Starting /dee2/code/volunteer_pipeline.sh SRR7169990 current disk space = 3049705873408 free memory = 1398975440 SRR7169990 SRAfilesize 68b40f8bba20e8c64a542c1c4f4040ba SRR7169990.sra SRR7169990.sra file validated SRR7169990 is paired end SRR7169990 is conventional basespace SRR7169990 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169990_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.831 34.0 33.0 34.0 33.0 34.0 2 33.3095 34.0 33.0 34.0 33.0 34.0 3 33.3165 34.0 33.0 34.0 33.0 34.0 4 33.39275 34.0 34.0 34.0 33.0 34.0 5 33.43725 34.0 33.0 34.0 33.0 34.0 6 36.99425 38.0 37.0 38.0 36.0 38.0 7 37.29225 38.0 38.0 38.0 37.0 38.0 8 37.37625 38.0 38.0 38.0 37.0 38.0 9 37.46925 38.0 38.0 38.0 37.0 38.0 10-14 37.4577 38.0 38.0 38.0 37.0 38.0 15-19 37.4037 38.0 38.0 38.0 37.0 38.0 20-24 37.3517 38.0 38.0 38.0 37.0 38.0 25-29 37.2707 38.0 38.0 38.0 37.0 38.0 30-34 37.2392 38.0 38.0 38.0 37.0 38.0 35-39 37.21745 38.0 38.0 38.0 36.6 38.0 40-44 36.99385 38.0 38.0 38.0 36.0 38.0 45-49 36.8997 38.0 38.0 38.0 35.6 38.0 50-54 36.7961 38.0 38.0 38.0 35.0 38.0 55-59 36.72275 38.0 38.0 38.0 34.6 38.0 60-64 36.70725 38.0 38.0 38.0 35.0 38.0 65-69 36.7129 38.0 38.0 38.0 34.6 38.0 70-74 36.512350000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.44075 38.0 38.0 38.0 34.0 38.0 80-84 36.326649999999994 38.0 37.8 38.0 33.8 38.0 85-89 36.2087 38.0 37.2 38.0 33.2 38.0 90-94 36.149150000000006 38.0 37.2 38.0 33.4 38.0 95-99 36.0878 38.0 37.0 38.0 33.2 38.0 100-104 35.84105000000001 38.0 37.0 38.0 31.6 38.0 105-109 35.71605000000001 38.0 37.0 38.0 31.0 38.0 110-114 35.394400000000005 38.0 36.6 38.0 29.4 38.0 115-119 35.04745 38.0 36.0 38.0 27.8 38.0 120-124 34.9535 38.0 35.8 38.0 27.6 38.0 125-129 34.668150000000004 38.0 35.0 38.0 26.8 38.0 130-134 34.150999999999996 38.0 34.6 38.0 23.8 38.0 135-139 33.57555 38.0 34.0 38.0 19.8 38.0 140-144 33.2221 38.0 34.0 38.0 16.2 38.0 145-149 32.46945 38.0 33.8 38.0 11.8 38.0 150-151 28.6155 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 3.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 3.0 19 7.0 20 4.0 21 10.0 22 12.0 23 14.0 24 14.0 25 24.0 26 28.0 27 29.0 28 44.0 29 71.0 30 65.0 31 65.0 32 91.0 33 126.0 34 185.0 35 289.0 36 701.0 37 2206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.06280193236715 12.356979405034325 10.094075769132978 36.48614289346555 2 24.0 14.725 34.599999999999994 26.674999999999997 3 20.325 21.875 25.174999999999997 32.625 4 22.275 28.375 23.549999999999997 25.8 5 22.45 33.6 23.549999999999997 20.4 6 19.3 34.25 25.874999999999996 20.575 7 15.475 26.025 40.550000000000004 17.95 8 17.075000000000003 25.825 31.175000000000004 25.924999999999997 9 18.3 24.85 32.175 24.675 10-14 20.435 29.439999999999998 26.685 23.44 15-19 20.175 28.610000000000003 27.500000000000004 23.715 20-24 20.65 27.744999999999997 27.615000000000002 23.990000000000002 25-29 19.96 28.645 27.21 24.185000000000002 30-34 20.16 28.785 26.855 24.2 35-39 20.044999999999998 28.775000000000002 26.919999999999998 24.26 40-44 20.49 28.255000000000003 27.33 23.925 45-49 20.4 28.144999999999996 27.33 24.125 50-54 19.835 28.215 27.650000000000002 24.3 55-59 20.93 27.744999999999997 26.729999999999997 24.595 60-64 20.21 28.49 27.115000000000002 24.185000000000002 65-69 20.575 27.950000000000003 27.22 24.255 70-74 20.200000000000003 28.26 27.58 23.96 75-79 20.175 28.000000000000004 26.965 24.86 80-84 20.32 27.985 27.48 24.215 85-89 20.36 28.095 27.884999999999998 23.66 90-94 20.53 28.425 26.490000000000002 24.555 95-99 20.4 28.305000000000003 27.310000000000002 23.985 100-104 20.87 28.410000000000004 26.634999999999998 24.085 105-109 20.424999999999997 27.98 26.865 24.73 110-114 21.17 28.765 26.815 23.25 115-119 20.655 28.43 26.700000000000003 24.215 120-124 20.82 27.985 26.855 24.34 125-129 20.849999999999998 27.855 26.650000000000002 24.645 130-134 20.71 27.815 26.875 24.6 135-139 21.22 27.794999999999998 27.005000000000003 23.98 140-144 20.990000000000002 28.744999999999997 26.245 24.02 145-149 20.849999999999998 27.815 26.650000000000002 24.685000000000002 150-151 20.6125 27.6875 27.6 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.0 25 1.5 26 3.5 27 6.5 28 7.0 29 7.5 30 12.5 31 20.5 32 24.5 33 26.5 34 39.0 35 62.0 36 78.0 37 88.5 38 118.0 39 142.0 40 160.0 41 203.0 42 244.0 43 270.0 44 274.0 45 265.5 46 275.5 47 279.5 48 253.5 49 212.0 50 180.5 51 161.5 52 138.5 53 113.0 54 82.5 55 57.5 56 49.0 57 38.5 58 27.5 59 22.0 60 12.5 61 7.0 62 8.0 63 8.5 64 6.5 65 4.5 66 2.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.8375 0.0 0.0 0.0 0.0 120-121 4.175000000000001 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.112500000000001 0.0 0.0 0.0 0.0 128-129 5.5125 0.0 0.0 0.0 0.0 130-131 5.862500000000001 0.0 0.0 0.0 0.0 132-133 6.4 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.6 0.0 0.0 0.0 0.0 138-139 8.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGCT 10 0.0060887975 150.61038 1 CAGGTAT 10 0.006836113 144.9625 2 TCTTAAC 10 0.006836113 144.9625 7 >>END_MODULE SRR7169990 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169990_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5265 33.0 33.0 34.0 30.0 34.0 2 31.9535 33.0 33.0 34.0 30.0 34.0 3 31.99 33.0 33.0 34.0 31.0 34.0 4 31.73575 34.0 33.0 34.0 31.0 34.0 5 31.7005 34.0 33.0 34.0 31.0 34.0 6 36.00325 38.0 38.0 38.0 34.0 38.0 7 35.9985 38.0 38.0 38.0 34.0 38.0 8 36.02325 38.0 38.0 38.0 34.0 38.0 9 36.0975 38.0 38.0 38.0 34.0 38.0 10-14 36.031600000000005 38.0 38.0 38.0 34.6 38.0 15-19 35.7745 38.0 38.0 38.0 34.2 38.0 20-24 35.925749999999994 38.0 38.0 38.0 34.0 38.0 25-29 35.93545 38.0 38.0 38.0 34.2 38.0 30-34 35.98885 38.0 38.0 38.0 34.8 38.0 35-39 35.83829999999999 38.0 38.0 38.0 34.2 38.0 40-44 35.71925 38.0 38.0 38.0 33.8 38.0 45-49 35.6759 38.0 38.0 38.0 33.6 38.0 50-54 35.83175 38.0 38.0 38.0 34.0 38.0 55-59 35.80595 38.0 38.0 38.0 33.8 38.0 60-64 35.71065 38.0 38.0 38.0 33.6 38.0 65-69 35.65495 38.0 38.0 38.0 33.0 38.0 70-74 35.577749999999995 38.0 38.0 38.0 33.0 38.0 75-79 35.458349999999996 38.0 38.0 38.0 31.6 38.0 80-84 35.49965 38.0 38.0 38.0 32.6 38.0 85-89 35.0262 38.0 38.0 38.0 28.6 38.0 90-94 34.7021 38.0 37.6 38.0 27.4 38.0 95-99 34.9053 38.0 37.2 38.0 27.6 38.0 100-104 35.058049999999994 38.0 37.6 38.0 29.0 38.0 105-109 34.8975 38.0 37.2 38.0 28.4 38.0 110-114 34.647400000000005 38.0 37.0 38.0 26.6 38.0 115-119 34.412850000000006 38.0 36.4 38.0 24.6 38.0 120-124 34.1372 38.0 36.0 38.0 23.0 38.0 125-129 33.59785 38.0 35.4 38.0 17.8 38.0 130-134 32.54445 38.0 35.0 38.0 11.2 38.0 135-139 31.60655 38.0 33.8 38.0 2.0 38.0 140-144 30.74815 38.0 32.4 38.0 2.0 38.0 145-149 30.1458 38.0 31.0 38.0 2.0 38.0 150-151 26.25075 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 93.0 3 17.0 4 1.0 5 2.0 6 3.0 7 4.0 8 0.0 9 2.0 10 2.0 11 2.0 12 3.0 13 1.0 14 3.0 15 6.0 16 12.0 17 9.0 18 5.0 19 15.0 20 9.0 21 10.0 22 16.0 23 28.0 24 39.0 25 18.0 26 38.0 27 38.0 28 40.0 29 47.0 30 71.0 31 75.0 32 98.0 33 143.0 34 145.0 35 208.0 36 473.0 37 2324.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.320413436692505 21.627906976744185 13.927648578811368 26.124031007751935 2 26.440849342770473 26.061678463094033 29.625884732052576 17.87158746208291 3 19.614311088556207 29.637147931996953 30.93123572697285 19.81730525247399 4 24.211336240061556 34.64991023339318 22.77507053090536 18.363682995639905 5 24.434737923946557 36.27954779033916 21.068859198355604 18.216855087358685 6 20.650241300482598 35.61087122174244 24.688849377698755 19.0500381000762 7 21.443089430894307 21.41768292682927 37.06808943089431 20.071138211382113 8 21.799746514575414 25.069708491761723 28.13688212927757 24.993662864385296 9 22.219400711020825 24.454037582529203 29.735906551549007 23.590655154900965 10-14 23.556076194356727 28.613629418355913 26.219822756442905 21.61047163084445 15-19 23.46102632387586 27.716890300112667 27.496671105193077 21.325412270818394 20-24 23.027924989808398 28.16449245821443 27.48165511618426 21.325927435792906 25-29 23.78048780487805 27.479674796747965 27.997967479674795 20.741869918699187 30-34 24.118455197679744 27.313896097287948 27.49198595634254 21.075662748689766 35-39 23.72138085768191 27.87721176890521 27.65284789148947 20.748559481923408 40-44 23.374098142557436 27.805352300056285 28.040730696413036 20.77981886097324 45-49 23.36472515098782 27.428600675606514 28.488074521445387 20.718599651960282 50-54 23.74192235282145 27.99572584338269 27.532692209840736 20.729659593955123 55-59 23.745734222991903 27.239851270819536 27.942749452452503 21.07166505373606 60-64 23.837416594509246 27.44358987419141 27.912188661946725 20.80680486935262 65-69 23.934843471621278 27.59480783914482 28.119114278442353 20.351234410791548 70-74 24.16097190584662 27.638572513287773 26.919767147557582 21.280688433308022 75-79 24.347165991902834 27.21153846153846 27.661943319838056 20.779352226720647 80-84 23.951031189677945 27.948796098750385 27.247790307832975 20.852382403738698 85-89 24.27608908090315 27.608908090315282 27.598621611891165 20.516381216890398 90-94 23.70355035710589 27.321188282786462 28.221716178449434 20.753545181658215 95-99 24.52868643635993 26.877611331906653 27.886477122184854 20.707225109548556 100-104 24.11618088407345 27.249605778523833 27.529375858385475 21.104837479017245 105-109 24.004278292757462 27.340328002444743 27.304675562799225 21.350718141998573 110-114 24.267782426778243 27.400755179099907 27.967139504031024 20.364322890090826 115-119 24.766450040617386 28.01076360682372 27.13748984565394 20.085296506904957 120-124 25.044252263187172 27.335255145906036 27.213877509735497 20.406615081171296 125-129 24.979545919410924 28.042544487625282 26.861321333606053 20.116588259357744 130-134 25.271439811172304 27.61605035405193 27.17020718594283 19.94230264883294 135-139 25.55531709410881 27.417104839575064 26.99860500053654 20.02897306577959 140-144 26.03849499782514 28.088299260548066 26.462592431491956 19.410613310134842 145-149 25.584565376952924 27.817972108629547 27.08398867568418 19.513473838733354 150-151 25.912642500320228 27.693095939541436 26.386576149609326 20.007685410529014 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 45.0 1 23.0 2 1.0 3 2.0 4 1.5 5 1.5 6 3.0 7 3.0 8 2.0 9 1.0 10 1.0 11 1.5 12 1.5 13 1.5 14 1.5 15 0.5 16 0.0 17 1.0 18 1.5 19 1.5 20 1.0 21 1.0 22 1.0 23 1.0 24 3.0 25 3.0 26 3.0 27 2.5 28 2.5 29 3.5 30 6.0 31 11.5 32 18.0 33 30.0 34 39.0 35 48.0 36 60.5 37 83.5 38 120.0 39 161.5 40 193.5 41 227.0 42 251.5 43 268.5 44 276.0 45 266.5 46 269.5 47 267.5 48 261.0 49 233.5 50 179.5 51 138.5 52 116.5 53 99.0 54 77.5 55 51.0 56 35.0 57 25.5 58 23.5 59 22.5 60 12.0 61 8.0 62 9.0 63 5.0 64 2.0 65 2.0 66 0.5 67 1.0 68 1.0 69 0.0 70 0.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.25 2 1.0999999999999999 3 1.4749999999999999 4 2.5250000000000004 5 2.7 6 1.575 7 1.6 8 1.375 9 1.55 10-14 1.83 15-19 2.37 20-24 1.8800000000000001 25-29 1.6 30-34 1.735 35-39 1.9449999999999998 40-44 2.2849999999999997 45-49 2.31 50-54 1.735 55-59 1.8350000000000002 60-64 1.8350000000000002 65-69 1.775 70-74 1.225 75-79 1.2 80-84 1.5699999999999998 85-89 2.785 90-94 3.39 95-99 1.87 100-104 1.7049999999999998 105-109 1.83 110-114 2.01 115-119 1.52 120-124 1.135 125-129 2.22 130-134 4.675 135-139 6.81 140-144 8.04 145-149 4.63 150-151 2.4125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.61899923799848 98.05 2 0.27940055880111764 0.5499999999999999 3 0.025400050800101596 0.075 4 0.025400050800101596 0.1 5 0.025400050800101596 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025400050800101596 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 44 1.0999999999999999 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.2125 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.025 0.0 0.0 0.0 0.0 128-129 5.3875 0.0 0.0 0.0 0.0 130-131 5.737500000000001 0.0 0.0 0.0 0.0 132-133 6.275 0.0 0.0 0.0 0.0 134-135 6.800000000000001 0.0 0.0 0.0 0.0 136-137 7.3875 0.0 0.0 0.0 0.0 138-139 7.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATGG 10 0.0069520934 144.07793 7 GGCCATT 10 0.0069520934 144.07793 4 >>END_MODULE Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791941 spots for SRR7169990.sra Written 791941 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra Read 791927 spots for SRR7169990.sra Written 791927 spots for SRR7169990.sra SRR ids: ['SRR7169990.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9t1jeuvn SRR7169990.sra spots: 15838554 blocks: [[1, 791927], [791928, 1583854], [1583855, 2375781], [2375782, 3167708], [3167709, 3959635], [3959636, 4751562], [4751563, 5543489], [5543490, 6335416], [6335417, 7127343], [7127344, 7919270], [7919271, 8711197], [8711198, 9503124], [9503125, 10295051], [10295052, 11086978], [11086979, 11878905], [11878906, 12670832], [12670833, 13462759], [13462760, 14254686], [14254687, 15046613], [15046614, 15838554]] SRR7169990 file size 5345465 SRR7169990 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169990 SRR7169990_1.fastq SRR7169990_2.fastq Input file: SRR7169990_1.fastq Paired file: SRR7169990_2.fastq trimmed: SRR7169990-trimmed-pair1.fastq, SRR7169990-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:54:55 2025 >> started Wed Feb 12 07:55:14 2025 >> done (19.136s) 15838554 read pairs processed; of these: 38530 ( 0.24%) short read pairs filtered out after trimming by size control 57058 ( 0.36%) empty read pairs filtered out after trimming by size control 15742966 (99.40%) read pairs available; of these: 7724521 (49.07%) trimmed read pairs available after processing 8018445 (50.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 6 0.00% 22 8 0.00% 23 12 0.00% 24 5 0.00% 25 5 0.00% 26 8 0.00% 27 7 0.00% 28 8 0.00% 29 11 0.00% 30 8 0.00% 31 16 0.00% 32 10 0.00% 33 10 0.00% 34 21 0.00% 35 20 0.00% 36 25 0.00% 37 31 0.00% 38 26 0.00% 39 26 0.00% 40 27 0.00% 41 37 0.00% 42 45 0.00% 43 50 0.00% 44 42 0.00% 45 55 0.00% 46 66 0.00% 47 62 0.00% 48 91 0.00% 49 87 0.00% 50 127 0.00% 51 142 0.00% 52 136 0.00% 53 200 0.00% 54 167 0.00% 55 191 0.00% 56 221 0.00% 57 240 0.00% 58 258 0.00% 59 302 0.00% 60 328 0.00% 61 424 0.00% 62 499 0.00% 63 556 0.00% 64 605 0.00% 65 624 0.00% 66 767 0.00% 67 925 0.01% 68 1019 0.01% 69 1287 0.01% 70 1693 0.01% 71 1512 0.01% 72 1692 0.01% 73 1843 0.01% 74 2116 0.01% 75 2270 0.01% 76 2422 0.02% 77 2652 0.02% 78 2982 0.02% 79 3335 0.02% 80 3689 0.02% 81 4281 0.03% 82 4840 0.03% 83 5589 0.04% 84 7737 0.05% 85 8890 0.06% 86 8968 0.06% 87 9662 0.06% 88 10210 0.06% 89 10226 0.06% 90 10948 0.07% 91 11851 0.08% 92 12706 0.08% 93 13924 0.09% 94 14814 0.09% 95 15646 0.10% 96 16490 0.10% 97 17087 0.11% 98 17812 0.11% 99 18254 0.12% 100 18925 0.12% 101 20144 0.13% 102 21208 0.13% 103 22914 0.15% 104 23969 0.15% 105 25279 0.16% 106 26527 0.17% 107 26955 0.17% 108 27703 0.18% 109 28432 0.18% 110 29082 0.18% 111 30202 0.19% 112 32014 0.20% 113 33560 0.21% 114 35145 0.22% 115 37295 0.24% 116 38386 0.24% 117 39096 0.25% 118 39809 0.25% 119 40400 0.26% 120 41296 0.26% 121 42810 0.27% 122 44775 0.28% 123 46432 0.29% 124 48588 0.31% 125 51034 0.32% 126 53437 0.34% 127 54163 0.34% 128 55669 0.35% 129 56986 0.36% 130 59113 0.38% 131 61479 0.39% 132 64183 0.41% 133 67216 0.43% 134 70863 0.45% 135 75028 0.48% 136 79353 0.50% 137 83491 0.53% 138 89730 0.57% 139 95021 0.60% 140 101099 0.64% 141 108767 0.69% 142 117079 0.74% 143 127655 0.81% 144 141569 0.90% 145 162460 1.03% 146 195719 1.24% 147 256057 1.63% 148 351290 2.23% 149 666573 4.23% 150 3402549 21.61% 151 8018445 50.93% 15742966 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.21 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=107.88 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=16.0 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=223.53 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=24.3 sequence=GAAGAAGAAGAAA SRR7169990 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:55:59 Started mapping on | Feb 12 07:56:00 Finished on | Feb 12 07:57:47 Mapping speed, Million of reads per hour | 529.67 Number of input reads | 15742966 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14809153 Uniquely mapped reads % | 94.07% Average mapped length | 291.51 Number of splices: Total | 14100627 Number of splices: Annotated (sjdb) | 13862912 Number of splices: GT/AG | 13898204 Number of splices: GC/AG | 162588 Number of splices: AT/AC | 11108 Number of splices: Non-canonical | 28727 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261508 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 33539 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.01% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 701559 701559 701559 N_multimapping 261508 261508 261508 N_noFeature 269634 14637405 345186 N_ambiguous 155072 794 58309 UnstrandedReadsAssigned:14384447 PositiveStrandReadsAssigned:170954 NegativeStrandReadsAssigned:14405658 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169990 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169990-trimmed-pair1.fastq SRR7169990-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,742,966 reads, 14,334,524 reads pseudoaligned [quant] estimated average fragment length: 230.231 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52401 SRR7169990.ke.tsv 34699 SRR7169990.se.tsv 87100 total ==> SRR7169990.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.77 279 10.752 Potri.005G024800.1.v4.1 1035 805.769 31 2.65211 Potri.004G059700.1.v4.1 961 731.805 6 0.565193 Potri.007G009000.2.v4.1 1416 1186.77 0 0 Potri.003G141000.2.v4.1 2943 2713.77 252 6.40131 Potri.016G087400.1.v4.1 270 87.6553 1369 1076.63 Potri.015G069301.1.v4.1 564 340.131 0 0 Potri.010G195200.1.v4.1 1773 1543.77 16 0.714461 Potri.012G127500.1.v4.1 977 747.788 4772 439.91 ==> SRR7169990.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 926 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169990 completed mapping pipeline successfully