 AAGAGCA 65 1.1004886E-9 78.07019 7 TCGGAAG 65 1.1004886E-9 78.07019 3 GATCGGA 70 1.7844286E-9 73.41139 1 ATCGGAA 80 5.700713E-9 63.43203 2 TGAAAAA 40 9.99761E-6 25.372812 60-64 GTATGCC 45 2.489452E-5 22.553612 45-49 ATCTCGT 45 2.489452E-5 22.553612 40-44 TGCCGTC 45 2.489452E-5 22.553612 45-49 TATGCCG 45 2.489452E-5 22.553612 45-49 CCGTCTT 45 2.489452E-5 22.553612 50-54 TCTCGTA 45 2.489452E-5 22.553612 40-44 TGCTTGA 45 2.489452E-5 22.553612 55-59 ATGCCGT 45 2.489452E-5 22.553612 45-49 GTCTTCT 45 2.489452E-5 22.553612 50-54 CGTATGC 45 2.489452E-5 22.553612 40-44 >>END_MODULE SRR7169987 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169987_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39225 33.0 33.0 34.0 32.0 34.0 2 32.51625 34.0 33.0 34.0 32.0 34.0 3 32.529 34.0 33.0 34.0 32.0 34.0 4 32.41125 34.0 33.0 34.0 32.0 34.0 5 32.3685 34.0 33.0 34.0 32.0 34.0 6 36.36025 38.0 38.0 38.0 36.0 38.0 7 36.37175 38.0 38.0 38.0 36.0 38.0 8 36.34825 38.0 38.0 38.0 37.0 38.0 9 36.33075 38.0 38.0 38.0 36.0 38.0 10-14 36.331450000000004 38.0 38.0 38.0 36.8 38.0 15-19 36.23585 38.0 38.0 38.0 36.6 38.0 20-24 36.2879 38.0 38.0 38.0 37.0 38.0 25-29 36.31165 38.0 38.0 38.0 37.0 38.0 30-34 36.285700000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.17525 38.0 38.0 38.0 36.0 38.0 40-44 36.09439999999999 38.0 38.0 38.0 36.0 38.0 45-49 35.8788 38.0 38.0 38.0 35.0 38.0 50-54 36.00725 38.0 38.0 38.0 35.0 38.0 55-59 36.1379 38.0 38.0 38.0 35.8 38.0 60-64 36.1006 38.0 38.0 38.0 35.8 38.0 65-69 35.3488 38.0 38.0 38.0 30.0 38.0 70-74 33.924549999999996 38.0 38.0 38.0 15.0 38.0 75-79 33.852700000000006 38.0 38.0 38.0 15.0 38.0 80-84 33.738600000000005 38.0 38.0 38.0 14.0 38.0 85-89 33.40105 38.0 38.0 38.0 2.0 38.0 90-94 33.14205 38.0 38.0 38.0 2.0 38.0 95-99 33.3476 38.0 38.0 38.0 2.0 38.0 100-104 33.42685 38.0 38.0 38.0 2.0 38.0 105-109 33.33855 38.0 38.0 38.0 2.0 38.0 110-114 33.1989 38.0 37.6 38.0 2.0 38.0 115-119 33.130599999999994 38.0 37.0 38.0 2.0 38.0 120-124 32.89265 38.0 36.8 38.0 2.0 38.0 125-129 32.536649999999995 38.0 36.0 38.0 2.0 38.0 130-134 31.724700000000002 38.0 34.8 38.0 2.0 38.0 135-139 30.892199999999995 38.0 33.8 38.0 2.0 38.0 140-144 30.04495 38.0 31.6 38.0 2.0 38.0 145-149 29.835050000000003 38.0 31.4 38.0 2.0 38.0 150-151 26.557375 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 105.0 3 5.0 4 5.0 5 0.0 6 1.0 7 3.0 8 2.0 9 2.0 10 4.0 11 5.0 12 4.0 13 9.0 14 8.0 15 11.0 16 26.0 17 187.0 18 31.0 19 14.0 20 9.0 21 8.0 22 11.0 23 11.0 24 11.0 25 10.0 26 17.0 27 21.0 28 18.0 29 24.0 30 48.0 31 40.0 32 57.0 33 113.0 34 107.0 35 153.0 36 330.0 37 2590.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.673042591175715 19.892884468247896 14.511604182606478 23.922468757969906 2 25.4614412136536 32.81921618204804 26.194690265486724 15.52465233881163 3 20.721178263077704 27.348908075165056 33.849669883189435 18.0802437785678 4 23.621041879468844 30.18386108273749 21.27170582226762 24.923391215526046 5 29.416282642089094 33.74295954941116 20.583717357910906 16.25704045058884 6 27.617097517276683 32.68492449449706 22.57486562579985 17.123112362426415 7 19.682620936780136 28.282569746608647 33.734323009982084 18.300486306629125 8 21.34630151011006 30.867673406705915 25.006398771435883 22.779626311748142 9 27.189175389328568 25.682920602501913 26.397753382690837 20.730150625478682 10-14 25.23833931317273 28.04715530497181 25.576627370579192 21.137878011276268 15-19 24.838179389705125 26.379328059180107 28.300626733792257 20.48186581732251 20-24 26.78937653814602 29.0350697292863 25.097415914684166 19.078137817883512 25-29 25.05242698583193 30.458800061377932 25.343972175336297 19.14480077745384 30-34 24.957798352856926 27.90935597728784 27.761010793390966 19.37183487646427 35-39 21.998359479134624 26.612324413001126 28.750128165692608 22.63918794217164 40-44 27.702667968950806 26.520331054336094 26.54089343545983 19.23610754125328 45-49 23.702903026559603 25.941939468807906 27.079472925674285 23.275684578958206 50-54 23.71719445439198 27.70757661022152 27.90197984345424 20.673249091932266 55-59 22.776583768293932 29.474976972674238 28.390134070207758 19.358305188824072 60-64 22.26378356220537 32.95757327321172 25.753228120516496 19.025415044066406 65-69 22.67819679680704 32.52827099217111 25.35434682495011 19.43918538607174 70-74 23.22531257973973 31.916305179892827 25.70553712681807 19.152845113549375 75-79 23.089472342594952 30.57863879683915 26.41855722661229 19.913331633953607 80-84 23.419789645665272 30.092923516797715 26.87634024303074 19.610946594506277 85-89 24.6574634196784 30.21043379349568 25.867328473191662 19.26477431363425 90-94 24.3670392513647 28.120613465037692 26.935274239667272 20.577073043930337 95-99 23.81562099871959 29.003841229193345 27.22663252240717 19.9539052496799 100-104 23.633391233268622 29.983651782977418 26.565852661694084 19.817104322059876 105-109 23.369843382127137 29.77786876855359 27.131743269526055 19.720544579793224 110-114 23.859505401669143 30.024064308023142 26.48097895653064 19.635451333777073 115-119 23.888520238885203 29.778980143943645 26.70614057475371 19.626359042417437 120-124 23.807584627131586 29.717485365232882 27.029778569610585 19.445151438024944 125-129 24.072360982629252 29.417206290471785 26.734505087881594 19.77592763901737 130-134 24.066171434592487 29.592750645382225 26.958537484853274 19.382540435172015 135-139 24.60623593699775 29.626058073502627 26.529518911389694 19.238187078109934 140-144 24.70453678993519 29.51908937421709 26.523609825172922 19.2527640106748 145-149 25.04617657923901 29.458018892817563 26.011926750752018 19.48387777719141 150-151 26.387096774193548 28.63225806451613 25.49677419354839 19.483870967741936 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 61.0 1 35.5 2 7.5 3 4.0 4 2.5 5 1.5 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.5 17 2.5 18 3.5 19 3.5 20 2.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.0 26 1.0 27 3.0 28 5.5 29 9.0 30 14.0 31 17.0 32 17.0 33 24.0 34 43.5 35 63.0 36 87.5 37 102.5 38 122.0 39 167.0 40 200.0 41 222.5 42 245.5 43 255.0 44 267.5 45 291.5 46 286.5 47 273.5 48 248.5 49 190.5 50 146.0 51 124.0 52 105.5 53 81.0 54 64.5 55 51.5 56 37.5 57 28.0 58 24.0 59 22.5 60 16.0 61 9.0 62 7.0 63 8.0 64 6.0 65 2.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.975 2 1.125 3 1.55 4 2.1 5 2.35 6 2.325 7 2.325 8 2.325 9 2.075 10-14 2.45 15-19 2.67 20-24 2.48 25-29 2.245 30-34 2.255 35-39 2.4699999999999998 40-44 2.735 45-49 2.86 50-54 2.265 55-59 2.29 60-64 2.42 65-69 2.2849999999999997 70-74 2.025 75-79 1.925 80-84 2.07 85-89 3.295 90-94 3.8249999999999997 95-99 2.375 100-104 2.13 105-109 2.31 110-114 2.3449999999999998 115-119 2.045 120-124 1.775 125-129 2.71 130-134 5.095000000000001 135-139 6.67 140-144 8.195 145-149 5.255 150-151 3.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.32048458149781 89.275 2 1.3766519823788546 2.5 3 0.19273127753303965 0.525 4 0.0 0.0 5 0.0 0.0 6 0.027533039647577095 0.15 7 0.027533039647577095 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027533039647577095 1.125 >50 0.0 0.0 >100 0.027533039647577095 6.25 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 250 6.25 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 45 1.125 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.35 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.6875 0.0 0.0 0.0 0.0 132-133 7.2375 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGCTT 10 0.006744593 145.54546 8 GAAGAGC 60 6.202754E-10 83.813034 6 CGGAAGA 60 6.202754E-10 83.813034 4 GAGCGTC 55 3.256173E-8 79.388435 9 AAGAGCG 55 3.256173E-8 79.388435 7 AGAGCGT 55 3.256173E-8 79.388435 8 TCGGAAG 65 1.1714292E-9 77.365875 3 GGAAGAG 70 2.1082087E-9 71.839745 5 ATCGGAA 75 3.6397978E-9 67.05042 2 GATCGGA 80 6.0663297E-9 62.859776 1 CGTATCA 45 2.4597206E-5 22.58175 45-49 GAGTGTA 45 2.6656022E-5 22.350143 25-29 GTATCAT 45 2.6656022E-5 22.350143 50-54 CATTAAA 45 2.6656022E-5 22.350143 50-54 AGAGTGT 45 2.6656022E-5 22.350143 25-29 AGTGTAG 45 2.6656022E-5 22.350143 25-29 ATTAAAA 45 2.6656022E-5 22.350143 55-59 TCATTAA 45 2.6656022E-5 22.350143 50-54 GTAGATC 40 2.878856E-4 21.83182 30-34 ATCTCGG 40 2.878856E-4 21.83182 35-39 >>END_MODULE Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648108 spots for SRR7169987.sra Written 648108 spots for SRR7169987.sra Read 648123 spots for SRR7169987.sra Written 648123 spots for SRR7169987.sra SRR ids: ['SRR7169987.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2oboydej SRR7169987.sra spots: 12962175 blocks: [[1, 648108], [648109, 1296216], [1296217, 1944324], [1944325, 2592432], [2592433, 3240540], [3240541, 3888648], [3888649, 4536756], [4536757, 5184864], [5184865, 5832972], [5832973, 6481080], [6481081, 7129188], [7129189, 7777296], [7777297, 8425404], [8425405, 9073512], [9073513, 9721620], [9721621, 10369728], [10369729, 11017836], [11017837, 11665944], [11665945, 12314052], [12314053, 12962175]] SRR7169987 file size 4370755 SRR7169987 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169987 SRR7169987_1.fastq SRR7169987_2.fastq Input file: SRR7169987_1.fastq Paired file: SRR7169987_2.fastq trimmed: SRR7169987-trimmed-pair1.fastq, SRR7169987-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:46:17 2025 >> started Wed Feb 12 07:46:31 2025 >> done (14.262s) 12962175 read pairs processed; of these: 29785 ( 0.23%) short read pairs filtered out after trimming by size control 975074 ( 7.52%) empty read pairs filtered out after trimming by size control 11957316 (92.25%) read pairs available; of these: 5674332 (47.45%) trimmed read pairs available after processing 6282984 (52.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 15 0.00% 21 12 0.00% 22 12 0.00% 23 12 0.00% 24 25 0.00% 25 10 0.00% 26 22 0.00% 27 40 0.00% 28 18 0.00% 29 12 0.00% 30 30 0.00% 31 38 0.00% 32 31 0.00% 33 23 0.00% 34 25 0.00% 35 39 0.00% 36 36 0.00% 37 22 0.00% 38 41 0.00% 39 45 0.00% 40 51 0.00% 41 78 0.00% 42 70 0.00% 43 84 0.00% 44 90 0.00% 45 140 0.00% 46 213 0.00% 47 243 0.00% 48 238 0.00% 49 239 0.00% 50 269 0.00% 51 282 0.00% 52 343 0.00% 53 341 0.00% 54 370 0.00% 55 339 0.00% 56 393 0.00% 57 388 0.00% 58 383 0.00% 59 395 0.00% 60 439 0.00% 61 482 0.00% 62 545 0.00% 63 602 0.01% 64 636 0.01% 65 819 0.01% 66 1120 0.01% 67 1381 0.01% 68 1722 0.01% 69 3085 0.03% 70 7013 0.06% 71 5924 0.05% 72 3751 0.03% 73 2690 0.02% 74 2302 0.02% 75 2395 0.02% 76 2275 0.02% 77 2514 0.02% 78 2669 0.02% 79 2848 0.02% 80 3066 0.03% 81 3477 0.03% 82 3986 0.03% 83 4627 0.04% 84 6276 0.05% 85 7130 0.06% 86 7817 0.07% 87 8172 0.07% 88 8723 0.07% 89 9240 0.08% 90 9705 0.08% 91 10286 0.09% 92 11195 0.09% 93 11792 0.10% 94 12709 0.11% 95 13565 0.11% 96 14160 0.12% 97 14811 0.12% 98 15429 0.13% 99 15655 0.13% 100 16651 0.14% 101 17518 0.15% 102 18603 0.16% 103 19825 0.17% 104 20585 0.17% 105 22335 0.19% 106 22591 0.19% 107 23454 0.20% 108 24010 0.20% 109 24824 0.21% 110 25160 0.21% 111 26463 0.22% 112 27789 0.23% 113 29641 0.25% 114 30413 0.25% 115 31637 0.26% 116 33189 0.28% 117 33710 0.28% 118 33541 0.28% 119 34093 0.29% 120 34865 0.29% 121 35636 0.30% 122 37007 0.31% 123 38537 0.32% 124 40203 0.34% 125 42074 0.35% 126 42917 0.36% 127 44299 0.37% 128 44548 0.37% 129 45762 0.38% 130 46911 0.39% 131 48027 0.40% 132 49880 0.42% 133 51557 0.43% 134 54144 0.45% 135 57117 0.48% 136 59786 0.50% 137 62559 0.52% 138 65439 0.55% 139 69215 0.58% 140 72156 0.60% 141 76239 0.64% 142 81429 0.68% 143 87707 0.73% 144 100155 0.84% 145 109966 0.92% 146 128124 1.07% 147 165017 1.38% 148 247515 2.07% 149 439123 3.67% 150 2437874 20.39% 151 6282984 52.55% 11957316 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=10.97 fanout-score-rank=14 prefix-density=0.31 prefix-fanout=5.8 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=281.68 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=27.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=8.30 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=301.01 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=26.2 sequence=AAGAAGAAGAAA SRR7169987 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:47:15 Started mapping on | Feb 12 07:47:15 Finished on | Feb 12 07:49:19 Mapping speed, Million of reads per hour | 347.15 Number of input reads | 11957316 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10968292 Uniquely mapped reads % | 91.73% Average mapped length | 290.89 Number of splices: Total | 9530205 Number of splices: Annotated (sjdb) | 9351599 Number of splices: GT/AG | 9376709 Number of splices: GC/AG | 118277 Number of splices: AT/AC | 8104 Number of splices: Non-canonical | 27115 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228877 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 36266 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.98% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 781781 781781 781781 N_multimapping 228877 228877 228877 N_noFeature 240271 10828372 308875 N_ambiguous 114221 890 42265 UnstrandedReadsAssigned:10613800 PositiveStrandReadsAssigned:139030 NegativeStrandReadsAssigned:10617152 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169987 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169987-trimmed-pair1.fastq SRR7169987-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,957,316 reads, 10,620,529 reads pseudoaligned [quant] estimated average fragment length: 217.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7169987.ke.tsv 34699 SRR7169987.se.tsv 87100 total ==> SRR7169987.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.23 160 7.28682 Potri.005G024800.1.v4.1 1035 818.232 36 3.60922 Potri.004G059700.1.v4.1 961 744.242 5 0.551117 Potri.007G009000.2.v4.1 1416 1199.23 0 0 Potri.003G141000.2.v4.1 2943 2726.23 174 5.23569 Potri.016G087400.1.v4.1 270 88.7348 1073.96 992.85 Potri.015G069301.1.v4.1 564 349.533 0 0 Potri.010G195200.1.v4.1 1773 1556.23 7 0.368987 Potri.012G127500.1.v4.1 977 760.232 6891 743.573 ==> SRR7169987.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 602 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169987 completed mapping pipeline successfully