Starting /dee2/code/volunteer_pipeline.sh SRR7169992 current disk space = 3049992003584 free memory = 1487787712 SRR7169992 SRAfilesize 8c8584fe21fa67ccdd4245d5c5948a36 SRR7169992.sra SRR7169992.sra file validated SRR7169992 is paired end SRR7169992 is conventional basespace SRR7169992 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.138 34.0 33.0 34.0 33.0 34.0 2 33.44725 34.0 34.0 34.0 33.0 34.0 3 33.4625 34.0 34.0 34.0 33.0 34.0 4 33.46675 34.0 34.0 34.0 33.0 34.0 5 33.44575 34.0 34.0 34.0 33.0 34.0 6 37.1965 38.0 38.0 38.0 36.0 38.0 7 37.4875 38.0 38.0 38.0 37.0 38.0 8 37.5365 38.0 38.0 38.0 38.0 38.0 9 37.546 38.0 38.0 38.0 38.0 38.0 10-14 37.5327 38.0 38.0 38.0 37.8 38.0 15-19 37.52305 38.0 38.0 38.0 38.0 38.0 20-24 37.4683 38.0 38.0 38.0 37.8 38.0 25-29 37.45225000000001 38.0 38.0 38.0 37.6 38.0 30-34 37.483 38.0 38.0 38.0 37.6 38.0 35-39 37.365700000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.240700000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.107299999999995 38.0 38.0 38.0 36.2 38.0 50-54 37.16695 38.0 38.0 38.0 36.0 38.0 55-59 37.092200000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.0338 38.0 38.0 38.0 36.0 38.0 65-69 36.97745 38.0 38.0 38.0 36.0 38.0 70-74 36.9806 38.0 38.0 38.0 36.0 38.0 75-79 36.85195 38.0 38.0 38.0 35.4 38.0 80-84 36.7239 38.0 38.0 38.0 35.0 38.0 85-89 36.6753 38.0 38.0 38.0 34.8 38.0 90-94 36.4665 38.0 38.0 38.0 34.0 38.0 95-99 36.1557 38.0 38.0 38.0 34.0 38.0 100-104 36.13525 38.0 38.0 38.0 33.6 38.0 105-109 36.22075 38.0 38.0 38.0 33.8 38.0 110-114 36.01115 38.0 37.4 38.0 33.2 38.0 115-119 35.75935 38.0 37.0 38.0 32.0 38.0 120-124 35.677099999999996 38.0 37.0 38.0 31.4 38.0 125-129 35.41275 38.0 36.2 38.0 30.6 38.0 130-134 34.79195 38.0 35.4 38.0 27.4 38.0 135-139 34.432249999999996 38.0 35.0 38.0 25.6 38.0 140-144 34.339150000000004 38.0 35.0 38.0 25.2 38.0 145-149 33.5155 38.0 34.8 38.0 20.0 38.0 150-151 29.623125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 3.0 14 2.0 15 2.0 16 1.0 17 2.0 18 3.0 19 3.0 20 4.0 21 4.0 22 7.0 23 10.0 24 11.0 25 15.0 26 20.0 27 25.0 28 31.0 29 39.0 30 50.0 31 47.0 32 74.0 33 99.0 34 149.0 35 256.0 36 582.0 37 2556.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.27272727272727 12.272727272727273 9.646464646464645 35.8080808080808 2 23.425 16.025 32.9 27.650000000000002 3 19.725 22.25 26.825 31.2 4 21.25 30.275000000000002 22.75 25.724999999999998 5 22.975 32.4 23.225 21.4 6 20.175 34.175 24.349999999999998 21.3 7 15.925 26.05 39.375 18.65 8 18.05 25.900000000000002 31.0 25.05 9 18.125 25.174999999999997 32.824999999999996 23.875 10-14 20.335 29.5 26.855 23.31 15-19 19.6 28.32 27.639999999999997 24.44 20-24 20.22 28.505000000000003 27.29 23.985 25-29 20.06 27.985 27.725 24.23 30-34 19.625 29.044999999999998 27.93 23.400000000000002 35-39 19.905 28.725 27.560000000000002 23.810000000000002 40-44 20.48 28.93 26.8 23.79 45-49 20.359431317581098 28.15378454144974 27.007408890668806 24.47937525030036 50-54 20.235 28.595 27.224999999999998 23.945 55-59 19.845 28.055000000000003 27.77 24.33 60-64 20.025000000000002 28.74 27.439999999999998 23.794999999999998 65-69 20.43 28.9 27.155 23.515 70-74 20.09 28.51 26.865 24.535 75-79 20.31 28.194999999999997 27.47 24.025 80-84 20.585 28.93 27.0 23.485 85-89 20.064028812965834 28.72792756740533 27.572407583412534 23.635636036216297 90-94 20.153521974714028 28.376480032109168 27.378085490668276 24.091912502508528 95-99 20.861027190332326 28.338368580060425 26.898288016112787 23.902316213494462 100-104 20.948992885058622 28.239302535324178 26.65597755286101 24.15572702675619 105-109 20.810202550637662 27.87696924231058 27.771942985746435 23.540885221305327 110-114 20.393550971359904 28.039254956939715 28.164430202283196 23.402763869417186 115-119 21.45 28.15 26.695 23.705000000000002 120-124 20.64 28.560000000000002 27.22 23.580000000000002 125-129 21.025 28.365000000000002 26.745 23.865 130-134 21.014601836519645 27.984344422700584 26.684730794319833 24.316322946459934 135-139 20.967741935483872 28.30141129032258 27.061491935483872 23.669354838709676 140-144 20.994780164625578 28.25737803653885 26.791808873720136 23.95603292511544 145-149 21.472977038002607 27.945452722350346 26.576757244560312 24.004812995086734 150-151 20.192668585011887 27.861879144251223 26.423120230201423 25.522332040535467 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.5 24 1.0 25 2.5 26 4.5 27 4.5 28 8.0 29 14.0 30 17.5 31 22.5 32 26.5 33 32.5 34 51.0 35 69.0 36 87.5 37 103.5 38 130.5 39 160.0 40 179.5 41 198.5 42 217.0 43 233.5 44 254.0 45 274.0 46 278.0 47 271.0 48 251.0 49 222.0 50 187.0 51 141.5 52 118.5 53 115.5 54 89.5 55 56.0 56 35.5 57 33.0 58 28.0 59 15.5 60 12.0 61 12.0 62 8.0 63 4.5 64 5.0 65 4.5 66 2.5 67 3.0 68 3.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.12 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.045 90-94 0.33999999999999997 95-99 0.7000000000000001 100-104 0.21 105-109 0.025 110-114 0.13999999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.35500000000000004 135-139 0.8 140-144 0.38 145-149 0.27 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.25 0.0125 0.0 0.0 0.0 106-107 1.5 0.025 0.0 0.0 0.0 108-109 1.6124999999999998 0.025 0.0 0.0 0.0 110-111 1.7625000000000002 0.025 0.0 0.0 0.0 112-113 1.8625 0.025 0.0 0.0 0.0 114-115 2.025 0.025 0.0 0.0 0.0 116-117 2.4 0.025 0.0 0.0 0.0 118-119 2.8 0.025 0.0 0.0 0.0 120-121 3.2125000000000004 0.025 0.0 0.0 0.0 122-123 3.5125 0.025 0.0 0.0 0.0 124-125 3.925 0.025 0.0 0.0 0.0 126-127 4.375 0.025 0.0 0.0 0.0 128-129 4.887499999999999 0.025 0.0 0.0 0.0 130-131 5.1625 0.025 0.0 0.0 0.0 132-133 5.6375 0.025 0.0 0.0 0.0 134-135 5.8625 0.025 0.0 0.0 0.0 136-137 6.2375 0.025 0.0 0.0 0.0 138-139 6.637499999999999 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATTTT 10 0.006693877 145.96202 145 >>END_MODULE SRR7169992 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169992_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11925 33.0 33.0 34.0 32.0 34.0 2 32.18925 34.0 33.0 34.0 32.0 34.0 3 32.2115 34.0 33.0 34.0 32.0 34.0 4 31.80375 34.0 33.0 34.0 31.0 34.0 5 31.82425 34.0 33.0 34.0 31.0 34.0 6 35.89325 38.0 38.0 38.0 34.0 38.0 7 35.879 38.0 38.0 38.0 34.0 38.0 8 35.85575 38.0 38.0 38.0 34.0 38.0 9 35.836 38.0 38.0 38.0 34.0 38.0 10-14 35.820299999999996 38.0 38.0 38.0 34.4 38.0 15-19 35.538700000000006 38.0 38.0 38.0 33.6 38.0 20-24 35.818599999999996 38.0 38.0 38.0 34.4 38.0 25-29 35.87714999999999 38.0 38.0 38.0 34.8 38.0 30-34 35.86965 38.0 38.0 38.0 34.6 38.0 35-39 35.7737 38.0 38.0 38.0 34.4 38.0 40-44 35.576499999999996 38.0 38.0 38.0 33.8 38.0 45-49 35.48085 38.0 38.0 38.0 33.4 38.0 50-54 35.80460000000001 38.0 38.0 38.0 34.4 38.0 55-59 35.78365 38.0 38.0 38.0 34.4 38.0 60-64 35.73295 38.0 38.0 38.0 34.0 38.0 65-69 35.69585 38.0 38.0 38.0 34.0 38.0 70-74 35.654250000000005 38.0 38.0 38.0 34.0 38.0 75-79 35.57845 38.0 38.0 38.0 33.6 38.0 80-84 35.4541 38.0 38.0 38.0 33.0 38.0 85-89 34.9787 38.0 38.0 38.0 29.8 38.0 90-94 34.5675 38.0 37.8 38.0 26.6 38.0 95-99 35.00150000000001 38.0 38.0 38.0 28.8 38.0 100-104 35.105500000000006 38.0 38.0 38.0 30.2 38.0 105-109 34.95175 38.0 37.4 38.0 29.0 38.0 110-114 34.84310000000001 38.0 37.2 38.0 28.2 38.0 115-119 34.548249999999996 38.0 37.0 38.0 25.8 38.0 120-124 34.4456 38.0 36.6 38.0 25.6 38.0 125-129 33.9223 38.0 36.0 38.0 19.8 38.0 130-134 32.92205 38.0 35.2 38.0 11.4 38.0 135-139 31.83865 38.0 34.2 38.0 2.0 38.0 140-144 30.90175 38.0 32.8 38.0 2.0 38.0 145-149 30.4163 38.0 32.0 38.0 2.0 38.0 150-151 26.614375000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 124.0 3 9.0 4 2.0 5 1.0 6 4.0 7 5.0 8 0.0 9 2.0 10 0.0 11 3.0 12 6.0 13 2.0 14 1.0 15 2.0 16 6.0 17 4.0 18 6.0 19 8.0 20 9.0 21 10.0 22 14.0 23 22.0 24 19.0 25 35.0 26 26.0 27 31.0 28 29.0 29 52.0 30 63.0 31 71.0 32 102.0 33 133.0 34 153.0 35 171.0 36 421.0 37 2454.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35931510350115 21.875798619984664 13.340148223869155 26.42473805264503 2 27.513362178671418 26.088063120386867 29.727666072792058 16.670908628149654 3 21.15236875800256 29.014084507042252 31.037131882202306 18.79641485275288 4 22.77432712215321 34.679089026915115 23.007246376811594 19.53933747412008 5 22.52462415759461 36.2623120787973 23.302229134266458 17.910834629341625 6 21.798505539809327 36.61427467147642 23.576397835609377 18.01082195310487 7 22.33960319505282 21.618139654728164 35.58361247101263 20.45864467920639 8 22.076586995630944 25.983037779491134 26.41994345926497 25.520431765612955 9 22.038709677419355 25.806451612903224 28.15483870967742 24.0 10-14 24.027684520427663 27.75683074221373 26.14017870977739 22.07530602758122 15-19 23.142648744399292 27.831614046056057 27.508596436386373 21.517140773158278 20-24 23.14527794998967 28.182475718123577 27.846662533581316 20.825583798305438 25-29 23.790114539263236 28.707047776287276 26.4626973480549 21.040140336394593 30-34 23.525770004643242 27.30743434968787 27.64277975545581 21.524015890213075 35-39 23.890784982935152 27.97083462612473 26.80215120488158 21.336229186058535 40-44 23.407022106631988 28.36410923276983 27.641092327698306 20.58777633289987 45-49 23.381145411079927 27.4555659494855 28.198731940546722 20.964556698887847 50-54 23.80118465104301 27.607519958794747 27.607519958794747 20.983775431367498 55-59 23.851271208292506 27.404465989376515 28.100665257078028 20.643597545252952 60-64 23.189450911713198 27.711960440918926 27.969506541670956 21.12908210569692 65-69 24.109715932482505 27.38781391519144 27.562783038287357 20.939687114038698 70-74 23.996117298457136 27.495657504853376 27.628486768161846 20.879738428527638 75-79 23.78447395301328 27.59959141981614 28.084780388151177 20.531154239019408 80-84 23.794079794079796 27.68082368082368 27.773487773487776 20.751608751608753 85-89 24.38081304211516 27.31737903647194 27.824224056850245 20.47758386456265 90-94 24.16859608503473 28.115133656072405 27.299515891391284 20.41675436750158 95-99 24.32153011113983 27.51615404497286 27.88317394675627 20.27914189713104 100-104 23.962564920039082 27.346120224199105 27.808916542397284 20.88239831336453 105-109 24.126181010893696 27.698900304610458 27.874438535804636 20.300480148691207 110-114 24.359504132231404 27.680785123966945 27.43285123966942 20.52685950413223 115-119 24.06485709887629 27.666889014315764 27.59505361999076 20.67320026681718 120-124 24.175656421738246 27.40687970690006 27.819051496030937 20.598412375330753 125-129 24.331883157240522 27.8071265796561 27.14936813755956 20.711622125543816 130-134 24.63605823068309 28.096837839279047 26.737055404468617 20.530048525569242 135-139 25.097031651451374 27.447657573935384 27.196195265948724 20.259115508664514 140-144 25.163979988882712 27.493051695386328 26.498054474708173 20.84491384102279 145-149 25.27625046709016 28.18021672983505 26.904393316607056 19.63913948646773 150-151 25.84123684552423 28.114849941535663 26.71170585942575 19.332207353514356 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 77.0 1 40.5 2 3.5 3 3.5 4 3.5 5 3.5 6 4.5 7 5.5 8 4.0 9 3.0 10 2.5 11 1.5 12 1.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 1.0 19 2.0 20 1.0 21 1.0 22 2.0 23 2.0 24 2.0 25 1.0 26 4.0 27 5.0 28 3.0 29 6.0 30 6.5 31 6.5 32 16.0 33 23.5 34 32.0 35 52.5 36 72.0 37 96.0 38 122.5 39 147.5 40 182.5 41 220.0 42 257.5 43 265.5 44 260.0 45 270.0 46 276.0 47 267.5 48 249.5 49 211.5 50 176.0 51 157.5 52 123.0 53 95.0 54 80.0 55 57.0 56 34.0 57 22.0 58 13.0 59 10.5 60 12.0 61 9.5 62 7.0 63 5.5 64 3.5 65 3.5 66 2.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.175 2 1.775 3 2.375 4 3.4000000000000004 5 3.55 6 2.9749999999999996 7 2.9749999999999996 8 2.725 9 3.125 10-14 3.195 15-19 4.03 20-24 3.2199999999999998 25-29 3.09 30-34 3.085 35-39 3.3099999999999996 40-44 3.875 45-49 3.7900000000000005 50-54 2.9250000000000003 55-59 3.045 60-64 2.93 65-69 2.8400000000000003 70-74 2.13 75-79 2.1 80-84 2.875 85-89 4.31 90-94 4.9799999999999995 95-99 3.2750000000000004 100-104 2.765 105-109 3.1550000000000002 110-114 3.2 115-119 2.555 120-124 1.7399999999999998 125-129 3.46 130-134 6.235 135-139 8.535 140-144 10.05 145-149 6.335 150-151 3.7875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.28076033907013 96.625 2 0.5394297456974056 1.05 3 0.10274852298998202 0.3 4 0.025687130747495505 0.1 5 0.0 0.0 6 0.025687130747495505 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025687130747495505 1.775 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 71 1.775 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.2125000000000004 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.300000000000001 0.0 0.0 0.0 0.0 128-129 4.800000000000001 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.4875 0.0 0.0 0.0 0.0 134-135 5.7375 0.0 0.0 0.0 0.0 136-137 6.075 0.0 0.0 0.0 0.0 138-139 6.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGACAA 10 0.006948341 144.07893 8 >>END_MODULE Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra Read 772533 spots for SRR7169992.sra Written 772533 spots for SRR7169992.sra Read 772514 spots for SRR7169992.sra Written 772514 spots for SRR7169992.sra SRR ids: ['SRR7169992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_23164a3e SRR7169992.sra spots: 15450299 blocks: [[1, 772514], [772515, 1545028], [1545029, 2317542], [2317543, 3090056], [3090057, 3862570], [3862571, 4635084], [4635085, 5407598], [5407599, 6180112], [6180113, 6952626], [6952627, 7725140], [7725141, 8497654], [8497655, 9270168], [9270169, 10042682], [10042683, 10815196], [10815197, 11587710], [11587711, 12360224], [12360225, 13132738], [13132739, 13905252], [13905253, 14677766], [14677767, 15450299]] SRR7169992 file size 5213898 SRR7169992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169992 SRR7169992_1.fastq SRR7169992_2.fastq Input file: SRR7169992_1.fastq Paired file: SRR7169992_2.fastq trimmed: SRR7169992-trimmed-pair1.fastq, SRR7169992-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:26:56 2025 >> started Wed Feb 12 07:27:12 2025 >> done (16.611s) 15450299 read pairs processed; of these: 20299 ( 0.13%) short read pairs filtered out after trimming by size control 33667 ( 0.22%) empty read pairs filtered out after trimming by size control 15396333 (99.65%) read pairs available; of these: 7277780 (47.27%) trimmed read pairs available after processing 8118553 (52.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 0 0.00% 21 4 0.00% 22 6 0.00% 23 9 0.00% 24 4 0.00% 25 3 0.00% 26 6 0.00% 27 10 0.00% 28 7 0.00% 29 8 0.00% 30 11 0.00% 31 10 0.00% 32 9 0.00% 33 7 0.00% 34 10 0.00% 35 12 0.00% 36 15 0.00% 37 7 0.00% 38 14 0.00% 39 20 0.00% 40 30 0.00% 41 31 0.00% 42 29 0.00% 43 31 0.00% 44 29 0.00% 45 33 0.00% 46 44 0.00% 47 52 0.00% 48 46 0.00% 49 60 0.00% 50 72 0.00% 51 86 0.00% 52 101 0.00% 53 101 0.00% 54 105 0.00% 55 130 0.00% 56 133 0.00% 57 163 0.00% 58 179 0.00% 59 189 0.00% 60 229 0.00% 61 273 0.00% 62 282 0.00% 63 352 0.00% 64 396 0.00% 65 401 0.00% 66 482 0.00% 67 526 0.00% 68 643 0.00% 69 795 0.01% 70 964 0.01% 71 983 0.01% 72 1097 0.01% 73 1199 0.01% 74 1323 0.01% 75 1496 0.01% 76 1578 0.01% 77 1726 0.01% 78 1963 0.01% 79 2134 0.01% 80 2408 0.02% 81 2791 0.02% 82 3305 0.02% 83 3673 0.02% 84 5152 0.03% 85 5768 0.04% 86 6248 0.04% 87 6436 0.04% 88 6820 0.04% 89 7190 0.05% 90 7481 0.05% 91 8260 0.05% 92 8842 0.06% 93 9810 0.06% 94 10781 0.07% 95 11386 0.07% 96 11960 0.08% 97 12213 0.08% 98 12977 0.08% 99 13264 0.09% 100 14306 0.09% 101 15156 0.10% 102 16194 0.11% 103 17474 0.11% 104 18714 0.12% 105 19892 0.13% 106 20987 0.14% 107 21056 0.14% 108 21773 0.14% 109 22230 0.14% 110 23132 0.15% 111 24074 0.16% 112 25399 0.16% 113 27097 0.18% 114 28885 0.19% 115 29861 0.19% 116 31142 0.20% 117 32031 0.21% 118 32561 0.21% 119 32510 0.21% 120 33826 0.22% 121 34576 0.22% 122 35682 0.23% 123 38584 0.25% 124 40746 0.26% 125 42735 0.28% 126 44120 0.29% 127 45627 0.30% 128 47291 0.31% 129 47983 0.31% 130 49384 0.32% 131 51799 0.34% 132 53866 0.35% 133 57485 0.37% 134 60790 0.39% 135 64382 0.42% 136 68368 0.44% 137 72905 0.47% 138 78678 0.51% 139 85011 0.55% 140 89633 0.58% 141 96909 0.63% 142 105170 0.68% 143 115567 0.75% 144 130497 0.85% 145 149565 0.97% 146 181880 1.18% 147 238031 1.55% 148 340308 2.21% 149 642480 4.17% 150 3482001 22.62% 151 8118553 52.73% 15396333 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=164.36 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.31 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=4.4 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=59.07 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.6 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCG SRR7169992 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:27:53 Started mapping on | Feb 12 07:27:53 Finished on | Feb 12 07:29:14 Mapping speed, Million of reads per hour | 684.28 Number of input reads | 15396333 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14604893 Uniquely mapped reads % | 94.86% Average mapped length | 293.15 Number of splices: Total | 13718012 Number of splices: Annotated (sjdb) | 13487929 Number of splices: GT/AG | 13520566 Number of splices: GC/AG | 158311 Number of splices: AT/AC | 11114 Number of splices: Non-canonical | 28021 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 259726 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 26866 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 549839 549839 549839 N_multimapping 259726 259726 259726 N_noFeature 277428 14432353 350433 N_ambiguous 157986 845 57951 UnstrandedReadsAssigned:14169479 PositiveStrandReadsAssigned:171695 NegativeStrandReadsAssigned:14196509 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169992 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169992-trimmed-pair1.fastq SRR7169992-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,396,333 reads, 14,122,301 reads pseudoaligned [quant] estimated average fragment length: 233.98 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR7169992.ke.tsv 34699 SRR7169992.se.tsv 87100 total ==> SRR7169992.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.02 269 10.078 Potri.005G024800.1.v4.1 1035 802.02 30 2.50151 Potri.004G059700.1.v4.1 961 728.073 6 0.551115 Potri.007G009000.2.v4.1 1416 1183.02 0 0 Potri.003G141000.2.v4.1 2943 2710.02 250 6.16926 Potri.016G087400.1.v4.1 270 83.9857 1419.17 1130.04 Potri.015G069301.1.v4.1 564 335.807 0 0 Potri.010G195200.1.v4.1 1773 1540.02 19 0.825074 Potri.012G127500.1.v4.1 977 744.061 5366 482.289 ==> SRR7169992.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 887 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 311 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169992 completed mapping pipeline successfully