Starting /dee2/code/volunteer_pipeline.sh SRR7169991 current disk space = 3049756721152 free memory = 1305088972 SRR7169991 SRAfilesize e9865345c6a75b6e41d7741cd75b18ba SRR7169991.sra SRR7169991.sra file validated SRR7169991 is paired end SRR7169991 is conventional basespace SRR7169991 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.859 34.0 33.0 34.0 33.0 34.0 2 33.3945 34.0 34.0 34.0 33.0 34.0 3 33.52075 34.0 34.0 34.0 33.0 34.0 4 33.53975 34.0 34.0 34.0 33.0 34.0 5 33.39175 34.0 34.0 34.0 33.0 34.0 6 37.19925 38.0 38.0 38.0 36.0 38.0 7 37.53025 38.0 38.0 38.0 37.0 38.0 8 37.653 38.0 38.0 38.0 38.0 38.0 9 37.68275 38.0 38.0 38.0 38.0 38.0 10-14 37.61345 38.0 38.0 38.0 38.0 38.0 15-19 37.5875 38.0 38.0 38.0 38.0 38.0 20-24 37.504599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.45125 38.0 38.0 38.0 38.0 38.0 30-34 37.441 38.0 38.0 38.0 38.0 38.0 35-39 37.2821 38.0 38.0 38.0 37.4 38.0 40-44 37.20555 38.0 38.0 38.0 37.0 38.0 45-49 37.056 38.0 38.0 38.0 36.4 38.0 50-54 37.0416 38.0 38.0 38.0 36.2 38.0 55-59 36.9455 38.0 38.0 38.0 36.0 38.0 60-64 36.905950000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.9095 38.0 38.0 38.0 35.8 38.0 70-74 36.779849999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.44455000000001 38.0 38.0 38.0 34.2 38.0 80-84 36.30165 38.0 38.0 38.0 34.0 38.0 85-89 36.2445 38.0 38.0 38.0 34.0 38.0 90-94 36.14795 38.0 38.0 38.0 34.0 38.0 95-99 35.969300000000004 38.0 38.0 38.0 33.2 38.0 100-104 35.6241 38.0 37.4 38.0 30.6 38.0 105-109 35.43135 38.0 37.0 38.0 30.4 38.0 110-114 35.2939 38.0 37.0 38.0 29.2 38.0 115-119 35.091899999999995 38.0 36.6 38.0 28.0 38.0 120-124 35.27445 38.0 36.8 38.0 29.4 38.0 125-129 34.9708 38.0 36.0 38.0 28.8 38.0 130-134 34.325450000000004 38.0 35.4 38.0 24.2 38.0 135-139 33.506600000000006 38.0 34.8 38.0 16.2 38.0 140-144 33.53255 38.0 35.0 38.0 18.6 38.0 145-149 32.86275 38.0 34.2 38.0 12.8 38.0 150-151 28.623874999999998 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 0.0 9 0.0 10 0.0 11 1.0 12 4.0 13 3.0 14 4.0 15 4.0 16 6.0 17 7.0 18 7.0 19 12.0 20 11.0 21 7.0 22 12.0 23 22.0 24 15.0 25 26.0 26 20.0 27 33.0 28 31.0 29 38.0 30 43.0 31 64.0 32 88.0 33 92.0 34 124.0 35 232.0 36 571.0 37 2520.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.43477150880776 13.071227980597397 10.109777891243299 35.38422261935155 2 23.724999999999998 14.6 30.9 30.775000000000002 3 20.225 19.125 26.825 33.825 4 21.6 26.5 24.075 27.825 5 22.25 30.775000000000002 24.15 22.825 6 21.425 34.075 24.2 20.3 7 14.6 28.799999999999997 39.85 16.75 8 17.474999999999998 28.025 31.5 23.0 9 16.35 27.200000000000003 34.050000000000004 22.400000000000002 10-14 19.165 30.270000000000003 27.639999999999997 22.925 15-19 19.314999999999998 29.715000000000003 27.33 23.64 20-24 19.785 29.580000000000002 27.48 23.155 25-29 18.905 30.214999999999996 27.134999999999998 23.745 30-34 19.615 29.73 27.229999999999997 23.425 35-39 20.255000000000003 29.115000000000002 27.229999999999997 23.400000000000002 40-44 19.689999999999998 29.335 27.88 23.095 45-49 19.54684139448807 29.120192067223527 27.274546091131896 24.058420447156507 50-54 19.830000000000002 28.775000000000002 27.47 23.925 55-59 19.85 29.475 26.939999999999998 23.735 60-64 19.835 28.735 27.29 24.14 65-69 19.925 29.470000000000002 27.04 23.565 70-74 20.32 28.51 27.62 23.549999999999997 75-79 20.02 29.18 26.545 24.255 80-84 20.44 28.610000000000003 27.060000000000002 23.89 85-89 19.50743354858087 29.108474745957853 27.676828352605497 23.707263352855783 90-94 20.269252021901842 28.43220977545587 27.17134676244537 24.127191440196917 95-99 20.31556203205869 28.777448369428672 27.239837194110848 23.66715240440179 100-104 20.4553415061296 28.98173630222667 26.93520140105079 23.627720790592946 105-109 20.601030051502576 28.71643582179109 26.88634431721586 23.796189809490475 110-114 20.25 29.01 26.825 23.915 115-119 20.651032551627583 28.466423321166058 27.01635081754088 23.866193309665483 120-124 20.849999999999998 28.405 26.935 23.810000000000002 125-129 21.00630189056717 28.39351805541662 26.61298389516855 23.987196158847652 130-134 20.73073073073073 28.783783783783782 26.5015015015015 23.983983983983983 135-139 20.812641083521445 28.54778028592927 27.037873087534486 23.6017055430148 140-144 20.624593363695514 28.472048446023724 26.054752014413694 24.848606175867076 145-149 21.18118118118118 28.82882882882883 25.59059059059059 24.3993993993994 150-151 21.2625 28.4 25.5625 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 4.0 24 5.5 25 4.5 26 6.5 27 9.5 28 16.5 29 19.5 30 24.0 31 37.0 32 47.0 33 57.5 34 64.5 35 77.0 36 95.5 37 110.0 38 125.5 39 148.0 40 174.5 41 210.5 42 221.0 43 238.0 44 254.0 45 265.5 46 268.0 47 245.5 48 223.5 49 194.5 50 179.5 51 150.5 52 117.0 53 94.5 54 85.0 55 63.5 56 38.5 57 30.0 58 22.5 59 18.5 60 12.0 61 6.5 62 8.0 63 5.5 64 2.5 65 3.0 66 1.5 67 0.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.034999999999999996 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.11499999999999999 90-94 0.46499999999999997 95-99 0.49500000000000005 100-104 0.075 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.03 130-134 0.1 135-139 0.325 140-144 0.095 145-149 0.1 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98887765419616 97.89999999999999 2 0.9858442871587462 1.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.02527805864509606 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTACAGCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.4874999999999998 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 2.975 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.7750000000000004 0.0 0.0 0.0 0.0 118-119 4.2625 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.325 0.0 0.0 0.0 0.0 124-125 5.9875 0.0 0.0 0.0 0.0 126-127 6.4875 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.5 0.0 0.0 0.0 0.0 132-133 8.05 0.0 0.0 0.0 0.0 134-135 8.7125 0.0 0.0 0.0 0.0 136-137 9.5 0.0 0.0 0.0 0.0 138-139 10.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTTG 10 0.006836113 144.9625 5 GAATTTT 10 0.006836113 144.9625 4 >>END_MODULE SRR7169991 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169991_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.762 33.0 33.0 34.0 31.0 34.0 2 32.1085 34.0 33.0 34.0 31.0 34.0 3 32.06925 34.0 33.0 34.0 31.0 34.0 4 31.926 34.0 33.0 34.0 31.0 34.0 5 31.85325 34.0 33.0 34.0 32.0 34.0 6 35.91975 38.0 38.0 38.0 35.0 38.0 7 36.04925 38.0 38.0 38.0 35.0 38.0 8 36.0595 38.0 38.0 38.0 35.0 38.0 9 36.0585 38.0 38.0 38.0 36.0 38.0 10-14 36.004749999999994 38.0 38.0 38.0 35.0 38.0 15-19 35.90390000000001 38.0 38.0 38.0 35.4 38.0 20-24 35.879349999999995 38.0 38.0 38.0 35.0 38.0 25-29 36.0605 38.0 38.0 38.0 36.0 38.0 30-34 36.03925 38.0 38.0 38.0 36.0 38.0 35-39 35.99225 38.0 38.0 38.0 35.8 38.0 40-44 35.87760000000001 38.0 38.0 38.0 35.6 38.0 45-49 35.7838 38.0 38.0 38.0 35.0 38.0 50-54 35.912850000000006 38.0 38.0 38.0 35.0 38.0 55-59 35.893100000000004 38.0 38.0 38.0 35.0 38.0 60-64 35.81745 38.0 38.0 38.0 34.4 38.0 65-69 35.8848 38.0 38.0 38.0 35.0 38.0 70-74 35.8409 38.0 38.0 38.0 34.8 38.0 75-79 35.75545 38.0 38.0 38.0 34.2 38.0 80-84 35.62055 38.0 38.0 38.0 34.0 38.0 85-89 35.285849999999996 38.0 38.0 38.0 32.6 38.0 90-94 34.8934 38.0 38.0 38.0 29.4 38.0 95-99 35.22805 38.0 38.0 38.0 30.6 38.0 100-104 35.35485 38.0 38.0 38.0 33.0 38.0 105-109 35.277300000000004 38.0 38.0 38.0 32.2 38.0 110-114 35.12135 38.0 38.0 38.0 30.6 38.0 115-119 34.89145 38.0 37.6 38.0 29.0 38.0 120-124 34.74315 38.0 37.0 38.0 28.0 38.0 125-129 34.425599999999996 38.0 36.6 38.0 25.8 38.0 130-134 33.28515 38.0 35.6 38.0 14.4 38.0 135-139 32.3893 38.0 35.0 38.0 6.4 38.0 140-144 31.521849999999993 38.0 33.8 38.0 2.0 38.0 145-149 30.935399999999998 38.0 32.2 38.0 2.0 38.0 150-151 27.280124999999998 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 109.0 3 7.0 4 9.0 5 3.0 6 5.0 7 3.0 8 5.0 9 1.0 10 2.0 11 3.0 12 3.0 13 6.0 14 4.0 15 5.0 16 3.0 17 7.0 18 6.0 19 3.0 20 9.0 21 11.0 22 11.0 23 13.0 24 12.0 25 22.0 26 20.0 27 25.0 28 26.0 29 30.0 30 59.0 31 60.0 32 100.0 33 119.0 34 128.0 35 178.0 36 431.0 37 2562.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.976653696498055 21.037613488975357 15.823605706874188 25.1621271076524 2 26.99822380106572 26.211621415884295 28.39380867800051 18.39634610504948 3 20.919540229885058 29.476372924648786 29.859514687100898 19.744572158365262 4 23.974193548387095 33.31612903225806 23.25161290322581 19.45806451612903 5 25.504919730709474 34.80062143966857 21.77628171931642 17.918177110305542 6 22.509034589571502 36.680433660299435 22.870418172431595 17.94011357769747 7 21.788283658787254 21.99383350462487 37.30729701952723 18.91058581706064 8 23.6896197327852 25.976361767728672 25.12846865364851 25.205549845837616 9 22.045629325813895 26.71109971802102 29.941040758779803 21.302230197385285 10-14 24.19388070464613 28.757597609972187 25.981250643865252 21.06727104151643 15-19 23.954942386193355 28.031829690487264 27.27742468867876 20.735803234640624 20-24 23.293669190748467 28.542729099057336 27.471282130531087 20.692319579663113 25-29 23.757246190940336 28.487149233058023 27.579130970091825 20.176473605909813 30-34 23.735069462244322 28.020710514174397 27.374788537448097 20.869431486133184 35-39 23.579618489382487 27.70836546866163 27.71350712118875 20.998508920767133 40-44 24.317066873224892 28.004131164471985 27.47224373870385 20.206558223599277 45-49 24.059334298118667 27.77548066983668 27.39818069051065 20.767004341534008 50-54 23.971018960998922 28.076666152818458 27.223678125481733 20.728636760700887 55-59 24.403905447070915 27.51284686536485 27.78520041109969 20.298047276464544 60-64 24.15158371040724 27.977169888934593 27.514397367338546 20.35684903331962 65-69 23.282051282051285 28.15897435897436 27.917948717948722 20.64102564102564 70-74 23.789333878218226 27.93216183081324 27.477523498161016 20.80098079280752 75-79 23.53572523765716 27.660226924256364 27.736890524379028 21.06715731370745 80-84 24.335106382978726 28.007364975450084 27.43453355155483 20.222995090016365 85-89 23.631647211413746 28.005188067444877 28.186770428015564 20.17639429312581 90-94 23.86999007158907 27.55395307519465 27.99811882740241 20.577938025813868 95-99 24.240398951210736 27.319932137165182 27.988278237622744 20.45139067400134 100-104 24.487599918015988 27.567124410739908 27.618364418938306 20.326911252305802 105-109 24.37621932436595 27.821131533011602 27.631173631789714 20.171475510832735 110-114 24.38335046248715 27.420349434737922 27.92394655704008 20.27235354573484 115-119 24.85823754789272 27.61685823754789 27.555555555555557 19.96934865900383 120-124 25.011452130096195 27.454573217285084 27.71924466839721 19.81472998422151 125-129 25.262070746191583 27.993803253292022 27.31216111541441 19.431964885101987 130-134 25.28766106368312 27.201866482846388 27.965427647277163 19.545044806193328 135-139 24.764061910154776 27.751712236423447 27.530604540797064 19.953621312624712 140-144 26.12661823346261 27.486753700770194 27.530452832249956 18.856175233517234 145-149 25.85448571882783 27.86285835408828 26.70764665359546 19.575009273488423 150-151 26.20279358510088 27.832384893947232 27.2633212622866 18.701500258665288 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 68.0 1 37.5 2 7.0 3 6.0 4 4.0 5 2.0 6 1.0 7 1.0 8 1.5 9 2.0 10 1.5 11 0.5 12 0.0 13 0.5 14 1.5 15 1.5 16 1.5 17 1.0 18 0.0 19 0.0 20 2.0 21 2.5 22 1.5 23 2.5 24 2.5 25 1.5 26 3.5 27 4.5 28 6.0 29 8.0 30 13.5 31 19.5 32 19.5 33 24.5 34 36.0 35 49.5 36 62.0 37 78.0 38 105.0 39 144.0 40 181.0 41 218.5 42 255.0 43 288.0 44 301.0 45 287.5 46 277.5 47 271.0 48 247.5 49 205.0 50 177.5 51 151.0 52 113.5 53 93.0 54 73.5 55 49.0 56 31.5 57 23.5 58 17.5 59 14.5 60 13.0 61 7.0 62 3.5 63 2.0 64 2.0 65 2.5 66 1.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.6249999999999996 2 1.4749999999999999 3 2.125 4 3.125 5 3.45 6 3.15 7 2.7 8 2.7 9 2.475 10-14 2.93 15-19 3.235 20-24 2.935 25-29 2.535 30-34 2.465 35-39 2.7550000000000003 40-44 3.175 45-49 3.26 50-54 2.6950000000000003 55-59 2.7 60-64 2.76 65-69 2.5 70-74 2.12 75-79 2.17 80-84 2.2399999999999998 85-89 3.6249999999999996 90-94 4.315 95-99 2.7449999999999997 100-104 2.42 105-109 2.6100000000000003 110-114 2.7 115-119 2.125 120-124 1.765 125-129 3.175 130-134 5.705 135-139 7.285 140-144 8.465 145-149 5.645 150-151 3.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70801033591732 95.5 2 1.1111111111111112 2.15 3 0.05167958656330749 0.15 4 0.025839793281653745 0.1 5 0.0 0.0 6 0.025839793281653745 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025839793281653745 0.22499999999999998 >10 0.025839793281653745 0.25 >50 0.025839793281653745 1.4749999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 59 1.4749999999999999 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.5374999999999996 0.0 0.0 0.0 0.0 112-113 2.85 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 5.1 0.0 0.0 0.0 0.0 124-125 5.75 0.0 0.0 0.0 0.0 126-127 6.25 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.3375 0.0 0.0 0.0 0.0 136-137 9.0625 0.0 0.0 0.0 0.0 138-139 9.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705678 spots for SRR7169991.sra Written 705678 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra Read 705659 spots for SRR7169991.sra Written 705659 spots for SRR7169991.sra SRR ids: ['SRR7169991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ovbiaex SRR7169991.sra spots: 14113199 blocks: [[1, 705659], [705660, 1411318], [1411319, 2116977], [2116978, 2822636], [2822637, 3528295], [3528296, 4233954], [4233955, 4939613], [4939614, 5645272], [5645273, 6350931], [6350932, 7056590], [7056591, 7762249], [7762250, 8467908], [8467909, 9173567], [9173568, 9879226], [9879227, 10584885], [10584886, 11290544], [11290545, 11996203], [11996204, 12701862], [12701863, 13407521], [13407522, 14113199]] SRR7169991 file size 4760799 SRR7169991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169991 SRR7169991_1.fastq SRR7169991_2.fastq Input file: SRR7169991_1.fastq Paired file: SRR7169991_2.fastq trimmed: SRR7169991-trimmed-pair1.fastq, SRR7169991-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:41:36 2025 >> started Wed Feb 12 07:41:51 2025 >> done (15.438s) 14113199 read pairs processed; of these: 25488 ( 0.18%) short read pairs filtered out after trimming by size control 57107 ( 0.40%) empty read pairs filtered out after trimming by size control 14030604 (99.41%) read pairs available; of these: 6652568 (47.41%) trimmed read pairs available after processing 7378036 (52.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 8 0.00% 21 5 0.00% 22 6 0.00% 23 12 0.00% 24 5 0.00% 25 6 0.00% 26 8 0.00% 27 4 0.00% 28 13 0.00% 29 14 0.00% 30 14 0.00% 31 16 0.00% 32 14 0.00% 33 19 0.00% 34 13 0.00% 35 12 0.00% 36 22 0.00% 37 20 0.00% 38 14 0.00% 39 28 0.00% 40 39 0.00% 41 27 0.00% 42 49 0.00% 43 55 0.00% 44 54 0.00% 45 59 0.00% 46 80 0.00% 47 93 0.00% 48 102 0.00% 49 97 0.00% 50 98 0.00% 51 135 0.00% 52 149 0.00% 53 179 0.00% 54 180 0.00% 55 190 0.00% 56 198 0.00% 57 266 0.00% 58 256 0.00% 59 312 0.00% 60 357 0.00% 61 416 0.00% 62 470 0.00% 63 536 0.00% 64 608 0.00% 65 691 0.00% 66 736 0.01% 67 887 0.01% 68 961 0.01% 69 1314 0.01% 70 1769 0.01% 71 1650 0.01% 72 1821 0.01% 73 1976 0.01% 74 2034 0.01% 75 2234 0.02% 76 2472 0.02% 77 2729 0.02% 78 2959 0.02% 79 3226 0.02% 80 3703 0.03% 81 4134 0.03% 82 4752 0.03% 83 5276 0.04% 84 6777 0.05% 85 8173 0.06% 86 8659 0.06% 87 9438 0.07% 88 9534 0.07% 89 10059 0.07% 90 10886 0.08% 91 11494 0.08% 92 12467 0.09% 93 13447 0.10% 94 14389 0.10% 95 15530 0.11% 96 16188 0.12% 97 17001 0.12% 98 17424 0.12% 99 18089 0.13% 100 19100 0.14% 101 19903 0.14% 102 21258 0.15% 103 22557 0.16% 104 23773 0.17% 105 25075 0.18% 106 26005 0.19% 107 26892 0.19% 108 27529 0.20% 109 28382 0.20% 110 29141 0.21% 111 29911 0.21% 112 31302 0.22% 113 32863 0.23% 114 34249 0.24% 115 35796 0.26% 116 36986 0.26% 117 37419 0.27% 118 38356 0.27% 119 38640 0.28% 120 39801 0.28% 121 41062 0.29% 122 41760 0.30% 123 43489 0.31% 124 45490 0.32% 125 47149 0.34% 126 48975 0.35% 127 50204 0.36% 128 51336 0.37% 129 52509 0.37% 130 53582 0.38% 131 55462 0.40% 132 57150 0.41% 133 59740 0.43% 134 62743 0.45% 135 65467 0.47% 136 68696 0.49% 137 72201 0.51% 138 76448 0.54% 139 81187 0.58% 140 85148 0.61% 141 90608 0.65% 142 97210 0.69% 143 104151 0.74% 144 115091 0.82% 145 129482 0.92% 146 152918 1.09% 147 194806 1.39% 148 269815 1.92% 149 504364 3.59% 150 2959243 21.09% 151 7378036 52.59% 14030604 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=55.44 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=13.9 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.62 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=3.9 sequence=CAGCACCAGCACCTGAAAAGCCAAAGAAGAGATCCAAAGCTGCAGCGAGTCCAGAATCTCCTGCGGATACTTCTGGGGCAGTAAGCTTTACTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=38.55 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTT SRR7169991 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:42:35 Started mapping on | Feb 12 07:42:35 Finished on | Feb 12 07:43:51 Mapping speed, Million of reads per hour | 664.61 Number of input reads | 14030604 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13224380 Uniquely mapped reads % | 94.25% Average mapped length | 291.14 Number of splices: Total | 11369457 Number of splices: Annotated (sjdb) | 11154240 Number of splices: GT/AG | 11197750 Number of splices: GC/AG | 134629 Number of splices: AT/AC | 9617 Number of splices: Non-canonical | 27461 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251507 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 25917 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576240 576240 576240 N_multimapping 251507 251507 251507 N_noFeature 277814 13039509 355225 N_ambiguous 162995 803 55023 UnstrandedReadsAssigned:12783571 PositiveStrandReadsAssigned:184068 NegativeStrandReadsAssigned:12814132 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169991 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169991-trimmed-pair1.fastq SRR7169991-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,030,604 reads, 12,776,264 reads pseudoaligned [quant] estimated average fragment length: 218.484 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7169991.ke.tsv 34699 SRR7169991.se.tsv 87100 total ==> SRR7169991.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.52 231 8.76187 Potri.005G024800.1.v4.1 1035 817.516 36 3.00738 Potri.004G059700.1.v4.1 961 743.516 4 0.367411 Potri.007G009000.2.v4.1 1416 1198.52 0 0 Potri.003G141000.2.v4.1 2943 2725.52 181.03 4.53612 Potri.016G087400.1.v4.1 270 87.6868 1415.49 1102.44 Potri.015G069301.1.v4.1 564 348.572 0 0 Potri.010G195200.1.v4.1 1773 1555.52 11 0.482948 Potri.012G127500.1.v4.1 977 759.516 4948 444.913 ==> SRR7169991.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 864 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169991 completed mapping pipeline successfully