Starting /dee2/code/volunteer_pipeline.sh SRR7169995 current disk space = 3049346822144 free memory = 1578953912 SRR7169995 SRAfilesize 96e86ef3c2ec75428ba759d526d8bbf9 SRR7169995.sra SRR7169995.sra file validated SRR7169995 is paired end SRR7169995 is conventional basespace SRR7169995 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82025 34.0 33.0 34.0 33.0 34.0 2 33.395 34.0 34.0 34.0 33.0 34.0 3 33.402 34.0 34.0 34.0 33.0 34.0 4 33.53925 34.0 34.0 34.0 33.0 34.0 5 33.54675 34.0 34.0 34.0 33.0 34.0 6 37.275 38.0 38.0 38.0 36.0 38.0 7 37.5075 38.0 38.0 38.0 37.0 38.0 8 37.619 38.0 38.0 38.0 38.0 38.0 9 37.6695 38.0 38.0 38.0 38.0 38.0 10-14 37.63755 38.0 38.0 38.0 38.0 38.0 15-19 37.597350000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.53525 38.0 38.0 38.0 38.0 38.0 25-29 37.53075 38.0 38.0 38.0 38.0 38.0 30-34 37.535250000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.483050000000006 38.0 38.0 38.0 37.8 38.0 40-44 37.308299999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.2609 38.0 38.0 38.0 36.8 38.0 50-54 37.20025 38.0 38.0 38.0 36.6 38.0 55-59 37.12 38.0 38.0 38.0 36.0 38.0 60-64 37.0603 38.0 38.0 38.0 36.0 38.0 65-69 37.018649999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.93655 38.0 38.0 38.0 36.0 38.0 75-79 36.81635 38.0 38.0 38.0 35.2 38.0 80-84 36.728750000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.6409 38.0 38.0 38.0 34.6 38.0 90-94 36.5651 38.0 38.0 38.0 34.4 38.0 95-99 36.3425 38.0 38.0 38.0 34.0 38.0 100-104 36.16374999999999 38.0 37.8 38.0 33.8 38.0 105-109 36.0319 38.0 37.2 38.0 33.0 38.0 110-114 35.960899999999995 38.0 37.0 38.0 33.0 38.0 115-119 35.74175 38.0 36.8 38.0 31.6 38.0 120-124 35.513999999999996 38.0 36.2 38.0 30.6 38.0 125-129 35.18245 38.0 36.0 38.0 29.8 38.0 130-134 34.6839 38.0 35.2 38.0 27.2 38.0 135-139 34.3442 38.0 35.0 38.0 24.6 38.0 140-144 34.03445 38.0 35.0 38.0 23.4 38.0 145-149 33.17215 38.0 33.4 38.0 18.6 38.0 150-151 29.043875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 0.0 12 0.0 13 3.0 14 1.0 15 4.0 16 4.0 17 2.0 18 4.0 19 5.0 20 4.0 21 4.0 22 5.0 23 4.0 24 15.0 25 11.0 26 19.0 27 21.0 28 22.0 29 41.0 30 48.0 31 51.0 32 66.0 33 89.0 34 157.0 35 286.0 36 715.0 37 2415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.82165605095541 12.917197452229297 9.910828025477707 37.35031847133758 2 22.8 16.225 33.900000000000006 27.075 3 19.475 20.974999999999998 26.0 33.550000000000004 4 22.55 29.2 21.875 26.375 5 21.175 32.2 25.575 21.05 6 20.599999999999998 34.625 24.95 19.825 7 14.299999999999999 26.325 41.5 17.875 8 17.575 25.775 30.5 26.150000000000002 9 17.875 24.425 32.6 25.1 10-14 19.935 29.565 27.175 23.325000000000003 15-19 20.225 28.415000000000003 27.595 23.765 20-24 20.064999999999998 27.865000000000002 28.139999999999997 23.93 25-29 20.11 28.825 27.495000000000005 23.57 30-34 20.095 28.249999999999996 27.625 24.03 35-39 19.895 28.59 26.884999999999998 24.63 40-44 20.205000000000002 28.475 27.21 24.11 45-49 19.98 28.575 27.62 23.825 50-54 19.919999999999998 28.389999999999997 27.405 24.285 55-59 20.580000000000002 28.050000000000004 26.97 24.4 60-64 19.66 27.735 28.43 24.175 65-69 20.105 27.73 27.845 24.32 70-74 20.105 28.64 27.834999999999997 23.419999999999998 75-79 20.72 28.425 26.93 23.925 80-84 20.465 28.255000000000003 26.979999999999997 24.3 85-89 19.94199419941994 28.137813781378142 27.93279327932793 23.98739873987399 90-94 20.82498998798558 28.233880656788145 27.217661193432118 23.723468161794152 95-99 20.858803487323378 28.655175869325582 26.405451448040886 24.08056919531015 100-104 20.395 28.13 27.400000000000002 24.075 105-109 20.7 28.26 26.77 24.27 110-114 20.724999999999998 27.83 27.575 23.87 115-119 20.810000000000002 28.07 27.1 24.02 120-124 20.705000000000002 28.410000000000004 26.93 23.955000000000002 125-129 20.849999999999998 27.800000000000004 27.48 23.87 130-134 21.185000000000002 27.855 27.205000000000002 23.755000000000003 135-139 20.791237371211363 27.7333199959988 26.71301390417125 24.762428728618584 140-144 21.154999999999998 28.17 26.6 24.075 145-149 20.919999999999998 28.4 26.325 24.355 150-151 21.5375 27.55 26.5 24.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 3.0 26 2.5 27 5.0 28 6.5 29 9.5 30 15.5 31 18.5 32 24.5 33 39.0 34 50.0 35 58.0 36 80.0 37 94.0 38 111.5 39 149.0 40 174.0 41 198.5 42 246.0 43 263.0 44 262.5 45 283.0 46 288.0 47 275.0 48 251.5 49 226.0 50 188.5 51 161.0 52 129.0 53 86.5 54 71.0 55 59.0 56 41.0 57 31.5 58 25.5 59 15.5 60 9.0 61 10.0 62 9.5 63 3.0 64 3.5 65 5.0 66 2.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.12 95-99 0.21 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.03 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.9625 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.612500000000001 0.0 0.0 0.0 0.0 124-125 4.862500000000001 0.0 0.0 0.0 0.0 126-127 5.1125 0.0 0.0 0.0 0.0 128-129 5.475 0.0 0.0 0.0 0.0 130-131 5.9 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 6.775 0.0 0.0 0.0 0.0 136-137 7.275 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169995 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169995_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.877 33.0 33.0 34.0 32.0 34.0 2 32.225 34.0 33.0 34.0 32.0 34.0 3 32.1545 34.0 33.0 34.0 32.0 34.0 4 31.72275 34.0 33.0 34.0 32.0 34.0 5 31.753 34.0 33.0 34.0 32.0 34.0 6 36.18325 38.0 38.0 38.0 34.0 38.0 7 36.24525 38.0 38.0 38.0 35.0 38.0 8 36.20675 38.0 38.0 38.0 35.0 38.0 9 36.233 38.0 38.0 38.0 36.0 38.0 10-14 36.12115 38.0 38.0 38.0 35.8 38.0 15-19 35.917449999999995 38.0 38.0 38.0 35.0 38.0 20-24 35.996 38.0 38.0 38.0 35.0 38.0 25-29 36.128150000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.124900000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.03855 38.0 38.0 38.0 35.8 38.0 40-44 35.81335 38.0 38.0 38.0 35.2 38.0 45-49 35.71040000000001 38.0 38.0 38.0 34.2 38.0 50-54 35.9867 38.0 38.0 38.0 34.8 38.0 55-59 35.9099 38.0 38.0 38.0 34.8 38.0 60-64 35.8836 38.0 38.0 38.0 34.6 38.0 65-69 35.79715 38.0 38.0 38.0 34.0 38.0 70-74 35.7783 38.0 38.0 38.0 34.0 38.0 75-79 35.663 38.0 38.0 38.0 33.6 38.0 80-84 35.60835 38.0 38.0 38.0 33.8 38.0 85-89 35.1978 38.0 38.0 38.0 31.8 38.0 90-94 34.78105 38.0 38.0 38.0 28.6 38.0 95-99 35.194100000000006 38.0 38.0 38.0 29.6 38.0 100-104 35.20945 38.0 37.8 38.0 30.6 38.0 105-109 35.1191 38.0 37.8 38.0 30.0 38.0 110-114 34.9044 38.0 37.0 38.0 28.8 38.0 115-119 34.58455000000001 38.0 36.6 38.0 26.0 38.0 120-124 34.41565000000001 38.0 36.0 38.0 25.2 38.0 125-129 33.7659 38.0 35.4 38.0 18.2 38.0 130-134 32.755449999999996 38.0 33.8 38.0 13.4 38.0 135-139 31.336900000000004 38.0 33.0 38.0 2.0 38.0 140-144 30.42445 38.0 31.0 38.0 2.0 38.0 145-149 29.674649999999996 38.0 29.2 38.0 2.0 38.0 150-151 25.084125 33.0 14.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 105.0 3 15.0 4 2.0 5 0.0 6 2.0 7 3.0 8 1.0 9 1.0 10 2.0 11 2.0 12 2.0 13 4.0 14 2.0 15 5.0 16 5.0 17 2.0 18 6.0 19 11.0 20 12.0 21 11.0 22 16.0 23 19.0 24 15.0 25 32.0 26 33.0 27 43.0 28 42.0 29 36.0 30 59.0 31 67.0 32 100.0 33 138.0 34 157.0 35 208.0 36 529.0 37 2313.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.98348813209495 20.45923632610939 14.060887512899898 26.49638802889577 2 27.168659374205035 25.92215721190537 29.483591961332994 17.425591452556603 3 20.67110655737705 27.894467213114755 31.736680327868854 19.697745901639344 4 22.64591439688716 33.72243839169909 23.96887159533074 19.66277561608301 5 24.09043659043659 35.47297297297297 22.531185031185032 17.905405405405407 6 21.699078812691912 36.15660184237461 23.439099283520985 18.705220061412486 7 20.913032389696507 20.734506503442997 37.566947207345066 20.78551389951543 8 21.961783439490446 24.94267515923567 26.777070063694268 26.31847133757962 9 20.606988013261923 24.611068604947718 30.502422851313444 24.27952053047692 10-14 23.614741913988414 28.269004049413095 26.80301399354144 21.31324004305705 15-19 23.679464055655757 27.523834063385728 27.64751352744138 21.149188353517133 20-24 23.037857802400737 27.705960808453884 28.013747819842006 21.242433569303376 25-29 23.920725149792595 27.479899626158655 27.66425974292006 20.935115481128694 30-34 23.900789177001126 27.8569232346008 27.49308188992518 20.749205698472892 35-39 23.72002259538849 27.391773224464643 27.612591793765727 21.275612386381145 40-44 23.698347107438018 27.70144628099174 27.794421487603305 20.805785123966942 45-49 23.78959334470108 27.515113935823905 27.36009920942489 21.33519351005012 50-54 23.581523965587873 27.749897582957807 27.068824252355594 21.59975419909873 55-59 23.33999897451674 28.123878377685486 27.426549761575142 21.109572886222633 60-64 23.773604269293923 27.51949917898194 27.801724137931032 20.905172413793103 65-69 23.400543840747012 27.699964085988405 27.67944179364835 21.220050279616235 70-74 23.997551270278546 27.104377104377104 27.65023977145189 21.24783185389246 75-79 23.453581983083666 27.427901762967494 28.23295628248242 20.88555997146642 80-84 23.400991870750037 27.905312132522113 27.757042793598856 20.936653203128994 85-89 23.554748313440584 27.9605604566684 27.85677218474312 20.627919045147898 90-94 24.025940065896133 27.425343862768685 28.058155954186496 20.490560117148686 95-99 24.526364429840324 27.647995071109516 27.401550546798788 20.42408995225137 100-104 24.282357748493208 28.35836142609051 26.774951476146697 20.584329349269588 105-109 24.375993029573063 27.066782840448976 27.845830557121626 20.711393572856338 110-114 23.94554328281531 27.572566144361677 27.731826354996148 20.750064217826868 115-119 24.85261700927872 27.902804121597374 26.636591992618037 20.607986876505873 120-124 24.443314692425012 27.49872902897814 27.33604473817997 20.72191154041688 125-129 25.293996286362695 27.991541159480093 26.970290901588612 19.7441716525686 130-134 25.11239223567991 28.22235151002274 26.524567620458033 20.140688633839318 135-139 25.089256734826353 27.2963323596235 27.404522341231203 20.209888564318945 140-144 25.55378442258011 27.75792887374265 26.790523827845874 19.89776287583136 145-149 24.793607112616428 28.70977984758679 26.36007620660457 20.13653683319221 150-151 25.810618783102957 27.63208887740602 26.908668130732465 19.64862420875856 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 70.0 1 36.5 2 1.5 3 0.0 4 1.0 5 2.5 6 3.0 7 2.5 8 3.0 9 2.0 10 1.0 11 1.5 12 1.0 13 1.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.5 19 2.5 20 2.5 21 1.5 22 1.5 23 1.0 24 1.5 25 1.5 26 2.0 27 4.5 28 4.5 29 4.0 30 6.5 31 11.0 32 15.0 33 33.0 34 46.5 35 46.0 36 57.5 37 92.5 38 123.0 39 142.0 40 184.0 41 232.5 42 248.0 43 254.0 44 275.5 45 282.0 46 281.0 47 264.5 48 222.0 49 194.5 50 194.0 51 166.5 52 129.5 53 99.0 54 67.5 55 52.5 56 42.0 57 36.5 58 24.5 59 12.5 60 9.0 61 7.5 62 6.0 63 3.0 64 3.5 65 4.5 66 2.0 67 1.0 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.1 2 1.725 3 2.4 4 3.6249999999999996 5 3.8 6 2.3 7 1.975 8 1.875 9 1.975 10-14 2.455 15-19 2.9749999999999996 20-24 2.53 25-29 2.365 30-34 2.4299999999999997 35-39 2.635 40-44 3.2 45-49 3.235 50-54 2.36 55-59 2.485 60-64 2.56 65-69 2.545 70-74 1.9900000000000002 75-79 1.87 80-84 2.205 85-89 3.65 90-94 4.3950000000000005 95-99 2.6149999999999998 100-104 2.11 105-109 2.445 110-114 2.675 115-119 2.465 120-124 1.6500000000000001 125-129 3.06 130-134 5.465 135-139 7.57 140-144 9.035 145-149 5.52 150-151 3.2375000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.38556067588326 97.05 2 0.5376344086021506 1.05 3 0.025601638504864313 0.075 4 0.025601638504864313 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025601638504864313 1.725 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 69 1.725 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.2125000000000004 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.387499999999999 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.05 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.762499999999999 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.6375 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770178 spots for SRR7169995.sra Written 770178 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra Read 770163 spots for SRR7169995.sra Written 770163 spots for SRR7169995.sra SRR ids: ['SRR7169995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g14pegri SRR7169995.sra spots: 15403275 blocks: [[1, 770163], [770164, 1540326], [1540327, 2310489], [2310490, 3080652], [3080653, 3850815], [3850816, 4620978], [4620979, 5391141], [5391142, 6161304], [6161305, 6931467], [6931468, 7701630], [7701631, 8471793], [8471794, 9241956], [9241957, 10012119], [10012120, 10782282], [10782283, 11552445], [11552446, 12322608], [12322609, 13092771], [13092772, 13862934], [13862935, 14633097], [14633098, 15403275]] SRR7169995 file size 5197964 SRR7169995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169995 SRR7169995_1.fastq SRR7169995_2.fastq Input file: SRR7169995_1.fastq Paired file: SRR7169995_2.fastq trimmed: SRR7169995-trimmed-pair1.fastq, SRR7169995-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:15:52 2025 >> started Wed Feb 12 08:16:08 2025 >> done (16.363s) 15403275 read pairs processed; of these: 21820 ( 0.14%) short read pairs filtered out after trimming by size control 44186 ( 0.29%) empty read pairs filtered out after trimming by size control 15337269 (99.57%) read pairs available; of these: 7532623 (49.11%) trimmed read pairs available after processing 7804646 (50.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 10 0.00% 24 6 0.00% 25 7 0.00% 26 8 0.00% 27 13 0.00% 28 5 0.00% 29 9 0.00% 30 12 0.00% 31 15 0.00% 32 12 0.00% 33 13 0.00% 34 15 0.00% 35 19 0.00% 36 15 0.00% 37 20 0.00% 38 29 0.00% 39 38 0.00% 40 31 0.00% 41 42 0.00% 42 34 0.00% 43 33 0.00% 44 47 0.00% 45 40 0.00% 46 50 0.00% 47 65 0.00% 48 72 0.00% 49 85 0.00% 50 91 0.00% 51 139 0.00% 52 129 0.00% 53 152 0.00% 54 157 0.00% 55 171 0.00% 56 163 0.00% 57 206 0.00% 58 237 0.00% 59 277 0.00% 60 329 0.00% 61 358 0.00% 62 466 0.00% 63 488 0.00% 64 564 0.00% 65 597 0.00% 66 656 0.00% 67 751 0.00% 68 853 0.01% 69 998 0.01% 70 1270 0.01% 71 1278 0.01% 72 1441 0.01% 73 1630 0.01% 74 1754 0.01% 75 2107 0.01% 76 2145 0.01% 77 2293 0.01% 78 2539 0.02% 79 2810 0.02% 80 3121 0.02% 81 3727 0.02% 82 4353 0.03% 83 4859 0.03% 84 6084 0.04% 85 6910 0.05% 86 7522 0.05% 87 7571 0.05% 88 8043 0.05% 89 8685 0.06% 90 9332 0.06% 91 10030 0.07% 92 10763 0.07% 93 11893 0.08% 94 12706 0.08% 95 13319 0.09% 96 14389 0.09% 97 14386 0.09% 98 15187 0.10% 99 15445 0.10% 100 16310 0.11% 101 17371 0.11% 102 18718 0.12% 103 20199 0.13% 104 21093 0.14% 105 22020 0.14% 106 23132 0.15% 107 23324 0.15% 108 23941 0.16% 109 24941 0.16% 110 25064 0.16% 111 26418 0.17% 112 27855 0.18% 113 29318 0.19% 114 31020 0.20% 115 32412 0.21% 116 33190 0.22% 117 34289 0.22% 118 34916 0.23% 119 35118 0.23% 120 36070 0.24% 121 36963 0.24% 122 38388 0.25% 123 40424 0.26% 124 43110 0.28% 125 44433 0.29% 126 46505 0.30% 127 47661 0.31% 128 48586 0.32% 129 50676 0.33% 130 51988 0.34% 131 53528 0.35% 132 56603 0.37% 133 59646 0.39% 134 63248 0.41% 135 67366 0.44% 136 71014 0.46% 137 75186 0.49% 138 81374 0.53% 139 88457 0.58% 140 93389 0.61% 141 100305 0.65% 142 108012 0.70% 143 117946 0.77% 144 132214 0.86% 145 151178 0.99% 146 183977 1.20% 147 240815 1.57% 148 342726 2.23% 149 661382 4.31% 150 3562664 23.23% 151 7804646 50.89% 15337269 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=89.22 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=18.3 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.59 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=10 fanout-score=49.04 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=12.7 sequence=TGTTGGTGGTGG SRR7169995 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:16:53 Started mapping on | Feb 12 08:16:54 Finished on | Feb 12 08:18:19 Mapping speed, Million of reads per hour | 649.58 Number of input reads | 15337269 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14662973 Uniquely mapped reads % | 95.60% Average mapped length | 292.46 Number of splices: Total | 13817223 Number of splices: Annotated (sjdb) | 13587537 Number of splices: GT/AG | 13627532 Number of splices: GC/AG | 152890 Number of splices: AT/AC | 10348 Number of splices: Non-canonical | 26453 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269980 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 31140 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 421333 421333 421333 N_multimapping 269980 269980 269980 N_noFeature 271793 14491939 344604 N_ambiguous 152439 689 53729 UnstrandedReadsAssigned:14238741 PositiveStrandReadsAssigned:170345 NegativeStrandReadsAssigned:14264640 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169995 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169995-trimmed-pair1.fastq SRR7169995-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,337,269 reads, 14,170,973 reads pseudoaligned [quant] estimated average fragment length: 237.451 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR7169995.ke.tsv 34699 SRR7169995.se.tsv 87100 total ==> SRR7169995.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.55 212 8.19951 Potri.005G024800.1.v4.1 1035 798.549 30 2.58863 Potri.004G059700.1.v4.1 961 724.618 17 1.61655 Potri.007G009000.2.v4.1 1416 1179.55 0 0 Potri.003G141000.2.v4.1 2943 2706.55 246.078 6.2648 Potri.016G087400.1.v4.1 270 85.9513 1657 1328.37 Potri.015G069301.1.v4.1 564 334.109 0 0 Potri.010G195200.1.v4.1 1773 1536.55 15 0.672658 Potri.012G127500.1.v4.1 977 740.58 4757 442.599 ==> SRR7169995.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 968 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169995 completed mapping pipeline successfully