Starting /dee2/code/volunteer_pipeline.sh SRR7169997 current disk space = 3049749655552 free memory = 1477465652 SRR7169997 SRAfilesize 3c039e1e981e9c55d9561b5320dbac60 SRR7169997.sra SRR7169997.sra file validated SRR7169997 is paired end SRR7169997 is conventional basespace SRR7169997 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9105 34.0 33.0 34.0 33.0 34.0 2 33.421 34.0 34.0 34.0 33.0 34.0 3 33.3915 34.0 34.0 34.0 33.0 34.0 4 33.519 34.0 34.0 34.0 33.0 34.0 5 33.4985 34.0 34.0 34.0 33.0 34.0 6 37.151 38.0 38.0 38.0 36.0 38.0 7 37.46375 38.0 38.0 38.0 37.0 38.0 8 37.50375 38.0 38.0 38.0 38.0 38.0 9 37.55325 38.0 38.0 38.0 38.0 38.0 10-14 37.579899999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.539550000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.50425 38.0 38.0 38.0 38.0 38.0 25-29 37.46815 38.0 38.0 38.0 38.0 38.0 30-34 37.4511 38.0 38.0 38.0 37.8 38.0 35-39 37.45075 38.0 38.0 38.0 37.6 38.0 40-44 37.234500000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.20845 38.0 38.0 38.0 36.8 38.0 50-54 37.13525 38.0 38.0 38.0 36.4 38.0 55-59 37.09605 38.0 38.0 38.0 36.0 38.0 60-64 37.0688 38.0 38.0 38.0 36.0 38.0 65-69 36.980599999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.9408 38.0 38.0 38.0 35.8 38.0 75-79 36.75765 38.0 38.0 38.0 35.4 38.0 80-84 36.67385 38.0 38.0 38.0 35.0 38.0 85-89 36.60095 38.0 38.0 38.0 34.8 38.0 90-94 36.4813 38.0 38.0 38.0 34.2 38.0 95-99 36.32099999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.179899999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.0654 38.0 37.6 38.0 33.4 38.0 110-114 35.73245 38.0 37.0 38.0 31.6 38.0 115-119 35.6408 38.0 37.0 38.0 31.0 38.0 120-124 35.55485 38.0 37.0 38.0 31.2 38.0 125-129 35.0873 38.0 36.0 38.0 28.2 38.0 130-134 34.70415 38.0 35.4 38.0 27.6 38.0 135-139 34.24264999999999 38.0 35.0 38.0 24.0 38.0 140-144 34.05815 38.0 35.0 38.0 23.4 38.0 145-149 33.27355 38.0 34.6 38.0 17.0 38.0 150-151 29.404125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 3.0 13 2.0 14 2.0 15 1.0 16 1.0 17 3.0 18 9.0 19 9.0 20 5.0 21 9.0 22 10.0 23 8.0 24 15.0 25 21.0 26 21.0 27 24.0 28 22.0 29 30.0 30 44.0 31 50.0 32 69.0 33 89.0 34 122.0 35 220.0 36 666.0 37 2540.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.64007137394851 13.739485087942901 8.590364516951313 34.03007902115728 2 21.875 15.8 32.45 29.875 3 19.8 19.400000000000002 26.35 34.449999999999996 4 21.75 27.525 23.5 27.224999999999998 5 22.15 32.1 24.575 21.175 6 19.075 35.225 24.65 21.05 7 13.900000000000002 28.199999999999996 40.175 17.724999999999998 8 17.5 26.974999999999998 29.825000000000003 25.7 9 17.424999999999997 26.35 31.525 24.7 10-14 20.095 30.555 26.235000000000003 23.115 15-19 19.735 29.354999999999997 26.939999999999998 23.97 20-24 19.395 28.634999999999998 27.165 24.805 25-29 19.475 29.515 26.82 24.19 30-34 20.11 29.255 26.8 23.835 35-39 20.07 28.860000000000003 26.96 24.11 40-44 20.0 28.970000000000002 27.37 23.66 45-49 19.31 28.79 27.439999999999998 24.46 50-54 19.935 28.785 27.005000000000003 24.275 55-59 20.405 28.549999999999997 26.795 24.25 60-64 19.75 29.134999999999998 26.790000000000003 24.325 65-69 20.14 28.810000000000002 26.775 24.275 70-74 20.474999999999998 28.825 27.16 23.54 75-79 20.46 29.080000000000002 26.465 23.995 80-84 20.47 28.77 27.065 23.695 85-89 20.544999999999998 28.375 27.02 24.060000000000002 90-94 20.345 28.48 27.095000000000002 24.08 95-99 20.615 28.325 26.825 24.235 100-104 20.745 28.325 26.650000000000002 24.279999999999998 105-109 20.62 28.395 26.525 24.46 110-114 20.655 28.92 26.435 23.990000000000002 115-119 21.05 28.895 25.96 24.095 120-124 21.145 28.34 26.215 24.3 125-129 21.175 28.08 26.195 24.55 130-134 21.325 28.050000000000004 26.11 24.515 135-139 21.615000000000002 28.395 25.19 24.8 140-144 21.65 28.505000000000003 25.650000000000002 24.195 145-149 21.865000000000002 27.515 25.685000000000002 24.935 150-151 21.825 27.400000000000002 26.375 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 3.0 26 6.0 27 8.0 28 13.0 29 15.0 30 14.5 31 21.5 32 32.0 33 45.5 34 46.0 35 66.5 36 90.0 37 89.5 38 117.5 39 156.0 40 188.5 41 210.5 42 219.0 43 235.5 44 268.5 45 274.5 46 256.5 47 240.0 48 221.0 49 215.0 50 200.5 51 173.0 52 135.0 53 101.5 54 85.0 55 66.5 56 47.5 57 36.0 58 27.5 59 23.0 60 15.5 61 6.0 62 6.0 63 6.0 64 4.0 65 2.5 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.5287009063444109 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025176233635448138 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCGCATCTCGTATGC 8 0.2 TruSeq Adapter, Index 4 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0125 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.075 0.025 0.0 0.0 0.0 76-77 0.075 0.025 0.0 0.0 0.0 78-79 0.075 0.025 0.0 0.0 0.0 80-81 0.0875 0.025 0.0 0.0 0.0 82-83 0.1 0.025 0.0 0.0 0.0 84-85 0.1 0.025 0.0 0.0 0.0 86-87 0.15 0.025 0.0 0.0 0.0 88-89 0.30000000000000004 0.025 0.0 0.0 0.0 90-91 0.4625 0.025 0.0 0.0 0.0 92-93 0.6125 0.025 0.0 0.0 0.0 94-95 0.7875 0.025 0.0 0.0 0.0 96-97 1.0375 0.025 0.0 0.0 0.0 98-99 1.3624999999999998 0.025 0.0 0.0 0.0 100-101 1.6125 0.025 0.0 0.0 0.0 102-103 1.9875 0.025 0.0 0.0 0.0 104-105 2.525 0.025 0.0 0.0 0.0 106-107 2.95 0.025 0.0 0.0 0.0 108-109 3.4 0.025 0.0 0.0 0.0 110-111 3.8875 0.025 0.0 0.0 0.0 112-113 4.449999999999999 0.025 0.0 0.0 0.0 114-115 4.925000000000001 0.025 0.0 0.0 0.0 116-117 5.4625 0.025 0.0 0.0 0.0 118-119 6.05 0.025 0.0 0.0 0.0 120-121 6.775 0.025 0.0 0.0 0.0 122-123 7.4375 0.025 0.0 0.0 0.0 124-125 8.05 0.025 0.0 0.0 0.0 126-127 8.6875 0.025 0.0 0.0 0.0 128-129 9.3625 0.025 0.0 0.0 0.0 130-131 10.149999999999999 0.025 0.0 0.0 0.0 132-133 10.8875 0.025 0.0 0.0 0.0 134-135 11.5375 0.025 0.0 0.0 0.0 136-137 12.274999999999999 0.025 0.0 0.0 0.0 138-139 12.95 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTTGC 10 0.0068343505 144.975 4 AGTTGCA 10 0.0068343505 144.975 5 >>END_MODULE SRR7169997 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169997_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8545 33.0 33.0 34.0 32.0 34.0 2 32.36725 34.0 33.0 34.0 32.0 34.0 3 32.37925 34.0 33.0 34.0 32.0 34.0 4 32.25475 34.0 33.0 34.0 32.0 34.0 5 32.12625 34.0 33.0 34.0 32.0 34.0 6 36.347 38.0 38.0 38.0 36.0 38.0 7 36.33025 38.0 38.0 38.0 36.0 38.0 8 36.37625 38.0 38.0 38.0 36.0 38.0 9 36.41275 38.0 38.0 38.0 36.0 38.0 10-14 36.3537 38.0 38.0 38.0 36.0 38.0 15-19 36.12195 38.0 38.0 38.0 35.4 38.0 20-24 36.27585 38.0 38.0 38.0 36.0 38.0 25-29 36.334500000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.42055 38.0 38.0 38.0 36.6 38.0 35-39 36.2945 38.0 38.0 38.0 36.0 38.0 40-44 36.1427 38.0 38.0 38.0 36.0 38.0 45-49 36.0418 38.0 38.0 38.0 35.4 38.0 50-54 36.2342 38.0 38.0 38.0 35.8 38.0 55-59 36.140550000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.12585 38.0 38.0 38.0 35.6 38.0 65-69 36.05185 38.0 38.0 38.0 35.2 38.0 70-74 35.9828 38.0 38.0 38.0 34.6 38.0 75-79 35.878099999999996 38.0 38.0 38.0 34.2 38.0 80-84 35.8493 38.0 38.0 38.0 34.0 38.0 85-89 35.5634 38.0 38.0 38.0 33.6 38.0 90-94 35.1241 38.0 38.0 38.0 30.0 38.0 95-99 35.49679999999999 38.0 38.0 38.0 32.0 38.0 100-104 35.53705 38.0 38.0 38.0 32.8 38.0 105-109 35.3843 38.0 38.0 38.0 32.0 38.0 110-114 35.187650000000005 38.0 38.0 38.0 30.8 38.0 115-119 34.9026 38.0 37.2 38.0 28.2 38.0 120-124 34.667 38.0 37.0 38.0 27.0 38.0 125-129 34.31595 38.0 36.2 38.0 24.8 38.0 130-134 33.273700000000005 38.0 35.6 38.0 14.2 38.0 135-139 32.2787 38.0 34.6 38.0 6.4 38.0 140-144 31.438049999999997 38.0 33.4 38.0 2.0 38.0 145-149 30.72335 38.0 31.6 38.0 2.0 38.0 150-151 26.920625 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 80.0 3 8.0 4 4.0 5 4.0 6 1.0 7 2.0 8 1.0 9 3.0 10 4.0 11 1.0 12 5.0 13 5.0 14 5.0 15 3.0 16 6.0 17 13.0 18 10.0 19 4.0 20 13.0 21 12.0 22 14.0 23 11.0 24 12.0 25 22.0 26 20.0 27 26.0 28 46.0 29 46.0 30 56.0 31 58.0 32 86.0 33 130.0 34 128.0 35 196.0 36 427.0 37 2538.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.68377397615345 21.82477967858994 14.074650077760499 24.416796267496114 2 28.028204482498108 27.04608410979602 28.128934777134223 16.796776630571646 3 21.851289833080425 29.261507334344966 30.652503793626707 18.234699038947902 4 24.22772529997447 33.77584886392647 23.308654582588716 18.68777125351034 5 25.78825942066137 35.76006152268649 21.302230197385285 17.149448859266855 6 22.45158002038736 36.08562691131498 23.063200815494394 18.399592252803263 7 20.408163265306122 21.096938775510203 38.75 19.744897959183675 8 22.75967413441955 24.516293279022403 26.960285132382893 25.76374745417515 9 22.33528364283897 25.184431442381072 28.97481556855762 23.505469346222334 10-14 23.80660954712362 27.942676458588334 26.132190942472462 22.118523051815586 15-19 24.027237354085603 27.605979930370673 27.508703665779233 20.858079049764488 20-24 23.702342673403766 28.321339253815136 26.713622212014492 21.262695860766602 25-29 24.149694501018327 28.034623217922604 26.853360488798373 20.962321792260692 30-34 23.95011453296004 27.65589208449987 27.493000763553066 20.90099261898702 35-39 23.786680275580505 27.34371013013524 27.144679765246238 21.724929829038018 40-44 23.745391233101188 27.16099959033183 27.263416632527655 21.830192544039328 45-49 23.994665572425113 28.24169060320066 26.590069757899055 21.173574066475172 50-54 24.356162986383804 28.216635218522107 27.222193890560458 20.20500790453363 55-59 24.241187573330613 27.35805744018773 27.633525480793757 20.767229505687904 60-64 24.64389646193904 27.814366671772095 26.905600653494666 20.636136212794202 65-69 23.742290636627757 27.97288342932871 27.58550384831031 20.69932208573322 70-74 24.410167943579076 27.439240955908467 27.637120097417423 20.51347100309503 75-79 24.73183566079741 27.30722525804493 27.49949402954868 20.461445051608987 80-84 23.882191362734627 27.315733251945673 27.961747799989826 20.840327585329874 85-89 24.55400750604082 27.016605830034447 28.2299110585574 20.199475605367333 90-94 24.537588725972746 27.666960261126366 27.133309154966064 20.66214185793482 95-99 24.41659023744013 27.01008865790278 27.51452155304188 21.058799551615202 100-104 23.998574846032472 27.459663052883393 28.121341680663715 20.42042042042042 105-109 24.4582674756539 28.042624789680314 27.328812522306634 20.17029521235915 110-114 24.74337367856596 27.981206271385528 27.30708339717073 19.968336652877788 115-119 25.449284191288456 27.109351203167837 27.759163366839275 19.682201238704437 120-124 24.997472960679268 27.286970585262303 27.539674517335488 20.175881936722938 125-129 25.830900804014956 28.032979976442874 27.018999334255135 19.11711988528704 130-134 26.10180175447812 27.625151021694595 27.304722382728368 18.968324841098912 135-139 26.28030181409536 26.847541071333016 27.254240916144912 19.617916198426713 140-144 26.130952380952383 27.505411255411254 26.6991341991342 19.664502164502164 145-149 26.99396166972959 27.429771593594122 26.652664741401942 18.92360199527435 150-151 27.056860480041074 26.99268386599923 26.877165960723914 19.073289693235786 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 36.0 1 23.0 2 5.0 3 3.0 4 4.0 5 2.0 6 5.5 7 5.0 8 0.5 9 2.0 10 2.5 11 1.0 12 0.5 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.5 22 0.5 23 0.0 24 1.0 25 2.5 26 3.0 27 2.5 28 1.5 29 3.0 30 9.5 31 11.5 32 11.5 33 15.5 34 25.0 35 36.5 36 57.0 37 80.5 38 108.0 39 134.5 40 173.0 41 222.5 42 240.5 43 262.0 44 300.0 45 308.0 46 290.0 47 270.0 48 239.0 49 208.0 50 195.5 51 169.5 52 135.0 53 109.0 54 78.0 55 56.5 56 45.5 57 33.5 58 20.5 59 15.5 60 10.0 61 5.0 62 7.0 63 7.0 64 4.0 65 3.0 66 2.0 67 2.0 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.55 2 0.7250000000000001 3 1.15 4 2.075 5 2.475 6 1.9 7 2.0 8 1.7999999999999998 9 1.725 10-14 1.96 15-19 2.34 20-24 2.035 25-29 1.7999999999999998 30-34 1.775 35-39 2.025 40-44 2.36 45-49 2.52 50-54 1.955 55-59 1.9849999999999999 60-64 2.0650000000000004 65-69 1.905 70-74 1.455 75-79 1.18 80-84 1.7049999999999998 85-89 2.7449999999999997 90-94 3.495 95-99 1.87 100-104 1.765 105-109 1.9349999999999998 110-114 2.095 115-119 1.51 120-124 1.0699999999999998 125-129 2.365 130-134 4.8149999999999995 135-139 6.565 140-144 7.6 145-149 4.775 150-151 2.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.20877998979071 97.175 2 0.5104645227156712 1.0 3 0.05104645227156713 0.15 4 0.1276161306789178 0.5 5 0.05104645227156713 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025523226135783564 0.2 9 0.0 0.0 >10 0.025523226135783564 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 29 0.7250000000000001 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.9249999999999998 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.325 0.0 0.0 0.0 0.0 110-111 3.8 0.0 0.0 0.0 0.0 112-113 4.387499999999999 0.0 0.0 0.0 0.0 114-115 4.875 0.0 0.0 0.0 0.0 116-117 5.4125 0.0 0.0 0.0 0.0 118-119 5.925000000000001 0.0 0.0 0.0 0.0 120-121 6.5625 0.0 0.0 0.0 0.0 122-123 7.199999999999999 0.0 0.0 0.0 0.0 124-125 7.7875 0.0 0.0 0.0 0.0 126-127 8.3 0.0 0.0 0.0 0.0 128-129 8.8875 0.0 0.0 0.0 0.0 130-131 9.5375 0.0 0.0 0.0 0.0 132-133 10.1625 0.0 0.0 0.0 0.0 134-135 10.7875 0.0 0.0 0.0 0.0 136-137 11.475000000000001 0.0 0.0 0.0 0.0 138-139 12.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 20 0.0061443853 28.789612 60-64 >>END_MODULE Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778232 spots for SRR7169997.sra Written 778232 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra Read 778220 spots for SRR7169997.sra Written 778220 spots for SRR7169997.sra SRR ids: ['SRR7169997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nfxm3kmh SRR7169997.sra spots: 15564412 blocks: [[1, 778220], [778221, 1556440], [1556441, 2334660], [2334661, 3112880], [3112881, 3891100], [3891101, 4669320], [4669321, 5447540], [5447541, 6225760], [6225761, 7003980], [7003981, 7782200], [7782201, 8560420], [8560421, 9338640], [9338641, 10116860], [10116861, 10895080], [10895081, 11673300], [11673301, 12451520], [12451521, 13229740], [13229741, 14007960], [14007961, 14786180], [14786181, 15564412]] SRR7169997 file size 5252568 SRR7169997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169997 SRR7169997_1.fastq SRR7169997_2.fastq Input file: SRR7169997_1.fastq Paired file: SRR7169997_2.fastq trimmed: SRR7169997-trimmed-pair1.fastq, SRR7169997-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:44:59 2025 >> started Wed Feb 12 07:45:16 2025 >> done (16.764s) 15564412 read pairs processed; of these: 26948 ( 0.17%) short read pairs filtered out after trimming by size control 59662 ( 0.38%) empty read pairs filtered out after trimming by size control 15477802 (99.44%) read pairs available; of these: 7895702 (51.01%) trimmed read pairs available after processing 7582100 (48.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 7 0.00% 21 8 0.00% 22 12 0.00% 23 3 0.00% 24 11 0.00% 25 9 0.00% 26 13 0.00% 27 15 0.00% 28 18 0.00% 29 14 0.00% 30 21 0.00% 31 36 0.00% 32 18 0.00% 33 30 0.00% 34 20 0.00% 35 37 0.00% 36 33 0.00% 37 21 0.00% 38 57 0.00% 39 36 0.00% 40 46 0.00% 41 48 0.00% 42 69 0.00% 43 61 0.00% 44 80 0.00% 45 88 0.00% 46 113 0.00% 47 123 0.00% 48 118 0.00% 49 135 0.00% 50 179 0.00% 51 212 0.00% 52 240 0.00% 53 207 0.00% 54 263 0.00% 55 297 0.00% 56 303 0.00% 57 327 0.00% 58 364 0.00% 59 435 0.00% 60 479 0.00% 61 581 0.00% 62 725 0.00% 63 764 0.00% 64 905 0.01% 65 979 0.01% 66 1136 0.01% 67 1309 0.01% 68 1515 0.01% 69 2216 0.01% 70 2671 0.02% 71 2352 0.02% 72 2343 0.02% 73 2634 0.02% 74 2967 0.02% 75 3186 0.02% 76 3455 0.02% 77 3836 0.02% 78 4169 0.03% 79 4807 0.03% 80 5353 0.03% 81 6020 0.04% 82 6842 0.04% 83 7780 0.05% 84 9516 0.06% 85 10959 0.07% 86 11761 0.08% 87 12466 0.08% 88 13144 0.08% 89 13931 0.09% 90 14747 0.10% 91 15950 0.10% 92 17347 0.11% 93 19171 0.12% 94 20314 0.13% 95 22051 0.14% 96 23206 0.15% 97 23971 0.15% 98 24530 0.16% 99 25479 0.16% 100 27238 0.18% 101 28322 0.18% 102 30529 0.20% 103 32595 0.21% 104 34130 0.22% 105 35774 0.23% 106 37397 0.24% 107 37780 0.24% 108 38906 0.25% 109 39834 0.26% 110 41061 0.27% 111 42345 0.27% 112 44779 0.29% 113 47006 0.30% 114 48541 0.31% 115 50914 0.33% 116 52046 0.34% 117 53811 0.35% 118 53616 0.35% 119 54694 0.35% 120 55119 0.36% 121 57562 0.37% 122 58207 0.38% 123 60752 0.39% 124 63783 0.41% 125 66271 0.43% 126 67818 0.44% 127 69380 0.45% 128 70297 0.45% 129 72021 0.47% 130 72721 0.47% 131 74944 0.48% 132 77494 0.50% 133 80228 0.52% 134 83222 0.54% 135 87576 0.57% 136 90657 0.59% 137 94738 0.61% 138 99376 0.64% 139 104093 0.67% 140 107261 0.69% 141 114144 0.74% 142 120880 0.78% 143 128583 0.83% 144 140456 0.91% 145 158268 1.02% 146 181970 1.18% 147 224948 1.45% 148 314377 2.03% 149 576509 3.72% 150 3139025 20.28% 151 7582100 48.99% 15477802 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=41 prefix-density=0.29 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=55.87 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.3 sequence=CATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=44 prefix-density=0.29 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=39.11 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=10.3 sequence=TCAAGGAAGCTTTCAG SRR7169997 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:45:55 Started mapping on | Feb 12 07:45:56 Finished on | Feb 12 07:47:19 Mapping speed, Million of reads per hour | 671.33 Number of input reads | 15477802 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14598981 Uniquely mapped reads % | 94.32% Average mapped length | 288.71 Number of splices: Total | 12319589 Number of splices: Annotated (sjdb) | 12084761 Number of splices: GT/AG | 12142603 Number of splices: GC/AG | 137166 Number of splices: AT/AC | 11022 Number of splices: Non-canonical | 28798 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262436 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 30289 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 638517 638517 638517 N_multimapping 262436 262436 262436 N_noFeature 295105 14372828 376162 N_ambiguous 206795 1148 60858 UnstrandedReadsAssigned:14097081 PositiveStrandReadsAssigned:225005 NegativeStrandReadsAssigned:14161961 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169997 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169997-trimmed-pair1.fastq SRR7169997-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,477,802 reads, 14,136,994 reads pseudoaligned [quant] estimated average fragment length: 210.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR7169997.ke.tsv 34699 SRR7169997.se.tsv 87100 total ==> SRR7169997.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.95 258 9.07101 Potri.005G024800.1.v4.1 1035 825.948 32 2.46411 Potri.004G059700.1.v4.1 961 751.958 9 0.761222 Potri.007G009000.2.v4.1 1416 1206.95 0 0 Potri.003G141000.2.v4.1 2943 2733.95 211 4.90856 Potri.016G087400.1.v4.1 270 95.2704 1553.8 1037.29 Potri.015G069301.1.v4.1 564 357.34 0 0 Potri.010G195200.1.v4.1 1773 1563.95 11 0.447335 Potri.012G127500.1.v4.1 977 767.953 4458 369.205 ==> SRR7169997.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 947 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169997 completed mapping pipeline successfully