Starting /dee2/code/volunteer_pipeline.sh SRR7169996 current disk space = 3049714663424 free memory = 1297992396 SRR7169996 SRAfilesize d1a9219797424ecb73bffd1cff180d30 SRR7169996.sra SRR7169996.sra file validated SRR7169996 is paired end SRR7169996 is conventional basespace SRR7169996 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.45675 34.0 34.0 34.0 33.0 34.0 2 33.607 34.0 34.0 34.0 33.0 34.0 3 33.6745 34.0 34.0 34.0 33.0 34.0 4 33.68975 34.0 34.0 34.0 33.0 34.0 5 33.67275 34.0 34.0 34.0 33.0 34.0 6 37.22625 38.0 38.0 38.0 36.0 38.0 7 37.44775 38.0 38.0 38.0 37.0 38.0 8 37.6275 38.0 38.0 38.0 38.0 38.0 9 37.6315 38.0 38.0 38.0 38.0 38.0 10-14 37.58635 38.0 38.0 38.0 38.0 38.0 15-19 37.52585 38.0 38.0 38.0 38.0 38.0 20-24 37.50305000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.45605 38.0 38.0 38.0 37.4 38.0 30-34 37.362199999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.2604 38.0 38.0 38.0 36.6 38.0 40-44 36.812650000000005 38.0 38.0 38.0 35.2 38.0 45-49 36.677949999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.66855 38.0 38.0 38.0 34.4 38.0 55-59 36.6407 38.0 38.0 38.0 34.2 38.0 60-64 36.5642 38.0 38.0 38.0 34.0 38.0 65-69 36.401250000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.194599999999994 38.0 37.4 38.0 33.4 38.0 75-79 35.905550000000005 38.0 37.0 38.0 33.0 38.0 80-84 35.74895 38.0 37.0 38.0 32.6 38.0 85-89 35.62055 38.0 37.0 38.0 31.4 38.0 90-94 35.27325 38.0 36.6 38.0 29.4 38.0 95-99 35.144450000000006 38.0 36.4 38.0 29.0 38.0 100-104 35.100649999999995 38.0 36.0 38.0 29.0 38.0 105-109 34.8343 38.0 35.8 38.0 28.4 38.0 110-114 34.43795 38.0 35.2 38.0 26.0 38.0 115-119 34.059 38.0 34.8 38.0 23.0 38.0 120-124 33.806349999999995 38.0 34.4 38.0 21.4 38.0 125-129 33.36105 38.0 34.0 38.0 15.0 38.0 130-134 32.94095 38.0 33.8 38.0 15.0 38.0 135-139 32.08969999999999 37.2 32.4 38.0 14.2 38.0 140-144 31.3498 36.2 31.0 38.0 13.6 38.0 145-149 30.460249999999995 36.0 31.0 38.0 6.4 38.0 150-151 26.051625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 3.0 10 2.0 11 1.0 12 2.0 13 2.0 14 5.0 15 11.0 16 6.0 17 8.0 18 18.0 19 36.0 20 10.0 21 10.0 22 16.0 23 25.0 24 18.0 25 14.0 26 31.0 27 25.0 28 31.0 29 44.0 30 39.0 31 65.0 32 91.0 33 142.0 34 238.0 35 474.0 36 1071.0 37 1560.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.4486921529175 15.719315895372233 10.588531187122737 32.243460764587525 2 22.625 17.675 30.825000000000003 28.875 3 19.575 22.15 26.474999999999998 31.8 4 22.35 27.950000000000003 24.075 25.624999999999996 5 22.0 32.300000000000004 24.5 21.2 6 20.474999999999998 35.525 24.575 19.425 7 14.124999999999998 29.25 38.675 17.95 8 18.5 28.725 29.2 23.575 9 17.724999999999998 27.6 31.5 23.175 10-14 19.32 31.474999999999998 26.69 22.515 15-19 19.08 30.509999999999998 27.084999999999997 23.325000000000003 20-24 18.67 31.025000000000002 27.46 22.845 25-29 19.11 30.665 27.084999999999997 23.14 30-34 18.85 30.630000000000003 26.895000000000003 23.625 35-39 19.025 30.055 27.54 23.380000000000003 40-44 19.445 30.264999999999997 27.029999999999998 23.26 45-49 20.580000000000002 29.470000000000002 27.325 22.625 50-54 19.205 30.255 27.060000000000002 23.48 55-59 19.7 29.335 26.905 24.060000000000002 60-64 19.564999999999998 30.145 26.96 23.330000000000002 65-69 19.405 30.97 26.490000000000002 23.135 70-74 19.29 30.325000000000003 27.150000000000002 23.235 75-79 19.63 30.18 27.175 23.015 80-84 20.0 29.215000000000003 27.235 23.549999999999997 85-89 20.44 29.365000000000002 26.590000000000003 23.605 90-94 20.14014014014014 29.43943943943944 26.546546546546544 23.873873873873876 95-99 19.97898003102948 29.52805164906661 26.580251238676745 23.912717081227168 100-104 19.91 30.36 26.33 23.400000000000002 105-109 20.64 29.23 26.68 23.45 110-114 20.11 29.865000000000002 26.77 23.255 115-119 20.286014300715035 29.326466323316165 26.666333316665835 23.721186059302966 120-124 20.630157539384847 29.202300575143784 26.376594148537137 23.790947736934235 125-129 20.68 29.345 26.064999999999998 23.91 130-134 20.747261541539537 29.240234081928673 25.954083929375283 24.058420447156507 135-139 20.96233681788626 29.195218326414246 26.244185464912718 23.598259390786776 140-144 20.802280798279398 29.360276096633818 25.814034912219274 24.023408192867503 145-149 20.744334950727826 28.677905057275776 26.001700765344403 24.576059226651996 150-151 21.12764095511939 28.391048881110137 26.16577072134017 24.315539442430303 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.5 18 2.0 19 1.5 20 1.0 21 1.5 22 4.5 23 4.5 24 3.0 25 5.5 26 10.0 27 11.0 28 15.5 29 29.0 30 40.0 31 48.5 32 57.0 33 69.0 34 83.5 35 97.0 36 126.5 37 135.5 38 153.5 39 173.5 40 174.0 41 212.0 42 221.0 43 219.0 44 235.0 45 231.5 46 213.5 47 200.0 48 197.5 49 184.5 50 159.0 51 135.5 52 119.5 53 99.0 54 81.0 55 66.5 56 46.5 57 30.5 58 22.0 59 16.5 60 12.5 61 10.5 62 9.0 63 6.5 64 4.0 65 2.5 66 1.5 67 2.5 68 3.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.1 95-99 0.095 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.025 125-129 0.0 130-134 0.034999999999999996 135-139 0.034999999999999996 140-144 0.034999999999999996 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.53545734840698 95.875 2 1.2332990750256936 2.4 3 0.10277492291880781 0.3 4 0.051387461459403906 0.2 5 0.025693730729701953 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025693730729701953 0.22499999999999998 >10 0.025693730729701953 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCTTAATCTCGTATGC 35 0.8750000000000001 TruSeq Adapter, Index 11 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCTTAATCTCGTATGCC 9 0.22499999999999998 TruSeq Adapter, Index 11 (97% over 36bp) GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.4000000000000004 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.8625 0.0 0.0 0.0 0.0 122-123 5.4375 0.0 0.0 0.0 0.0 124-125 6.012499999999999 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.675 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.8 0.0 0.0 0.0 0.0 136-137 9.475 0.0 0.0 0.0 0.0 138-139 10.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAGC 10 0.006577216 146.82278 1 TGCATGT 10 0.006832588 144.9875 145 >>END_MODULE SRR7169996 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169996_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05825 34.0 33.0 34.0 33.0 34.0 2 33.1165 34.0 33.0 34.0 33.0 34.0 3 33.0105 34.0 33.0 34.0 33.0 34.0 4 32.83025 34.0 33.0 34.0 33.0 34.0 5 32.9735 34.0 33.0 34.0 33.0 34.0 6 37.1705 38.0 38.0 38.0 38.0 38.0 7 37.24125 38.0 38.0 38.0 38.0 38.0 8 37.106 38.0 38.0 38.0 38.0 38.0 9 37.15525 38.0 38.0 38.0 38.0 38.0 10-14 36.9351 38.0 38.0 38.0 37.6 38.0 15-19 36.83925 38.0 38.0 38.0 37.2 38.0 20-24 36.939099999999996 38.0 38.0 38.0 38.0 38.0 25-29 36.9042 38.0 38.0 38.0 37.6 38.0 30-34 36.90435 38.0 38.0 38.0 37.4 38.0 35-39 36.83115 38.0 38.0 38.0 37.6 38.0 40-44 36.72 38.0 38.0 38.0 37.2 38.0 45-49 36.71375 38.0 38.0 38.0 37.0 38.0 50-54 36.82165 38.0 38.0 38.0 37.0 38.0 55-59 36.85850000000001 38.0 38.0 38.0 37.0 38.0 60-64 36.77915 38.0 38.0 38.0 37.0 38.0 65-69 36.66735 38.0 38.0 38.0 36.6 38.0 70-74 36.3875 38.0 38.0 38.0 36.4 38.0 75-79 36.2787 38.0 38.0 38.0 36.0 38.0 80-84 36.155 38.0 38.0 38.0 35.6 38.0 85-89 35.814499999999995 38.0 38.0 38.0 35.2 38.0 90-94 35.68465 38.0 38.0 38.0 34.2 38.0 95-99 35.887299999999996 38.0 38.0 38.0 34.0 38.0 100-104 35.91945 38.0 38.0 38.0 34.4 38.0 105-109 35.79065 38.0 38.0 38.0 34.0 38.0 110-114 35.594199999999994 38.0 38.0 38.0 33.8 38.0 115-119 35.446250000000006 38.0 38.0 38.0 32.4 38.0 120-124 35.23105 38.0 38.0 38.0 31.4 38.0 125-129 34.80535 38.0 37.0 38.0 29.4 38.0 130-134 34.0708 38.0 36.0 38.0 23.8 38.0 135-139 33.32395 38.0 35.0 38.0 14.2 38.0 140-144 32.759100000000004 38.0 34.0 38.0 13.2 38.0 145-149 32.27655 38.0 33.0 38.0 6.4 38.0 150-151 27.908875000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 13.0 4 3.0 5 2.0 6 1.0 7 1.0 8 1.0 9 4.0 10 1.0 11 4.0 12 1.0 13 3.0 14 7.0 15 10.0 16 17.0 17 26.0 18 17.0 19 5.0 20 10.0 21 8.0 22 9.0 23 13.0 24 10.0 25 14.0 26 12.0 27 14.0 28 21.0 29 29.0 30 29.0 31 33.0 32 75.0 33 88.0 34 110.0 35 172.0 36 432.0 37 2774.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.766725131545975 22.92658481583563 14.206965672763719 22.099724379854674 2 27.776385058912005 28.854349461017797 26.798696415141638 16.570569064928552 3 20.80080584235709 29.790984638630068 29.916897506925206 19.491312012087636 4 24.94302355026589 34.591035705241836 22.23347682957711 18.23246391491517 5 25.144726906619685 35.313365215202616 22.35086836143972 17.191039516737984 6 23.309026904702037 36.61051043500126 22.504400301734975 17.57606235856173 7 21.7282089927154 24.114544084400904 36.071338859583015 18.08590806330068 8 22.997740396685913 28.044187798142104 25.30755711775044 23.65051468742154 9 22.69414425735109 27.142498115104296 27.117366172405127 23.045991455139482 10-14 24.683064801252588 28.622657709985354 25.127531693519874 21.566745795242184 15-19 24.755832194726988 27.888264763928948 27.03304488639239 20.322858154951675 20-24 25.036566298481866 27.97195743178494 26.756443233973876 20.23503303575932 25-29 24.603895448582097 28.544757291351296 26.415379957614288 20.435967302452315 30-34 24.832350123531487 27.83744264609489 26.904653859728732 20.425553370644884 35-39 24.193793347845897 27.484432744393256 27.02880575102516 21.292968156735686 40-44 24.949248883475438 27.633982947624848 27.167072675598863 20.249695493300855 45-49 24.361443340766268 27.28055949726333 27.17413338739104 21.183863774579365 50-54 24.286002623877284 28.433747098597234 26.798869714401047 20.481380563124432 55-59 24.553706505295008 28.028240040342915 27.453353504790723 19.964699949571358 60-64 23.44224155371232 29.481084361723646 26.926967428687032 20.149706655876997 65-69 23.730778926140662 28.78245525586085 26.75069321905722 20.736072598941266 70-74 23.364110798875952 28.904054596547574 27.177840224809312 20.55399437976716 75-79 23.006627836915044 28.77083751757381 27.78670415746134 20.43583048804981 80-84 23.660579154474824 28.670164463727172 27.60569064675613 20.063565735041873 85-89 23.421495184222596 28.35957804617031 27.386230443866893 20.8326963257402 90-94 23.73675631621842 28.132640586797063 27.791361043194783 20.33924205378973 95-99 23.963737093931 28.008058423570887 27.877109040543946 20.151095441954165 100-104 24.048721562311254 28.447755184215822 27.37064626535132 20.132876988121602 105-109 23.576499018275186 28.37436439611338 28.006846901273725 20.042289684337714 110-114 23.87517042872292 27.85436550017674 27.79376862091602 20.476695450184316 115-119 24.410715183193446 28.32085238980751 27.491581645474195 19.776850781524853 120-124 24.027701109048024 28.313343704521504 27.440156571485925 20.218798614944546 125-129 24.16996649406031 28.2617524621789 27.68809016143771 19.880190882323078 130-134 24.82225656877898 27.939206594538895 27.568263781555903 19.670273055126223 135-139 24.596732230200853 28.228743885940265 27.203663232386305 19.970860651472577 140-144 25.07984711241426 28.284203361432535 27.723964605476723 18.911984920676474 145-149 25.537579356952694 28.57874257628507 27.15543723121032 18.728240835551915 150-151 26.163601775523144 28.065948002536462 27.013316423589096 18.7571337983513 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 3.0 2 2.0 3 2.5 4 3.0 5 3.0 6 2.5 7 1.0 8 0.5 9 2.0 10 2.5 11 1.0 12 1.0 13 1.5 14 1.0 15 2.5 16 2.5 17 1.0 18 0.5 19 0.5 20 2.0 21 3.5 22 3.0 23 1.5 24 2.0 25 3.5 26 5.0 27 6.0 28 5.5 29 6.5 30 12.0 31 14.0 32 15.5 33 25.0 34 35.0 35 50.5 36 71.5 37 90.5 38 120.5 39 158.5 40 183.5 41 219.0 42 261.0 43 270.0 44 305.5 45 303.5 46 266.0 47 249.5 48 213.5 49 181.0 50 159.0 51 147.0 52 136.5 53 110.5 54 78.0 55 66.0 56 55.5 57 39.5 58 26.0 59 17.0 60 11.5 61 9.0 62 8.5 63 6.5 64 2.5 65 0.5 66 1.0 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.27499999999999997 3 0.7250000000000001 4 1.275 5 0.675 6 0.575 7 0.475 8 0.42500000000000004 9 0.525 10-14 1.005 15-19 1.195 20-24 0.865 25-29 0.91 30-34 0.835 35-39 1.2349999999999999 40-44 1.48 45-49 1.34 50-54 0.91 55-59 0.8500000000000001 60-64 1.1400000000000001 65-69 0.8250000000000001 70-74 0.36 75-79 0.42 80-84 0.89 85-89 1.8849999999999998 90-94 1.8399999999999999 95-99 0.7250000000000001 100-104 0.66 105-109 0.685 110-114 0.985 115-119 0.515 120-124 0.365 125-129 1.51 130-134 2.9499999999999997 135-139 3.91 140-144 4.505 145-149 2.34 150-151 1.4375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60717049264895 95.575 2 0.980139282950735 1.9 3 0.2321382512251741 0.675 4 0.07737941707505804 0.3 5 0.025793139025019347 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025793139025019347 0.2 9 0.0 0.0 >10 0.051586278050038695 1.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 34 0.8500000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 15 0.375 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 8 0.2 No Hit GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.3250000000000002 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.5875000000000004 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 4.275 0.0 0.0 0.0 0.0 120-121 4.824999999999999 0.0 0.0 0.0 0.0 122-123 5.375 0.0 0.0 0.0 0.0 124-125 5.9 0.0 0.0 0.0 0.0 126-127 6.4375 0.0 0.0 0.0 0.0 128-129 6.975 0.0 0.0 0.0 0.0 130-131 7.5125 0.0 0.0 0.0 0.0 132-133 7.95 0.0 0.0 0.0 0.0 134-135 8.6125 0.0 0.0 0.0 0.0 136-137 9.3 0.0 0.0 0.0 0.0 138-139 10.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACTCC 10 0.0069573796 144.1125 7 ATTAGGG 10 0.0069573796 144.1125 6 AATTAGG 10 0.0069573796 144.1125 5 ACACTCT 10 0.0069573796 144.1125 3 CATTAAT 10 0.0069573796 144.1125 1 ATTAATT 10 0.0069573796 144.1125 2 TTAGGGC 10 0.0069573796 144.1125 7 TGGTGAT 10 0.0069573796 144.1125 4 >>END_MODULE Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527947 spots for SRR7169996.sra Written 527947 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra Read 527946 spots for SRR7169996.sra Written 527946 spots for SRR7169996.sra SRR ids: ['SRR7169996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e37n3u6p SRR7169996.sra spots: 10558921 blocks: [[1, 527946], [527947, 1055892], [1055893, 1583838], [1583839, 2111784], [2111785, 2639730], [2639731, 3167676], [3167677, 3695622], [3695623, 4223568], [4223569, 4751514], [4751515, 5279460], [5279461, 5807406], [5807407, 6335352], [6335353, 6863298], [6863299, 7391244], [7391245, 7919190], [7919191, 8447136], [8447137, 8975082], [8975083, 9503028], [9503029, 10030974], [10030975, 10558921]] SRR7169996 file size 3556371 SRR7169996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169996 SRR7169996_1.fastq SRR7169996_2.fastq Input file: SRR7169996_1.fastq Paired file: SRR7169996_2.fastq trimmed: SRR7169996-trimmed-pair1.fastq, SRR7169996-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:44:51 2025 >> started Wed Feb 12 08:45:03 2025 >> done (12.112s) 10558921 read pairs processed; of these: 25606 ( 0.24%) short read pairs filtered out after trimming by size control 105780 ( 1.00%) empty read pairs filtered out after trimming by size control 10427535 (98.76%) read pairs available; of these: 6166479 (59.14%) trimmed read pairs available after processing 4261056 (40.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 14 0.00% 21 14 0.00% 22 16 0.00% 23 12 0.00% 24 11 0.00% 25 13 0.00% 26 15 0.00% 27 18 0.00% 28 27 0.00% 29 25 0.00% 30 23 0.00% 31 33 0.00% 32 32 0.00% 33 29 0.00% 34 28 0.00% 35 23 0.00% 36 21 0.00% 37 37 0.00% 38 36 0.00% 39 44 0.00% 40 50 0.00% 41 59 0.00% 42 62 0.00% 43 66 0.00% 44 71 0.00% 45 97 0.00% 46 101 0.00% 47 108 0.00% 48 121 0.00% 49 135 0.00% 50 149 0.00% 51 156 0.00% 52 198 0.00% 53 235 0.00% 54 231 0.00% 55 254 0.00% 56 267 0.00% 57 277 0.00% 58 380 0.00% 59 314 0.00% 60 403 0.00% 61 410 0.00% 62 469 0.00% 63 584 0.01% 64 673 0.01% 65 944 0.01% 66 1412 0.01% 67 2517 0.02% 68 3926 0.04% 69 4358 0.04% 70 5277 0.05% 71 4538 0.04% 72 3441 0.03% 73 2787 0.03% 74 2450 0.02% 75 2417 0.02% 76 2397 0.02% 77 2437 0.02% 78 2447 0.02% 79 2868 0.03% 80 3159 0.03% 81 3543 0.03% 82 4207 0.04% 83 5063 0.05% 84 6310 0.06% 85 6976 0.07% 86 7564 0.07% 87 7850 0.08% 88 8535 0.08% 89 8882 0.09% 90 9662 0.09% 91 10149 0.10% 92 10669 0.10% 93 11521 0.11% 94 12317 0.12% 95 13145 0.13% 96 13621 0.13% 97 14233 0.14% 98 14488 0.14% 99 15177 0.15% 100 15624 0.15% 101 16769 0.16% 102 17544 0.17% 103 18986 0.18% 104 19870 0.19% 105 21229 0.20% 106 21574 0.21% 107 22367 0.21% 108 23277 0.22% 109 23667 0.23% 110 23940 0.23% 111 24558 0.24% 112 26037 0.25% 113 28137 0.27% 114 28982 0.28% 115 29959 0.29% 116 30472 0.29% 117 31021 0.30% 118 30770 0.30% 119 31590 0.30% 120 32512 0.31% 121 33445 0.32% 122 34602 0.33% 123 36812 0.35% 124 38786 0.37% 125 39710 0.38% 126 41198 0.40% 127 42582 0.41% 128 42647 0.41% 129 43886 0.42% 130 45485 0.44% 131 46581 0.45% 132 49300 0.47% 133 52429 0.50% 134 55424 0.53% 135 59172 0.57% 136 61543 0.59% 137 64439 0.62% 138 69288 0.66% 139 72550 0.70% 140 76325 0.73% 141 82917 0.80% 142 91308 0.88% 143 100705 0.97% 144 115094 1.10% 145 134919 1.29% 146 168030 1.61% 147 229484 2.20% 148 335851 3.22% 149 626201 6.01% 150 2519237 24.16% 151 4261056 40.86% 10427535 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=31.44 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=10.2 sequence=CCATCACCAACAGGAAGCATGCAAATTTCAATCCTGGGGTCAGC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.93 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=3.6 sequence=CAGCACCAGCACCTGAAAAGCCAAAGAAGAGATCCAAAGCTGCAGCGAGTCCAGAATCTCCTGCGGATACTTCTGGGGCAGTAAGCTTTACTGTTCTGAACAATGTTGTGTTCTTTGGAGTTTGCATGGTTGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=251.36 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=14.5 sequence=AGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGC SRR7169996 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:45:53 Started mapping on | Feb 12 08:45:54 Finished on | Feb 12 08:48:06 Mapping speed, Million of reads per hour | 284.39 Number of input reads | 10427535 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 9296693 Uniquely mapped reads % | 89.16% Average mapped length | 289.75 Number of splices: Total | 7392268 Number of splices: Annotated (sjdb) | 7250404 Number of splices: GT/AG | 7282540 Number of splices: GC/AG | 85483 Number of splices: AT/AC | 6028 Number of splices: Non-canonical | 18217 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167299 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 12410 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 981476 981476 981476 N_multimapping 167299 167299 167299 N_noFeature 203657 9154061 260418 N_ambiguous 123172 533 36954 UnstrandedReadsAssigned:8969864 PositiveStrandReadsAssigned:142099 NegativeStrandReadsAssigned:8999321 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169996 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169996-trimmed-pair1.fastq SRR7169996-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,427,535 reads, 9,000,754 reads pseudoaligned [quant] estimated average fragment length: 219.19 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR7169996.ke.tsv 34699 SRR7169996.se.tsv 87100 total ==> SRR7169996.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.81 126 6.7141 Potri.005G024800.1.v4.1 1035 816.81 15 1.76122 Potri.004G059700.1.v4.1 961 742.82 2 0.25822 Potri.007G009000.2.v4.1 1416 1197.81 0 0 Potri.003G141000.2.v4.1 2943 2724.81 142 4.99799 Potri.016G087400.1.v4.1 270 87.992 1006 1096.47 Potri.015G069301.1.v4.1 564 348.049 0 0 Potri.010G195200.1.v4.1 1773 1554.81 1 0.0616831 Potri.012G127500.1.v4.1 977 758.82 3926 496.198 ==> SRR7169996.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 740 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169996 completed mapping pipeline successfully