Starting /dee2/code/volunteer_pipeline.sh SRR7169988 current disk space = 3050140549120 free memory = 1579537148 SRR7169988 SRAfilesize ff597c87539ed2893249ef5c8876159d SRR7169988.sra SRR7169988.sra file validated SRR7169988 is paired end SRR7169988 is conventional basespace SRR7169988 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169988_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85825 34.0 33.0 34.0 33.0 34.0 2 33.391 34.0 33.0 34.0 33.0 34.0 3 33.36425 34.0 33.0 34.0 33.0 34.0 4 33.43625 34.0 34.0 34.0 33.0 34.0 5 33.378 34.0 34.0 34.0 33.0 34.0 6 37.07775 38.0 37.0 38.0 36.0 38.0 7 37.33525 38.0 38.0 38.0 37.0 38.0 8 37.4375 38.0 38.0 38.0 37.0 38.0 9 37.44025 38.0 38.0 38.0 38.0 38.0 10-14 37.513850000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.48145 38.0 38.0 38.0 37.8 38.0 20-24 37.44005 38.0 38.0 38.0 37.4 38.0 25-29 37.373900000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.3683 38.0 38.0 38.0 37.0 38.0 35-39 37.30955 38.0 38.0 38.0 37.0 38.0 40-44 37.08705 38.0 38.0 38.0 36.0 38.0 45-49 37.02945 38.0 38.0 38.0 36.0 38.0 50-54 37.003049999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.89825 38.0 38.0 38.0 35.8 38.0 60-64 36.817400000000006 38.0 38.0 38.0 35.2 38.0 65-69 36.83630000000001 38.0 38.0 38.0 35.2 38.0 70-74 36.759499999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.56755 38.0 38.0 38.0 34.2 38.0 80-84 36.53145 38.0 38.0 38.0 34.0 38.0 85-89 36.33835 38.0 38.0 38.0 34.0 38.0 90-94 36.300200000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.2804 38.0 38.0 38.0 34.0 38.0 100-104 35.974199999999996 38.0 37.2 38.0 33.2 38.0 105-109 35.89255 38.0 37.0 38.0 33.0 38.0 110-114 35.53885 38.0 36.6 38.0 31.0 38.0 115-119 35.26635 38.0 36.0 38.0 29.4 38.0 120-124 35.17549999999999 38.0 36.0 38.0 28.8 38.0 125-129 34.8497 38.0 35.8 38.0 27.8 38.0 130-134 34.20825 38.0 34.8 38.0 24.0 38.0 135-139 33.99550000000001 38.0 35.0 38.0 23.0 38.0 140-144 33.717349999999996 38.0 34.4 38.0 21.8 38.0 145-149 33.05155 38.0 34.2 38.0 16.8 38.0 150-151 29.374625 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 0.0 13 2.0 14 2.0 15 3.0 16 3.0 17 5.0 18 8.0 19 7.0 20 7.0 21 6.0 22 12.0 23 15.0 24 16.0 25 18.0 26 19.0 27 18.0 28 37.0 29 41.0 30 47.0 31 81.0 32 74.0 33 102.0 34 151.0 35 270.0 36 654.0 37 2397.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.84601679816747 12.929498600152712 8.170017816238229 34.05446678544159 2 24.099999999999998 13.625000000000002 30.775000000000002 31.5 3 20.674999999999997 18.55 26.35 34.425 4 23.150000000000002 25.874999999999996 23.425 27.55 5 24.05 28.599999999999998 25.1 22.25 6 20.474999999999998 32.9 25.874999999999996 20.75 7 15.299999999999999 28.599999999999998 37.3 18.8 8 17.849999999999998 26.85 31.125000000000004 24.175 9 17.575 25.35 32.625 24.45 10-14 19.2 30.345 27.400000000000002 23.055 15-19 20.380000000000003 29.465000000000003 26.69 23.465 20-24 19.994999999999997 28.884999999999998 27.26 23.86 25-29 20.05 29.7 26.165 24.085 30-34 19.77 29.45 27.065 23.715 35-39 19.845 28.050000000000004 28.07 24.035 40-44 20.3 28.49 27.54 23.669999999999998 45-49 20.075000000000003 28.794999999999998 26.779999999999998 24.349999999999998 50-54 20.055 28.82 27.35 23.775 55-59 20.115 29.37 26.314999999999998 24.2 60-64 20.395 28.465 26.865 24.275 65-69 20.025000000000002 28.17 27.445000000000004 24.36 70-74 20.575 28.645 27.215 23.565 75-79 19.919999999999998 28.689999999999998 27.32 24.07 80-84 20.080000000000002 27.91 27.29 24.72 85-89 20.865000000000002 28.575 26.245 24.315 90-94 20.51 28.249999999999996 27.200000000000003 24.04 95-99 19.785 28.64 27.3 24.275 100-104 20.825 27.82 26.615 24.740000000000002 105-109 20.435 28.71 26.46 24.395 110-114 20.71 28.065 27.025 24.2 115-119 20.51 28.23 26.88 24.38 120-124 20.165 28.110000000000003 27.13 24.595 125-129 20.845 28.044999999999998 26.884999999999998 24.224999999999998 130-134 21.325 27.88 26.540000000000003 24.255 135-139 20.830000000000002 28.04 26.855 24.275 140-144 21.22 27.92 26.784999999999997 24.075 145-149 21.23 28.349999999999998 26.26 24.16 150-151 21.1125 28.6375 26.150000000000002 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 4.0 24 4.5 25 3.0 26 3.5 27 7.0 28 11.5 29 13.0 30 15.5 31 22.0 32 27.5 33 39.5 34 51.5 35 66.0 36 87.0 37 99.5 38 116.5 39 140.5 40 164.5 41 203.0 42 238.0 43 256.0 44 263.5 45 257.0 46 266.0 47 252.0 48 237.0 49 210.5 50 169.5 51 159.5 52 133.5 53 111.0 54 93.5 55 62.5 56 38.0 57 37.5 58 32.0 59 21.0 60 18.0 61 14.5 62 11.5 63 9.0 64 6.5 65 4.5 66 5.0 67 3.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7875000000000001 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.0250000000000004 0.0 0.0 0.0 0.0 116-117 3.4000000000000004 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.375 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.925 0.0 0.0 0.0 0.0 136-137 8.375 0.0 0.0 0.0 0.0 138-139 8.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGAAT 10 0.006830828 145.0 6 AAATAGG 10 0.006830828 145.0 6 >>END_MODULE SRR7169988 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169988_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63025 33.0 33.0 34.0 31.0 34.0 2 32.12675 33.0 33.0 34.0 31.0 34.0 3 32.17075 34.0 33.0 34.0 31.0 34.0 4 31.79425 34.0 33.0 34.0 31.0 34.0 5 31.804 34.0 33.0 34.0 31.0 34.0 6 36.14525 38.0 38.0 38.0 34.0 38.0 7 36.2195 38.0 38.0 38.0 34.0 38.0 8 36.23925 38.0 38.0 38.0 35.0 38.0 9 36.36 38.0 38.0 38.0 36.0 38.0 10-14 36.16035000000001 38.0 38.0 38.0 35.0 38.0 15-19 35.9295 38.0 38.0 38.0 34.8 38.0 20-24 36.0693 38.0 38.0 38.0 34.8 38.0 25-29 36.11555 38.0 38.0 38.0 35.0 38.0 30-34 36.097300000000004 38.0 38.0 38.0 35.0 38.0 35-39 36.0289 38.0 38.0 38.0 35.0 38.0 40-44 35.9001 38.0 38.0 38.0 34.6 38.0 45-49 35.853750000000005 38.0 38.0 38.0 34.0 38.0 50-54 36.01115 38.0 38.0 38.0 34.8 38.0 55-59 35.96155 38.0 38.0 38.0 34.4 38.0 60-64 35.9287 38.0 38.0 38.0 34.2 38.0 65-69 35.8895 38.0 38.0 38.0 34.0 38.0 70-74 35.814499999999995 38.0 38.0 38.0 34.0 38.0 75-79 35.70465 38.0 38.0 38.0 33.6 38.0 80-84 35.648399999999995 38.0 38.0 38.0 33.4 38.0 85-89 35.15875 38.0 38.0 38.0 30.0 38.0 90-94 34.850699999999996 38.0 38.0 38.0 28.2 38.0 95-99 35.19625 38.0 38.0 38.0 29.2 38.0 100-104 35.2495 38.0 38.0 38.0 30.2 38.0 105-109 35.0583 38.0 38.0 38.0 28.8 38.0 110-114 34.8759 38.0 37.2 38.0 28.6 38.0 115-119 34.63655 38.0 37.0 38.0 26.6 38.0 120-124 34.387150000000005 38.0 36.2 38.0 24.4 38.0 125-129 33.92645 38.0 35.8 38.0 19.4 38.0 130-134 32.9377 38.0 35.0 38.0 13.4 38.0 135-139 31.906599999999997 38.0 34.4 38.0 2.0 38.0 140-144 31.054150000000003 38.0 32.8 38.0 2.0 38.0 145-149 30.46445 38.0 31.4 38.0 2.0 38.0 150-151 26.88575 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 85.0 3 18.0 4 1.0 5 1.0 6 4.0 7 0.0 8 2.0 9 2.0 10 5.0 11 1.0 12 0.0 13 3.0 14 4.0 15 6.0 16 11.0 17 12.0 18 8.0 19 10.0 20 10.0 21 8.0 22 12.0 23 13.0 24 21.0 25 36.0 26 30.0 27 33.0 28 43.0 29 46.0 30 71.0 31 75.0 32 88.0 33 136.0 34 137.0 35 186.0 36 452.0 37 2430.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.55921223114797 21.922777921741385 14.356050790360197 25.161959056750455 2 28.98330804248862 25.97369752149722 27.870510875063225 17.172483560950937 3 21.80986273512964 27.147941026944583 30.706659888154554 20.335536349771225 4 25.17356646952944 32.81049112882489 22.936487528927746 19.07945487271792 5 25.237972729611524 34.268073064059685 22.356573192693592 18.137381013635196 6 21.612001017035343 36.689549961861175 23.290109331299263 18.408339689804222 7 21.266853218010684 22.284406003561436 35.945052149580256 20.503688628847623 8 23.774447548895097 24.917449834899667 26.16205232410465 25.146050292100586 9 21.80986273512964 26.41077783426538 28.622267412303 23.157092018301984 10-14 24.3507984286516 28.00367328197541 26.284373246262945 21.361155043110045 15-19 23.983990147783253 27.786330049261082 27.314244663382592 20.91543513957307 20-24 23.63274268498187 28.54006025634479 26.446407598427207 21.380789460246135 25-29 24.02789087947883 28.511807817589574 26.511604234527685 20.94869706840391 30-34 23.857091891340907 27.648947556189796 27.36863564548188 21.125324906987412 35-39 24.09090909090909 27.650663942798776 27.29826353421859 20.960163432073546 40-44 24.532075278190863 27.583200861494284 27.14732577816522 20.73739808214963 45-49 23.908694537060786 28.14567837907156 27.006924852526286 20.93870223134137 50-54 23.902961113093117 27.77126548086234 27.46547066918098 20.860302736863563 55-59 24.20902224943866 27.46989181465605 27.2708716064503 21.05021432945499 60-64 24.078987651801203 27.45178079395857 27.67629349933667 20.792938054903562 65-69 24.8062410768917 27.462777891087086 27.146644911278813 20.584336120742403 70-74 24.376394240519165 27.71243155546542 27.23078483066315 20.680389373352263 75-79 23.858279689796746 27.259364387449946 28.21734502508997 20.66501089766334 80-84 24.217597068851457 27.29632079792377 27.057147218971046 21.428934914253727 85-89 23.854440492758105 27.84392557084686 27.586206896551722 20.715427039843306 90-94 24.542809642560265 27.145677472984207 27.519742310889445 20.791770573566083 95-99 24.10942125140349 27.651321833214247 27.600285801776053 20.638971113606207 100-104 24.29320971932148 27.838622586725077 27.17131068208446 20.696857011868982 105-109 24.607142857142858 28.107142857142858 27.285714285714285 20.0 110-114 24.86959189935563 27.196481538304184 27.426613480617778 20.50731308172241 115-119 24.548460951411855 27.122869498855252 27.596031544136352 20.73263800559654 120-124 24.998734625702284 27.357392316647267 27.301715847547705 20.342157210102748 125-129 25.256200040992006 27.218692354990775 27.669604427136708 19.85550317688051 130-134 26.032665964172814 27.766069546891465 26.364594309799788 19.836670179135933 135-139 25.234248788368337 27.652127086698975 26.962843295638127 20.15078082929456 140-144 25.43138642425562 27.848239072451147 27.11338522671602 19.606989276577213 145-149 25.59082056950366 27.40670561608506 26.95405021316911 20.04842360124217 150-151 26.654694715238588 27.44997434581837 26.770138532580813 19.12519240636224 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 47.0 1 25.5 2 3.0 3 3.5 4 3.0 5 3.0 6 3.0 7 1.0 8 1.5 9 1.5 10 1.0 11 0.5 12 0.5 13 0.5 14 1.5 15 2.5 16 1.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 3.0 25 3.0 26 1.5 27 1.0 28 3.5 29 5.5 30 6.5 31 7.0 32 10.5 33 22.5 34 31.5 35 36.5 36 54.0 37 79.5 38 101.5 39 140.0 40 183.0 41 215.5 42 249.0 43 274.0 44 276.5 45 279.0 46 292.5 47 299.5 48 273.0 49 217.0 50 175.5 51 150.5 52 130.5 53 98.0 54 70.0 55 56.5 56 39.0 57 28.0 58 23.5 59 18.5 60 14.0 61 11.5 62 9.0 63 9.0 64 6.5 65 2.0 66 2.0 67 2.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.5249999999999995 2 1.15 3 1.6500000000000001 4 2.775 5 2.825 6 1.675 7 1.725 8 1.575 9 1.6500000000000001 10-14 1.9949999999999999 15-19 2.56 20-24 2.085 25-29 1.76 30-34 1.8950000000000002 35-39 2.1 40-44 2.495 45-49 2.5250000000000004 50-54 1.8950000000000002 55-59 2.02 60-64 2.01 65-69 1.94 70-74 1.38 75-79 1.355 80-84 1.745 85-89 2.995 90-94 3.7600000000000002 95-99 2.03 100-104 1.8450000000000002 105-109 2.0 110-114 2.23 115-119 1.725 120-124 1.2149999999999999 125-129 2.42 130-134 5.1 135-139 7.1499999999999995 140-144 8.145 145-149 5.005 150-151 2.55 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46428571428572 97.475 2 0.35714285714285715 0.7000000000000001 3 0.05102040816326531 0.15 4 0.0 0.0 5 0.07653061224489796 0.375 6 0.025510204081632654 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025510204081632654 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 46 1.15 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.5125 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTACCT 10 0.006711778 145.8077 1 >>END_MODULE Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773503 spots for SRR7169988.sra Written 773503 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra Read 773490 spots for SRR7169988.sra Written 773490 spots for SRR7169988.sra SRR ids: ['SRR7169988.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ipwpe223 SRR7169988.sra spots: 15469813 blocks: [[1, 773490], [773491, 1546980], [1546981, 2320470], [2320471, 3093960], [3093961, 3867450], [3867451, 4640940], [4640941, 5414430], [5414431, 6187920], [6187921, 6961410], [6961411, 7734900], [7734901, 8508390], [8508391, 9281880], [9281881, 10055370], [10055371, 10828860], [10828861, 11602350], [11602351, 12375840], [12375841, 13149330], [13149331, 13922820], [13922821, 14696310], [14696311, 15469813]] SRR7169988 file size 5220511 SRR7169988 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169988 SRR7169988_1.fastq SRR7169988_2.fastq Input file: SRR7169988_1.fastq Paired file: SRR7169988_2.fastq trimmed: SRR7169988-trimmed-pair1.fastq, SRR7169988-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:11:24 2025 >> started Wed Feb 12 07:11:40 2025 >> done (16.070s) 15469813 read pairs processed; of these: 28234 ( 0.18%) short read pairs filtered out after trimming by size control 43043 ( 0.28%) empty read pairs filtered out after trimming by size control 15398536 (99.54%) read pairs available; of these: 7358992 (47.79%) trimmed read pairs available after processing 8039544 (52.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 0 0.00% 21 5 0.00% 22 7 0.00% 23 6 0.00% 24 6 0.00% 25 4 0.00% 26 4 0.00% 27 11 0.00% 28 9 0.00% 29 18 0.00% 30 9 0.00% 31 15 0.00% 32 15 0.00% 33 13 0.00% 34 14 0.00% 35 23 0.00% 36 17 0.00% 37 18 0.00% 38 27 0.00% 39 29 0.00% 40 26 0.00% 41 35 0.00% 42 39 0.00% 43 34 0.00% 44 54 0.00% 45 64 0.00% 46 64 0.00% 47 59 0.00% 48 104 0.00% 49 84 0.00% 50 99 0.00% 51 108 0.00% 52 107 0.00% 53 155 0.00% 54 160 0.00% 55 158 0.00% 56 192 0.00% 57 234 0.00% 58 251 0.00% 59 259 0.00% 60 290 0.00% 61 370 0.00% 62 417 0.00% 63 489 0.00% 64 512 0.00% 65 564 0.00% 66 638 0.00% 67 750 0.00% 68 902 0.01% 69 1076 0.01% 70 1485 0.01% 71 1656 0.01% 72 1700 0.01% 73 1791 0.01% 74 1923 0.01% 75 2037 0.01% 76 2288 0.01% 77 2434 0.02% 78 2724 0.02% 79 3043 0.02% 80 3380 0.02% 81 3758 0.02% 82 4314 0.03% 83 5064 0.03% 84 6551 0.04% 85 7818 0.05% 86 8054 0.05% 87 8710 0.06% 88 9395 0.06% 89 9425 0.06% 90 10157 0.07% 91 10896 0.07% 92 11538 0.07% 93 12385 0.08% 94 13837 0.09% 95 14497 0.09% 96 15472 0.10% 97 16226 0.11% 98 16597 0.11% 99 17366 0.11% 100 18021 0.12% 101 19102 0.12% 102 20209 0.13% 103 21275 0.14% 104 22269 0.14% 105 24135 0.16% 106 25045 0.16% 107 25720 0.17% 108 26752 0.17% 109 27556 0.18% 110 28043 0.18% 111 29051 0.19% 112 30546 0.20% 113 31951 0.21% 114 33561 0.22% 115 35105 0.23% 116 36896 0.24% 117 37747 0.25% 118 38386 0.25% 119 39472 0.26% 120 39848 0.26% 121 41170 0.27% 122 42847 0.28% 123 44263 0.29% 124 46533 0.30% 125 48009 0.31% 126 50419 0.33% 127 52040 0.34% 128 53951 0.35% 129 55114 0.36% 130 57311 0.37% 131 58763 0.38% 132 61533 0.40% 133 64003 0.42% 134 67196 0.44% 135 70966 0.46% 136 74896 0.49% 137 78720 0.51% 138 84735 0.55% 139 90854 0.59% 140 96332 0.63% 141 103807 0.67% 142 110779 0.72% 143 120144 0.78% 144 132362 0.86% 145 151693 0.99% 146 179917 1.17% 147 237143 1.54% 148 324196 2.11% 149 615925 4.00% 150 3297606 21.42% 151 8039544 52.21% 15398536 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=107.00 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=14.4 sequence=AGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGACAACG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=70.80 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.4 sequence=AGAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAA SRR7169988 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:12:25 Started mapping on | Feb 12 07:12:25 Finished on | Feb 12 07:14:12 Mapping speed, Million of reads per hour | 518.08 Number of input reads | 15398536 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14395059 Uniquely mapped reads % | 93.48% Average mapped length | 291.85 Number of splices: Total | 13278669 Number of splices: Annotated (sjdb) | 13057595 Number of splices: GT/AG | 13082453 Number of splices: GC/AG | 157512 Number of splices: AT/AC | 11758 Number of splices: Non-canonical | 26946 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271064 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 24950 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.55% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 754768 754768 754768 N_multimapping 271064 271064 271064 N_noFeature 276675 14207001 367534 N_ambiguous 153118 947 55283 UnstrandedReadsAssigned:13965266 PositiveStrandReadsAssigned:187111 NegativeStrandReadsAssigned:13972242 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169988 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169988-trimmed-pair1.fastq SRR7169988-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,398,536 reads, 13,910,745 reads pseudoaligned [quant] estimated average fragment length: 225.7 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7169988.ke.tsv 34699 SRR7169988.se.tsv 87100 total ==> SRR7169988.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.3 232 8.28323 Potri.005G024800.1.v4.1 1035 810.3 30 2.3705 Potri.004G059700.1.v4.1 961 736.305 1 0.0869575 Potri.007G009000.2.v4.1 1416 1191.3 0 0 Potri.003G141000.2.v4.1 2943 2718.3 207 4.87571 Potri.016G087400.1.v4.1 270 85.6198 1196.44 894.712 Potri.015G069301.1.v4.1 564 342.182 0 0 Potri.010G195200.1.v4.1 1773 1548.3 16 0.661652 Potri.012G127500.1.v4.1 977 752.3 9130 777.042 ==> SRR7169988.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 600 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 305 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169988 completed mapping pipeline successfully