Starting /dee2/code/volunteer_pipeline.sh SRR7169993 current disk space = 3049261441024 free memory = 1582682336 SRR7169993 SRAfilesize 847b49e5710f248029a1fe05f166cad7 SRR7169993.sra SRR7169993.sra file validated SRR7169993 is paired end SRR7169993 is conventional basespace SRR7169993 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95525 34.0 33.0 34.0 33.0 34.0 2 33.4175 34.0 34.0 34.0 33.0 34.0 3 33.395 34.0 34.0 34.0 33.0 34.0 4 33.497 34.0 34.0 34.0 33.0 34.0 5 33.4675 34.0 34.0 34.0 33.0 34.0 6 37.26 38.0 38.0 38.0 36.0 38.0 7 37.4675 38.0 38.0 38.0 37.0 38.0 8 37.52075 38.0 38.0 38.0 37.0 38.0 9 37.54475 38.0 38.0 38.0 38.0 38.0 10-14 37.58785 38.0 38.0 38.0 38.0 38.0 15-19 37.56374999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.50435 38.0 38.0 38.0 38.0 38.0 25-29 37.4537 38.0 38.0 38.0 37.8 38.0 30-34 37.418400000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.33815 38.0 38.0 38.0 37.2 38.0 40-44 37.1693 38.0 38.0 38.0 36.8 38.0 45-49 37.1155 38.0 38.0 38.0 36.0 38.0 50-54 37.04664999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.9762 38.0 38.0 38.0 36.0 38.0 60-64 36.926399999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.89345 38.0 38.0 38.0 35.8 38.0 70-74 36.83115 38.0 38.0 38.0 35.8 38.0 75-79 36.624 38.0 38.0 38.0 34.8 38.0 80-84 36.54285 38.0 38.0 38.0 34.0 38.0 85-89 36.44715 38.0 38.0 38.0 34.0 38.0 90-94 36.4096 38.0 38.0 38.0 34.0 38.0 95-99 36.28475 38.0 38.0 38.0 34.0 38.0 100-104 36.03985 38.0 37.0 38.0 33.0 38.0 105-109 35.91374999999999 38.0 37.2 38.0 32.4 38.0 110-114 35.67445 38.0 37.0 38.0 31.0 38.0 115-119 35.52535 38.0 37.0 38.0 31.0 38.0 120-124 35.217 38.0 36.0 38.0 29.4 38.0 125-129 34.93495 38.0 36.0 38.0 28.0 38.0 130-134 34.44945 38.0 35.0 38.0 26.2 38.0 135-139 33.83925 38.0 35.0 38.0 22.2 38.0 140-144 33.72815 38.0 35.0 38.0 21.4 38.0 145-149 32.908699999999996 38.0 34.0 38.0 14.2 38.0 150-151 29.049500000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 2.0 9 2.0 10 0.0 11 1.0 12 1.0 13 0.0 14 3.0 15 3.0 16 3.0 17 1.0 18 4.0 19 10.0 20 8.0 21 14.0 22 8.0 23 15.0 24 22.0 25 18.0 26 18.0 27 28.0 28 42.0 29 37.0 30 44.0 31 52.0 32 58.0 33 94.0 34 135.0 35 251.0 36 670.0 37 2455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.399288798577594 13.208026416052832 9.118618237236474 33.2740665481331 2 23.0 13.975000000000001 31.1 31.924999999999997 3 20.125 17.95 26.174999999999997 35.75 4 23.625 25.05 22.825 28.499999999999996 5 22.900000000000002 29.725 23.175 24.2 6 19.675 34.55 24.4 21.375 7 15.425 29.75 36.225 18.6 8 17.675 27.150000000000002 30.099999999999998 25.074999999999996 9 16.975 25.324999999999996 34.025 23.674999999999997 10-14 19.2 30.685000000000002 27.42 22.695 15-19 19.79 29.025000000000002 27.48 23.705000000000002 20-24 19.34 29.585 27.305 23.77 25-29 19.725 29.575000000000003 27.08 23.62 30-34 19.835 29.154999999999998 27.589999999999996 23.419999999999998 35-39 19.42 29.69 26.96 23.93 40-44 19.79 28.735 27.3 24.175 45-49 19.950000000000003 28.799999999999997 27.389999999999997 23.86 50-54 19.37 29.205 27.38 24.044999999999998 55-59 20.34 28.705000000000002 26.790000000000003 24.165 60-64 19.794999999999998 28.665000000000003 27.325 24.215 65-69 20.325 28.310000000000002 26.825 24.54 70-74 19.585 29.2 27.445000000000004 23.77 75-79 20.24 28.765 27.034999999999997 23.96 80-84 19.74 28.15 27.994999999999997 24.115000000000002 85-89 20.53 28.625 27.139999999999997 23.705000000000002 90-94 20.43 28.73 26.700000000000003 24.14 95-99 20.29 28.610000000000003 26.974999999999998 24.125 100-104 21.22 28.199999999999996 26.99 23.59 105-109 20.93 28.205000000000002 27.189999999999998 23.674999999999997 110-114 20.515 27.91 27.13 24.445 115-119 20.25 28.294999999999998 26.729999999999997 24.725 120-124 21.22 28.105000000000004 26.895000000000003 23.78 125-129 20.544999999999998 27.74 27.6 24.115000000000002 130-134 20.674999999999997 27.725 27.034999999999997 24.565 135-139 21.22 28.1 26.740000000000002 23.94 140-144 21.32 28.275 25.990000000000002 24.415 145-149 21.2 28.115000000000002 26.035000000000004 24.65 150-151 21.6 28.349999999999998 25.724999999999998 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 3.0 23 2.0 24 3.5 25 5.0 26 6.0 27 8.5 28 10.0 29 11.5 30 11.5 31 24.0 32 42.0 33 44.0 34 46.5 35 76.0 36 102.0 37 108.5 38 117.0 39 138.0 40 173.0 41 200.0 42 238.5 43 250.5 44 247.5 45 261.5 46 249.0 47 247.0 48 262.5 49 237.0 50 186.0 51 155.5 52 130.0 53 102.0 54 78.5 55 59.0 56 42.5 57 33.5 58 23.5 59 12.5 60 10.5 61 8.5 62 6.0 63 6.5 64 7.0 65 4.5 66 1.0 67 0.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.4625000000000004 0.0 0.0 0.0 0.0 120-121 3.875 0.0 0.0 0.0 0.0 122-123 4.362500000000001 0.0 0.0 0.0 0.0 124-125 4.7 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.6875 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.5375 0.0 0.0 0.0 0.0 134-135 7.074999999999999 0.0 0.0 0.0 0.0 136-137 7.575 0.0 0.0 0.0 0.0 138-139 8.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTAAC 10 0.006832588 144.9875 5 GATAGCT 10 0.006832588 144.9875 3 TTTAACA 10 0.006832588 144.9875 6 >>END_MODULE SRR7169993 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169993_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.96325 33.0 33.0 34.0 32.0 34.0 2 32.37575 34.0 33.0 34.0 32.0 34.0 3 32.3685 34.0 33.0 34.0 32.0 34.0 4 32.2495 34.0 33.0 34.0 32.0 34.0 5 32.24275 34.0 33.0 34.0 32.0 34.0 6 36.3635 38.0 38.0 38.0 35.0 38.0 7 36.4135 38.0 38.0 38.0 36.0 38.0 8 36.44575 38.0 38.0 38.0 36.0 38.0 9 36.42175 38.0 38.0 38.0 36.0 38.0 10-14 36.31985000000001 38.0 38.0 38.0 35.8 38.0 15-19 36.11615 38.0 38.0 38.0 35.4 38.0 20-24 36.271699999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.2687 38.0 38.0 38.0 36.0 38.0 30-34 36.3366 38.0 38.0 38.0 36.0 38.0 35-39 36.247550000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.101299999999995 38.0 38.0 38.0 35.8 38.0 45-49 35.9406 38.0 38.0 38.0 34.8 38.0 50-54 36.19245 38.0 38.0 38.0 35.6 38.0 55-59 36.16565 38.0 38.0 38.0 36.0 38.0 60-64 36.067150000000005 38.0 38.0 38.0 35.2 38.0 65-69 36.02855 38.0 38.0 38.0 34.8 38.0 70-74 35.98524999999999 38.0 38.0 38.0 35.0 38.0 75-79 35.8729 38.0 38.0 38.0 34.0 38.0 80-84 35.849599999999995 38.0 38.0 38.0 34.0 38.0 85-89 35.54455 38.0 38.0 38.0 33.4 38.0 90-94 35.146 38.0 38.0 38.0 29.8 38.0 95-99 35.408550000000005 38.0 38.0 38.0 31.0 38.0 100-104 35.44235 38.0 38.0 38.0 32.2 38.0 105-109 35.35075 38.0 38.0 38.0 31.4 38.0 110-114 35.0548 38.0 37.8 38.0 29.4 38.0 115-119 34.85235 38.0 37.0 38.0 28.0 38.0 120-124 34.54225 38.0 37.0 38.0 25.2 38.0 125-129 34.293899999999994 38.0 36.2 38.0 24.4 38.0 130-134 33.4749 38.0 35.6 38.0 15.8 38.0 135-139 32.5227 38.0 34.8 38.0 8.6 38.0 140-144 31.621249999999996 38.0 33.8 38.0 2.0 38.0 145-149 31.134049999999995 38.0 32.8 38.0 2.0 38.0 150-151 27.30975 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 73.0 3 12.0 4 4.0 5 5.0 6 2.0 7 5.0 8 5.0 9 1.0 10 1.0 11 3.0 12 4.0 13 4.0 14 2.0 15 7.0 16 7.0 17 4.0 18 13.0 19 11.0 20 14.0 21 16.0 22 12.0 23 13.0 24 14.0 25 24.0 26 23.0 27 30.0 28 28.0 29 41.0 30 40.0 31 66.0 32 92.0 33 128.0 34 120.0 35 179.0 36 451.0 37 2546.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.207615127347566 22.845382042706458 14.509904810908155 23.43709801903782 2 27.453447408152993 27.65475591343734 27.528938097634626 17.362858580775036 3 21.14026236125126 29.74268415741675 29.439959636730574 19.677093844601412 4 24.09148665819568 33.138500635324014 23.60864040660737 19.161372299872937 5 25.184996172492983 35.21306455728502 21.66368971676448 17.938249553457513 6 21.695001268713522 36.665820857650345 23.52194874397361 18.117229129662523 7 21.655242447321655 22.315308453922313 36.912922061436916 19.116527037319116 8 22.515212981744423 25.811359026369168 26.44523326572008 25.22819472616633 9 22.0476431829701 25.114039533705018 29.472883933096806 23.36543335022808 10-14 24.37030266097908 29.128580134064595 25.426569165143203 21.07454803981312 15-19 23.613094024066896 28.50805629206608 26.87640220273302 21.002447481134 20-24 24.00650472609005 27.594267710133142 27.00477690822238 21.394450655554426 25-29 23.813628067329144 27.818900831474348 27.55019265868992 20.81727844250659 30-34 23.51450010139931 28.12309876292841 27.565402555262626 20.796998580409653 35-39 24.307426421999693 28.45524322675749 26.44741523916027 20.78991511208255 40-44 23.863926148824397 27.765593920538585 27.38307747233131 20.987402458305706 45-49 24.172286940527286 27.968526466380546 27.176578786020844 20.682607807071328 50-54 23.815809514139207 27.725034269178046 27.466111590597553 20.99304462608519 55-59 24.318147188785616 27.81248412819341 27.49758748539794 20.371781197623037 60-64 24.25629290617849 27.56165776760742 27.088736333587594 21.093312992626494 65-69 23.702237783528695 28.274217283198865 27.66022225605115 20.363322677221294 70-74 24.25146672061501 27.033178231843007 27.887922314383978 20.827432733158002 75-79 24.043605531442413 27.208034722923184 28.146764913697385 20.601594831937014 80-84 24.431155931688036 27.62377742867278 27.578168550144426 20.366898089494757 85-89 24.414082488998055 27.571384709855696 27.827243884965714 20.187288916180535 90-94 24.192468188140744 27.391685126989852 28.035649889238062 20.380196795631342 95-99 24.15368218037862 27.52880272039791 27.67598842815815 20.641526671065318 100-104 24.728784345533814 28.29260873973436 27.293926797120548 19.684680117611276 105-109 24.41636215996752 26.928542427933415 27.96386520503451 20.691230207064557 110-114 24.80797599064042 27.605676789256826 27.02578971463452 20.560557505468232 115-119 24.687610664238377 27.30308089239642 27.864622856275613 20.144685587089594 120-124 24.979826507968532 27.6982045592092 27.612467218075448 19.70950171474682 125-129 24.739955129512545 27.620844380991226 27.549459514582907 20.08974097491332 130-134 25.41364371835691 28.138211806461715 26.98470692624876 19.463437548932617 135-139 25.787995973936535 26.974625205276265 27.345446840069926 19.891931980717274 140-144 25.794562256289726 27.26350088136317 27.09256984135463 19.849367020992467 145-149 25.845624641684473 27.560327304946057 27.080835982696616 19.51321207067285 150-151 25.619729108101204 27.14030155890621 27.52363915154613 19.71633018144646 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 29.0 1 18.0 2 5.0 3 2.5 4 2.0 5 3.5 6 3.5 7 1.0 8 0.5 9 1.0 10 0.5 11 0.5 12 1.0 13 1.5 14 1.0 15 0.0 16 1.0 17 2.5 18 2.0 19 1.5 20 1.5 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 3.5 27 3.0 28 3.5 29 7.5 30 7.0 31 9.5 32 15.5 33 20.5 34 30.0 35 44.0 36 62.5 37 79.5 38 101.5 39 147.0 40 191.5 41 216.0 42 258.0 43 287.5 44 289.0 45 296.0 46 287.5 47 276.5 48 251.5 49 205.0 50 185.0 51 154.5 52 110.0 53 95.5 54 82.0 55 57.0 56 42.5 57 31.5 58 18.5 59 13.5 60 12.0 61 12.5 62 7.5 63 4.5 64 4.5 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.825 2 0.65 3 0.8999999999999999 4 1.625 5 2.025 6 1.4749999999999999 7 1.525 8 1.4000000000000001 9 1.35 10-14 1.54 15-19 1.94 20-24 1.6099999999999999 25-29 1.38 30-34 1.38 35-39 1.635 40-44 1.965 45-49 2.1399999999999997 50-54 1.5150000000000001 55-59 1.555 60-64 1.675 65-69 1.465 70-74 1.1400000000000001 75-79 0.9299999999999999 80-84 1.335 85-89 2.29 90-94 2.945 95-99 1.485 100-104 1.37 105-109 1.48 110-114 1.7049999999999998 115-119 1.165 120-124 0.86 125-129 1.94 130-134 4.205 135-139 5.615 140-144 6.3950000000000005 145-149 4.0649999999999995 150-151 2.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16243654822335 97.675 2 0.7614213197969544 1.5 3 0.025380710659898477 0.075 4 0.025380710659898477 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025380710659898477 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 26 0.65 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 5.012499999999999 0.0 0.0 0.0 0.0 128-129 5.4875 0.0 0.0 0.0 0.0 130-131 5.875 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 6.824999999999999 0.0 0.0 0.0 0.0 136-137 7.35 0.0 0.0 0.0 0.0 138-139 7.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687317 spots for SRR7169993.sra Written 687317 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra Read 687299 spots for SRR7169993.sra Written 687299 spots for SRR7169993.sra SRR ids: ['SRR7169993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vm3xywt0 SRR7169993.sra spots: 13745998 blocks: [[1, 687299], [687300, 1374598], [1374599, 2061897], [2061898, 2749196], [2749197, 3436495], [3436496, 4123794], [4123795, 4811093], [4811094, 5498392], [5498393, 6185691], [6185692, 6872990], [6872991, 7560289], [7560290, 8247588], [8247589, 8934887], [8934888, 9622186], [9622187, 10309485], [10309486, 10996784], [10996785, 11684083], [11684084, 12371382], [12371383, 13058681], [13058682, 13745998]] SRR7169993 file size 4636367 SRR7169993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169993 SRR7169993_1.fastq SRR7169993_2.fastq Input file: SRR7169993_1.fastq Paired file: SRR7169993_2.fastq trimmed: SRR7169993-trimmed-pair1.fastq, SRR7169993-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:34:12 2025 >> started Wed Feb 12 08:34:28 2025 >> done (15.698s) 13745998 read pairs processed; of these: 31734 ( 0.23%) short read pairs filtered out after trimming by size control 48135 ( 0.35%) empty read pairs filtered out after trimming by size control 13666129 (99.42%) read pairs available; of these: 6605437 (48.33%) trimmed read pairs available after processing 7060692 (51.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 8 0.00% 21 8 0.00% 22 9 0.00% 23 9 0.00% 24 6 0.00% 25 8 0.00% 26 8 0.00% 27 9 0.00% 28 10 0.00% 29 9 0.00% 30 9 0.00% 31 11 0.00% 32 10 0.00% 33 15 0.00% 34 17 0.00% 35 21 0.00% 36 13 0.00% 37 23 0.00% 38 18 0.00% 39 30 0.00% 40 26 0.00% 41 32 0.00% 42 38 0.00% 43 51 0.00% 44 35 0.00% 45 49 0.00% 46 55 0.00% 47 60 0.00% 48 82 0.00% 49 94 0.00% 50 91 0.00% 51 125 0.00% 52 135 0.00% 53 130 0.00% 54 124 0.00% 55 152 0.00% 56 174 0.00% 57 208 0.00% 58 188 0.00% 59 210 0.00% 60 277 0.00% 61 307 0.00% 62 345 0.00% 63 405 0.00% 64 470 0.00% 65 448 0.00% 66 585 0.00% 67 837 0.01% 68 1025 0.01% 69 1392 0.01% 70 2319 0.02% 71 1779 0.01% 72 1525 0.01% 73 1516 0.01% 74 1541 0.01% 75 1661 0.01% 76 1819 0.01% 77 1983 0.01% 78 2130 0.02% 79 2289 0.02% 80 2665 0.02% 81 3160 0.02% 82 3517 0.03% 83 4085 0.03% 84 5795 0.04% 85 6862 0.05% 86 7192 0.05% 87 7709 0.06% 88 8079 0.06% 89 8419 0.06% 90 8775 0.06% 91 9378 0.07% 92 10021 0.07% 93 11059 0.08% 94 11887 0.09% 95 12795 0.09% 96 13421 0.10% 97 14138 0.10% 98 14903 0.11% 99 15342 0.11% 100 16399 0.12% 101 16622 0.12% 102 18037 0.13% 103 19170 0.14% 104 19803 0.14% 105 21812 0.16% 106 22753 0.17% 107 23595 0.17% 108 24289 0.18% 109 24992 0.18% 110 25997 0.19% 111 26789 0.20% 112 27614 0.20% 113 29504 0.22% 114 30639 0.22% 115 32421 0.24% 116 33597 0.25% 117 35082 0.26% 118 35776 0.26% 119 36584 0.27% 120 37158 0.27% 121 38045 0.28% 122 39620 0.29% 123 41077 0.30% 124 43211 0.32% 125 44876 0.33% 126 46974 0.34% 127 47973 0.35% 128 50245 0.37% 129 51762 0.38% 130 52953 0.39% 131 54742 0.40% 132 56746 0.42% 133 59924 0.44% 134 61688 0.45% 135 64829 0.47% 136 67987 0.50% 137 72686 0.53% 138 78186 0.57% 139 83431 0.61% 140 87384 0.64% 141 92683 0.68% 142 100270 0.73% 143 107340 0.79% 144 119212 0.87% 145 135089 0.99% 146 160168 1.17% 147 200765 1.47% 148 286716 2.10% 149 541093 3.96% 150 2952957 21.61% 151 7060692 51.67% 13666129 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.80 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=4.1 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=65.42 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.9 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=42 prefix-density=0.21 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=169.63 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169993 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:35:10 Started mapping on | Feb 12 08:35:10 Finished on | Feb 12 08:36:31 Mapping speed, Million of reads per hour | 607.38 Number of input reads | 13666129 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12943423 Uniquely mapped reads % | 94.71% Average mapped length | 291.75 Number of splices: Total | 11337585 Number of splices: Annotated (sjdb) | 11132353 Number of splices: GT/AG | 11173258 Number of splices: GC/AG | 128358 Number of splices: AT/AC | 11178 Number of splices: Non-canonical | 24791 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235775 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 17912 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513058 513058 513058 N_multimapping 235775 235775 235775 N_noFeature 267283 12760737 342569 N_ambiguous 160323 1014 52230 UnstrandedReadsAssigned:12515817 PositiveStrandReadsAssigned:181672 NegativeStrandReadsAssigned:12548624 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169993 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169993-trimmed-pair1.fastq SRR7169993-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,666,129 reads, 12,496,842 reads pseudoaligned [quant] estimated average fragment length: 222.599 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7169993.ke.tsv 34699 SRR7169993.se.tsv 87100 total ==> SRR7169993.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.4 243 9.71341 Potri.005G024800.1.v4.1 1035 813.401 25 2.20701 Potri.004G059700.1.v4.1 961 739.42 3 0.291339 Potri.007G009000.2.v4.1 1416 1194.4 0 0 Potri.003G141000.2.v4.1 2943 2721.4 186.03 4.90863 Potri.016G087400.1.v4.1 270 86.6456 1745 1446.17 Potri.015G069301.1.v4.1 564 344.968 0 0 Potri.010G195200.1.v4.1 1773 1551.4 37 1.71256 Potri.012G127500.1.v4.1 977 755.408 5972 567.685 ==> SRR7169993.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1143 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169993 completed mapping pipeline successfully