Starting /dee2/code/volunteer_pipeline.sh SRR7169989 current disk space = 3049996398592 free memory = 1492303376 SRR7169989 SRAfilesize 7529bd2993444f457af71b50abbe874d SRR7169989.sra SRR7169989.sra file validated SRR7169989 is paired end SRR7169989 is conventional basespace SRR7169989 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169989_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9365 34.0 33.0 34.0 33.0 34.0 2 33.428 34.0 34.0 34.0 33.0 34.0 3 33.38625 34.0 34.0 34.0 33.0 34.0 4 33.459 34.0 34.0 34.0 33.0 34.0 5 33.43975 34.0 34.0 34.0 33.0 34.0 6 37.1315 38.0 37.0 38.0 36.0 38.0 7 37.399 38.0 38.0 38.0 37.0 38.0 8 37.51275 38.0 38.0 38.0 37.0 38.0 9 37.5965 38.0 38.0 38.0 38.0 38.0 10-14 37.52515 38.0 38.0 38.0 38.0 38.0 15-19 37.5188 38.0 38.0 38.0 38.0 38.0 20-24 37.453500000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.420249999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.414049999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.3368 38.0 38.0 38.0 37.2 38.0 40-44 37.17315 38.0 38.0 38.0 36.4 38.0 45-49 37.074200000000005 38.0 38.0 38.0 36.0 38.0 50-54 37.03810000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.00735 38.0 38.0 38.0 36.0 38.0 60-64 36.91195 38.0 38.0 38.0 35.8 38.0 65-69 36.9249 38.0 38.0 38.0 35.6 38.0 70-74 36.8208 38.0 38.0 38.0 35.2 38.0 75-79 36.62845 38.0 38.0 38.0 34.6 38.0 80-84 36.5627 38.0 38.0 38.0 34.2 38.0 85-89 36.436499999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.356449999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.123799999999996 38.0 38.0 38.0 33.6 38.0 100-104 36.0054 38.0 37.2 38.0 32.8 38.0 105-109 35.890150000000006 38.0 37.0 38.0 32.6 38.0 110-114 35.597449999999995 38.0 36.6 38.0 30.6 38.0 115-119 35.32834999999999 38.0 36.0 38.0 29.6 38.0 120-124 35.106100000000005 38.0 36.0 38.0 28.2 38.0 125-129 34.873850000000004 38.0 35.8 38.0 27.8 38.0 130-134 34.3525 38.0 35.0 38.0 24.8 38.0 135-139 34.02265 38.0 35.0 38.0 23.0 38.0 140-144 33.76970000000001 38.0 34.8 38.0 21.8 38.0 145-149 32.98605 38.0 34.0 38.0 14.4 38.0 150-151 29.235875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 3.0 15 1.0 16 6.0 17 3.0 18 9.0 19 9.0 20 9.0 21 9.0 22 8.0 23 11.0 24 13.0 25 18.0 26 24.0 27 27.0 28 25.0 29 38.0 30 45.0 31 66.0 32 61.0 33 100.0 34 160.0 35 268.0 36 735.0 37 2347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.691292206143686 12.261995430312261 9.317085554709317 34.72962680883473 2 24.25 13.425 31.574999999999996 30.75 3 19.525000000000002 18.55 25.95 35.975 4 22.55 26.125 23.0 28.325 5 22.825 29.525000000000002 24.125 23.525 6 20.674999999999997 33.0 24.575 21.75 7 15.25 29.45 37.974999999999994 17.325 8 16.525000000000002 27.425 30.975 25.074999999999996 9 17.549999999999997 27.0 31.775 23.674999999999997 10-14 19.46 29.765000000000004 27.279999999999998 23.494999999999997 15-19 20.265 28.535 27.555000000000003 23.645 20-24 19.965 28.935 27.279999999999998 23.82 25-29 19.765 29.325000000000003 27.439999999999998 23.47 30-34 20.3 29.080000000000002 26.325 24.295 35-39 20.485 28.294999999999998 26.945000000000004 24.275 40-44 20.095 29.494999999999997 26.88 23.53 45-49 20.119999999999997 27.91 27.339999999999996 24.63 50-54 20.205000000000002 29.23 26.779999999999998 23.785 55-59 20.27 28.625 27.165 23.94 60-64 20.455000000000002 29.110000000000003 26.584999999999997 23.849999999999998 65-69 20.26 28.52 27.855 23.365 70-74 20.244999999999997 28.575 26.845000000000002 24.335 75-79 20.155 28.46 27.089999999999996 24.295 80-84 20.22 28.084999999999997 27.465 24.23 85-89 20.380000000000003 28.084999999999997 27.325 24.21 90-94 20.78 28.155 27.279999999999998 23.785 95-99 20.46 28.17 26.99 24.38 100-104 20.735 28.475 26.685 24.104999999999997 105-109 21.105 28.09 27.115000000000002 23.69 110-114 21.13 27.700000000000003 26.56 24.610000000000003 115-119 20.974999999999998 27.91 26.779999999999998 24.335 120-124 20.95 28.810000000000002 26.46 23.78 125-129 20.935000000000002 27.715 26.87 24.48 130-134 21.61 27.955000000000002 26.595000000000002 23.84 135-139 21.435000000000002 27.889999999999997 26.884999999999998 23.79 140-144 21.16 28.64 25.745 24.455 145-149 21.205 27.58 26.69 24.525 150-151 21.6 27.1375 26.3125 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 0.5 24 1.0 25 4.0 26 7.5 27 8.5 28 11.0 29 16.5 30 19.5 31 27.0 32 34.5 33 37.5 34 51.0 35 61.0 36 67.5 37 92.0 38 119.5 39 145.5 40 178.5 41 199.5 42 207.5 43 234.0 44 271.0 45 273.0 46 259.0 47 257.0 48 237.0 49 227.5 50 198.5 51 150.0 52 128.5 53 110.0 54 92.0 55 65.0 56 41.5 57 37.0 58 31.5 59 22.5 60 17.5 61 10.5 62 9.0 63 7.0 64 5.0 65 4.5 66 4.0 67 3.5 68 1.5 69 2.5 70 2.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52201257861634 98.9 2 0.4528301886792453 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025157232704402514 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATGC 8 0.2 TruSeq Adapter, Index 27 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0125 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0125 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.1125 0.025 0.0 0.0 0.0 84-85 0.15 0.025 0.0 0.0 0.0 86-87 0.16249999999999998 0.025 0.0 0.0 0.0 88-89 0.25 0.025 0.0 0.0 0.0 90-91 0.3375 0.025 0.0 0.0 0.0 92-93 0.3875 0.025 0.0 0.0 0.0 94-95 0.475 0.025 0.0 0.0 0.0 96-97 0.675 0.025 0.0 0.0 0.0 98-99 0.825 0.025 0.0 0.0 0.0 100-101 0.975 0.025 0.0 0.0 0.0 102-103 1.2125 0.025 0.0 0.0 0.0 104-105 1.3375 0.025 0.0 0.0 0.0 106-107 1.525 0.025 0.0 0.0 0.0 108-109 1.8125 0.025 0.0 0.0 0.0 110-111 2.0875 0.025 0.0 0.0 0.0 112-113 2.3625 0.025 0.0 0.0 0.0 114-115 2.7 0.025 0.0 0.0 0.0 116-117 3.1 0.025 0.0 0.0 0.0 118-119 3.5875 0.025 0.0 0.0 0.0 120-121 4.199999999999999 0.025 0.0 0.0 0.0 122-123 4.775 0.025 0.0 0.0 0.0 124-125 5.2625 0.025 0.0 0.0 0.0 126-127 5.8375 0.025 0.0 0.0 0.0 128-129 6.425000000000001 0.025 0.0 0.0 0.0 130-131 7.0375 0.025 0.0 0.0 0.0 132-133 7.574999999999999 0.025 0.0 0.0 0.0 134-135 8.2875 0.025 0.0 0.0 0.0 136-137 8.8 0.025 0.0 0.0 0.0 138-139 9.45 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAGA 10 0.006832588 144.9875 4 >>END_MODULE SRR7169989 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169989_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9185 33.0 33.0 34.0 32.0 34.0 2 32.337 33.0 33.0 34.0 31.0 34.0 3 32.37225 34.0 33.0 34.0 31.0 34.0 4 32.0775 34.0 33.0 34.0 32.0 34.0 5 32.08575 34.0 33.0 34.0 32.0 34.0 6 36.431 38.0 38.0 38.0 36.0 38.0 7 36.445 38.0 38.0 38.0 35.0 38.0 8 36.4335 38.0 38.0 38.0 36.0 38.0 9 36.48825 38.0 38.0 38.0 36.0 38.0 10-14 36.42655 38.0 38.0 38.0 35.8 38.0 15-19 36.19935 38.0 38.0 38.0 35.8 38.0 20-24 36.3896 38.0 38.0 38.0 36.0 38.0 25-29 36.411500000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.484300000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.32755 38.0 38.0 38.0 36.0 38.0 40-44 36.1592 38.0 38.0 38.0 35.4 38.0 45-49 36.080349999999996 38.0 38.0 38.0 35.0 38.0 50-54 36.289649999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.247749999999996 38.0 38.0 38.0 35.4 38.0 60-64 36.1686 38.0 38.0 38.0 35.4 38.0 65-69 36.1286 38.0 38.0 38.0 35.0 38.0 70-74 36.036649999999995 38.0 38.0 38.0 34.6 38.0 75-79 35.95145 38.0 38.0 38.0 34.0 38.0 80-84 35.85105 38.0 38.0 38.0 34.0 38.0 85-89 35.3481 38.0 38.0 38.0 31.6 38.0 90-94 35.06495 38.0 38.0 38.0 29.2 38.0 95-99 35.31685 38.0 38.0 38.0 29.8 38.0 100-104 35.456300000000006 38.0 38.0 38.0 32.0 38.0 105-109 35.27665 38.0 38.0 38.0 31.0 38.0 110-114 35.126850000000005 38.0 37.8 38.0 29.8 38.0 115-119 34.9246 38.0 37.2 38.0 28.0 38.0 120-124 34.67649999999999 38.0 36.8 38.0 26.6 38.0 125-129 34.23535 38.0 36.2 38.0 23.8 38.0 130-134 33.17845 38.0 35.2 38.0 14.2 38.0 135-139 32.1969 38.0 34.6 38.0 4.2 38.0 140-144 31.3716 38.0 33.0 38.0 2.0 38.0 145-149 30.8935 38.0 32.2 38.0 2.0 38.0 150-151 26.948999999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 62.0 3 9.0 4 3.0 5 0.0 6 3.0 7 4.0 8 3.0 9 4.0 10 6.0 11 5.0 12 4.0 13 2.0 14 9.0 15 6.0 16 6.0 17 13.0 18 6.0 19 9.0 20 12.0 21 13.0 22 12.0 23 20.0 24 18.0 25 25.0 26 24.0 27 23.0 28 40.0 29 46.0 30 56.0 31 64.0 32 87.0 33 152.0 34 121.0 35 192.0 36 450.0 37 2491.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.20659453889748 21.32921174652241 14.45131375579598 25.012879958784133 2 27.832450164017157 27.32778198334595 26.8483472117083 17.99142064092859 3 21.966050164682038 30.42817329617431 27.995946288320244 19.60983025082341 4 23.950870010235413 34.03275332650972 22.59467758444217 19.421699078812694 5 25.34562211981567 36.098310291858674 21.044546850998465 17.51152073732719 6 22.574106916645555 35.82467696985052 23.916898910564985 17.68431720293894 7 20.481622306717366 22.9404309252218 35.81749049429658 20.76045627376426 8 22.49493927125506 27.201417004048583 25.253036437246962 25.050607287449395 9 21.45933620471244 25.183683810488976 30.250823410184953 23.10615657461363 10-14 24.838726062884138 28.333417991568037 25.08254177883883 21.745314166708994 15-19 23.534821930407233 28.32762761228348 26.845843339635174 21.29170711767411 20-24 24.515932306754078 27.300909691518015 27.33140214463587 20.851755857092037 25-29 24.16746920776522 27.99939175832531 26.59029854528866 21.24284048862081 30-34 23.999594258761476 28.406958462240706 27.017294720292135 20.576152558705687 35-39 24.313326551373347 27.995930824008138 26.810783316378433 20.879959308240082 40-44 24.479273024300593 28.119256687768022 26.669389422095158 20.732080865836224 45-49 24.046561494869046 27.88073722366876 26.808597539184152 21.264103742278042 50-54 24.666497590667007 28.450418463099165 26.517879786964237 20.36520415926959 55-59 24.479536914796384 27.383974814664363 26.94221590332081 21.194272367218442 60-64 23.924854023863926 27.595836506727593 27.956334094947955 20.522975374460522 65-69 24.049540632455205 27.663570377138218 27.409776153494747 20.87711283691183 70-74 24.124513618677042 27.56076608216686 27.227247460710498 21.0874728384456 75-79 24.73096549285101 27.661294397009044 27.090385489819635 20.517354620320315 80-84 24.237202230106437 27.567156614292955 27.430309173846933 20.765331981753672 85-89 23.848363599056118 27.439212065250846 27.80855647891659 20.903867856776444 90-94 24.228028503562946 27.992357740369723 27.49147991325003 20.288133842817306 95-99 24.32143946325099 27.274575581986376 27.42197824540002 20.98200670936261 100-104 24.885867911129147 27.254742822359745 26.990970883635995 20.868418382875113 105-109 24.355199025182777 27.208570268074734 28.020917952883835 20.415312753858654 110-114 24.48314492310826 27.344943476932475 26.98849169976576 21.183419900193503 115-119 24.64531820024321 27.7766518038103 27.391568706931498 20.186461289014996 120-124 25.454361873990305 28.175484652665588 26.342891760904685 20.02726171243942 125-129 25.103279441015964 27.63298821849339 26.898556637935435 20.36517570255521 130-134 25.25532917823286 27.915990153459386 26.423296496098047 20.405384172209708 135-139 25.47927599871479 27.567741244511083 26.67344971618293 20.279533040591197 140-144 26.202483596334254 27.048424705818558 26.891166422645192 19.857925275201996 145-149 26.028257456828886 28.00627943485086 26.582940868655154 19.382522239665096 150-151 27.241335209106023 27.177388412840514 26.26934390587032 19.311932472183145 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 37.0 1 19.5 2 2.0 3 1.5 4 2.5 5 2.0 6 1.0 7 2.5 8 2.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 1.5 18 2.0 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 3.0 26 3.5 27 3.0 28 3.0 29 5.5 30 10.5 31 12.0 32 14.5 33 26.5 34 32.5 35 36.0 36 53.0 37 79.0 38 104.0 39 133.0 40 169.5 41 193.5 42 240.5 43 274.5 44 279.5 45 296.5 46 287.0 47 277.0 48 271.5 49 241.5 50 187.0 51 144.0 52 117.5 53 98.5 54 90.5 55 70.0 56 46.5 57 30.5 58 21.0 59 18.0 60 15.0 61 10.0 62 10.5 63 10.0 64 5.5 65 2.5 66 0.5 67 1.0 68 1.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.9499999999999997 2 0.9249999999999999 3 1.325 4 2.3 5 2.35 6 1.325 7 1.375 8 1.2 9 1.325 10-14 1.5650000000000002 15-19 2.145 20-24 1.6150000000000002 25-29 1.355 30-34 1.415 35-39 1.7000000000000002 40-44 2.06 45-49 2.0650000000000004 50-54 1.425 55-59 1.53 60-64 1.525 65-69 1.4949999999999999 70-74 1.055 75-79 1.035 80-84 1.35 85-89 2.53 90-94 3.17 95-99 1.63 100-104 1.43 105-109 1.52 110-114 1.81 115-119 1.32 120-124 0.96 125-129 1.965 130-134 4.535 135-139 6.63 140-144 7.795000000000001 145-149 4.45 150-151 2.2624999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44063056191203 97.775 2 0.43224002034070685 0.8500000000000001 3 0.05085176709890668 0.15 4 0.0 0.0 5 0.02542588354945334 0.125 6 0.0 0.0 7 0.02542588354945334 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02542588354945334 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 37 0.9249999999999999 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.225 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.2875 0.0 0.0 0.0 0.0 122-123 4.8 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.85 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 7.9875 0.0 0.0 0.0 0.0 136-137 8.5125 0.0 0.0 0.0 0.0 138-139 9.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680694 spots for SRR7169989.sra Written 680694 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra Read 680693 spots for SRR7169989.sra Written 680693 spots for SRR7169989.sra SRR ids: ['SRR7169989.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d5ebyj4t SRR7169989.sra spots: 13613861 blocks: [[1, 680693], [680694, 1361386], [1361387, 2042079], [2042080, 2722772], [2722773, 3403465], [3403466, 4084158], [4084159, 4764851], [4764852, 5445544], [5445545, 6126237], [6126238, 6806930], [6806931, 7487623], [7487624, 8168316], [8168317, 8849009], [8849010, 9529702], [9529703, 10210395], [10210396, 10891088], [10891089, 11571781], [11571782, 12252474], [12252475, 12933167], [12933168, 13613861]] SRR7169989 file size 4591590 SRR7169989 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169989 SRR7169989_1.fastq SRR7169989_2.fastq Input file: SRR7169989_1.fastq Paired file: SRR7169989_2.fastq trimmed: SRR7169989-trimmed-pair1.fastq, SRR7169989-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:19:51 2025 >> started Wed Feb 12 07:20:06 2025 >> done (14.166s) 13613861 read pairs processed; of these: 29551 ( 0.22%) short read pairs filtered out after trimming by size control 61824 ( 0.45%) empty read pairs filtered out after trimming by size control 13522486 (99.33%) read pairs available; of these: 6621236 (48.96%) trimmed read pairs available after processing 6901250 (51.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 6 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 6 0.00% 25 7 0.00% 26 2 0.00% 27 7 0.00% 28 9 0.00% 29 10 0.00% 30 9 0.00% 31 14 0.00% 32 5 0.00% 33 11 0.00% 34 15 0.00% 35 13 0.00% 36 16 0.00% 37 15 0.00% 38 19 0.00% 39 27 0.00% 40 26 0.00% 41 32 0.00% 42 30 0.00% 43 39 0.00% 44 54 0.00% 45 45 0.00% 46 60 0.00% 47 63 0.00% 48 93 0.00% 49 78 0.00% 50 95 0.00% 51 85 0.00% 52 135 0.00% 53 150 0.00% 54 157 0.00% 55 164 0.00% 56 184 0.00% 57 191 0.00% 58 209 0.00% 59 220 0.00% 60 289 0.00% 61 320 0.00% 62 408 0.00% 63 437 0.00% 64 484 0.00% 65 543 0.00% 66 631 0.00% 67 792 0.01% 68 953 0.01% 69 1431 0.01% 70 1856 0.01% 71 1348 0.01% 72 1308 0.01% 73 1481 0.01% 74 1605 0.01% 75 1767 0.01% 76 1934 0.01% 77 2138 0.02% 78 2374 0.02% 79 2661 0.02% 80 2932 0.02% 81 3376 0.02% 82 3766 0.03% 83 4503 0.03% 84 6185 0.05% 85 7130 0.05% 86 7368 0.05% 87 7931 0.06% 88 8575 0.06% 89 8982 0.07% 90 9361 0.07% 91 9924 0.07% 92 10505 0.08% 93 11490 0.08% 94 12664 0.09% 95 13470 0.10% 96 14199 0.11% 97 14821 0.11% 98 15643 0.12% 99 16163 0.12% 100 16934 0.13% 101 17996 0.13% 102 19014 0.14% 103 20404 0.15% 104 21322 0.16% 105 22885 0.17% 106 23907 0.18% 107 24706 0.18% 108 25533 0.19% 109 26644 0.20% 110 26669 0.20% 111 28403 0.21% 112 29480 0.22% 113 30962 0.23% 114 32612 0.24% 115 34267 0.25% 116 35281 0.26% 117 36270 0.27% 118 37436 0.28% 119 37853 0.28% 120 38765 0.29% 121 39896 0.30% 122 41096 0.30% 123 42592 0.31% 124 45011 0.33% 125 46534 0.34% 126 48364 0.36% 127 50029 0.37% 128 51713 0.38% 129 53340 0.39% 130 54835 0.41% 131 56328 0.42% 132 58637 0.43% 133 61393 0.45% 134 63980 0.47% 135 67069 0.50% 136 70517 0.52% 137 74715 0.55% 138 79000 0.58% 139 84105 0.62% 140 89274 0.66% 141 95169 0.70% 142 101405 0.75% 143 109403 0.81% 144 121102 0.90% 145 137119 1.01% 146 161158 1.19% 147 211776 1.57% 148 287467 2.13% 149 542576 4.01% 150 2872224 21.24% 151 6901250 51.04% 13522486 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=235.47 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=16.4 sequence=GAAAACAAAGATGCATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGACAACGG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=42 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=41 fanout-score=124.01 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=13.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAA SRR7169989 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:20:50 Started mapping on | Feb 12 07:20:50 Finished on | Feb 12 07:22:08 Mapping speed, Million of reads per hour | 624.11 Number of input reads | 13522486 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12768844 Uniquely mapped reads % | 94.43% Average mapped length | 291.26 Number of splices: Total | 11562322 Number of splices: Annotated (sjdb) | 11363007 Number of splices: GT/AG | 11387764 Number of splices: GC/AG | 138731 Number of splices: AT/AC | 10448 Number of splices: Non-canonical | 25379 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244393 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 27937 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 532045 532045 532045 N_multimapping 244393 244393 244393 N_noFeature 247222 12612119 316298 N_ambiguous 136615 499 48693 UnstrandedReadsAssigned:12385007 PositiveStrandReadsAssigned:156226 NegativeStrandReadsAssigned:12403853 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169989 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169989-trimmed-pair1.fastq SRR7169989-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,522,486 reads, 12,360,461 reads pseudoaligned [quant] estimated average fragment length: 223.247 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR7169989.ke.tsv 34699 SRR7169989.se.tsv 87100 total ==> SRR7169989.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.75 235 9.14201 Potri.005G024800.1.v4.1 1035 812.753 39 3.35217 Potri.004G059700.1.v4.1 961 738.778 11 1.04016 Potri.007G009000.2.v4.1 1416 1193.75 0 0 Potri.003G141000.2.v4.1 2943 2720.75 179 4.59605 Potri.016G087400.1.v4.1 270 88.1542 1689 1338.46 Potri.015G069301.1.v4.1 564 344.767 0 0 Potri.010G195200.1.v4.1 1773 1550.75 17 0.76582 Potri.012G127500.1.v4.1 977 754.758 8081 747.959 ==> SRR7169989.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 812 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169989 completed mapping pipeline successfully