Starting /dee2/code/volunteer_pipeline.sh SRR7169998 current disk space = 3049589129216 free memory = 1582695676 SRR7169998 SRAfilesize a61b644a35a1d902011d5adc3ae1c2cc SRR7169998.sra SRR7169998.sra file validated SRR7169998 is paired end SRR7169998 is conventional basespace SRR7169998 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169998_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.494 34.0 34.0 34.0 33.0 34.0 2 33.61375 34.0 34.0 34.0 33.0 34.0 3 33.6715 34.0 34.0 34.0 33.0 34.0 4 33.69725 34.0 34.0 34.0 33.0 34.0 5 33.7075 34.0 34.0 34.0 33.0 34.0 6 37.19275 38.0 37.0 38.0 36.0 38.0 7 37.568 38.0 38.0 38.0 37.0 38.0 8 37.5785 38.0 38.0 38.0 38.0 38.0 9 37.66075 38.0 38.0 38.0 38.0 38.0 10-14 37.60795 38.0 38.0 38.0 38.0 38.0 15-19 37.49615 38.0 38.0 38.0 37.8 38.0 20-24 37.4754 38.0 38.0 38.0 38.0 38.0 25-29 37.449949999999994 38.0 38.0 38.0 37.6 38.0 30-34 37.3647 38.0 38.0 38.0 37.2 38.0 35-39 37.2025 38.0 38.0 38.0 36.8 38.0 40-44 36.73935 38.0 38.0 38.0 35.0 38.0 45-49 36.60765 38.0 38.0 38.0 34.2 38.0 50-54 36.5451 38.0 38.0 38.0 34.0 38.0 55-59 36.54805 38.0 38.0 38.0 34.0 38.0 60-64 36.4224 38.0 38.0 38.0 34.0 38.0 65-69 36.31555 38.0 38.0 38.0 34.0 38.0 70-74 36.092999999999996 38.0 37.8 38.0 33.6 38.0 75-79 35.7102 38.0 37.0 38.0 32.6 38.0 80-84 35.53405 38.0 37.0 38.0 31.2 38.0 85-89 35.3166 38.0 37.0 38.0 29.2 38.0 90-94 35.097249999999995 38.0 36.0 38.0 29.0 38.0 95-99 35.02995 38.0 36.2 38.0 28.8 38.0 100-104 34.84400000000001 38.0 36.0 38.0 28.0 38.0 105-109 34.650850000000005 38.0 36.0 38.0 27.0 38.0 110-114 34.3196 38.0 35.0 38.0 25.2 38.0 115-119 33.957100000000004 38.0 34.8 38.0 23.4 38.0 120-124 33.60155 38.0 34.0 38.0 20.2 38.0 125-129 33.23455 38.0 34.0 38.0 15.0 38.0 130-134 32.7447 38.0 33.6 38.0 15.0 38.0 135-139 31.999299999999998 37.2 32.0 38.0 14.2 38.0 140-144 31.246699999999997 36.0 31.0 38.0 13.4 38.0 145-149 30.071299999999997 36.0 28.8 38.0 6.4 38.0 150-151 25.508499999999998 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 1.0 8 1.0 9 2.0 10 2.0 11 2.0 12 1.0 13 3.0 14 11.0 15 13.0 16 10.0 17 13.0 18 23.0 19 23.0 20 9.0 21 16.0 22 18.0 23 14.0 24 17.0 25 15.0 26 30.0 27 32.0 28 36.0 29 48.0 30 38.0 31 58.0 32 103.0 33 174.0 34 233.0 35 471.0 36 1077.0 37 1504.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.44263118252573 15.415515942756716 12.92995229726337 32.21190057745418 2 24.349999999999998 15.7 30.225 29.725 3 20.05 20.674999999999997 26.650000000000002 32.625 4 23.0 24.8 23.95 28.249999999999996 5 23.575 30.425 23.25 22.75 6 20.05 32.45 26.85 20.65 7 15.049999999999999 30.925000000000004 37.55 16.475 8 18.275 28.050000000000004 29.95 23.724999999999998 9 17.974999999999998 29.25 31.4 21.375 10-14 19.035 31.05 27.474999999999998 22.439999999999998 15-19 18.925 30.659999999999997 26.995 23.419999999999998 20-24 19.045 30.84 27.544999999999998 22.57 25-29 18.990000000000002 30.214999999999996 27.175 23.62 30-34 18.925 30.44 26.705000000000002 23.93 35-39 19.645000000000003 30.365 26.634999999999998 23.355 40-44 19.525000000000002 29.285 27.694999999999997 23.494999999999997 45-49 19.744999999999997 29.575000000000003 27.515 23.165 50-54 19.505 29.25 27.46 23.785 55-59 19.215 29.544999999999998 27.655 23.585 60-64 19.45 30.09 27.400000000000002 23.06 65-69 18.834999999999997 30.759999999999998 26.784999999999997 23.62 70-74 19.055 30.23 27.065 23.65 75-79 19.54 29.705 26.950000000000003 23.805 80-84 19.05 29.970000000000002 26.97 24.01 85-89 19.6 29.73 26.86 23.810000000000002 90-94 19.30834292577949 29.377909013562885 27.441069015564786 23.872679045092838 95-99 19.6857485988791 29.65872698158527 27.13170536429143 23.523819055244196 100-104 19.759999999999998 30.345 27.029999999999998 22.865 105-109 19.79 30.330000000000002 26.655 23.225 110-114 19.38 30.659999999999997 26.735 23.225 115-119 19.63 30.505 26.479999999999997 23.385 120-124 20.09801470220533 29.75446316947542 26.689003350502578 23.45851877781667 125-129 20.085 29.360000000000003 26.845000000000002 23.71 130-134 20.681204361308392 29.84895468640592 26.22286686005802 23.246974092227667 135-139 20.475118779694924 29.50237559389847 26.296574143535885 23.725931482870717 140-144 20.436130839251774 29.488846653996198 26.342902870861256 23.732119635890765 145-149 20.80832332933173 29.176670668267306 25.990396158463387 24.024609843937576 150-151 20.142535633908476 29.457364341085274 26.331582895723933 24.06851712928232 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.5 20 1.0 21 1.0 22 3.5 23 4.5 24 3.0 25 5.0 26 13.0 27 17.5 28 16.5 29 19.5 30 32.0 31 51.5 32 60.0 33 60.5 34 75.0 35 98.5 36 116.5 37 132.5 38 143.0 39 162.5 40 182.5 41 206.5 42 228.0 43 237.0 44 247.0 45 245.5 46 247.0 47 235.0 48 198.5 49 177.0 50 150.0 51 112.5 52 105.0 53 101.5 54 77.0 55 55.0 56 45.0 57 33.0 58 21.0 59 16.0 60 14.5 61 10.5 62 7.5 63 5.0 64 4.0 65 3.0 66 1.5 67 0.5 68 1.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.095 95-99 0.08 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.0 130-134 0.03 135-139 0.025 140-144 0.03 145-149 0.04 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87034659820283 96.275 2 1.0526315789473684 2.0500000000000003 3 0.025673940949935817 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051347881899871634 1.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCGGCATCTCGTATGC 34 0.8500000000000001 TruSeq Adapter, Index 5 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACACCGGCATCTCGTATGCC 30 0.75 TruSeq Adapter, Index 5 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.4625000000000004 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.762499999999999 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.824999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169998 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169998_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.012 34.0 33.0 34.0 32.0 34.0 2 33.05975 34.0 33.0 34.0 33.0 34.0 3 32.95575 34.0 33.0 34.0 33.0 34.0 4 32.77975 34.0 33.0 34.0 33.0 34.0 5 32.88925 34.0 33.0 34.0 33.0 34.0 6 36.90075 38.0 38.0 38.0 37.0 38.0 7 37.03075 38.0 38.0 38.0 37.0 38.0 8 37.00375 38.0 38.0 38.0 37.0 38.0 9 37.024 38.0 38.0 38.0 37.0 38.0 10-14 36.87555 38.0 38.0 38.0 37.0 38.0 15-19 36.83925 38.0 38.0 38.0 37.0 38.0 20-24 36.86255 38.0 38.0 38.0 37.2 38.0 25-29 36.86280000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.85555 38.0 38.0 38.0 37.0 38.0 35-39 36.763000000000005 38.0 38.0 38.0 37.0 38.0 40-44 36.665499999999994 38.0 38.0 38.0 36.8 38.0 45-49 36.6367 38.0 38.0 38.0 36.6 38.0 50-54 36.74985 38.0 38.0 38.0 37.0 38.0 55-59 36.763999999999996 38.0 38.0 38.0 37.0 38.0 60-64 36.7079 38.0 38.0 38.0 37.0 38.0 65-69 36.5681 38.0 38.0 38.0 36.6 38.0 70-74 36.16850000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.0778 38.0 38.0 38.0 35.4 38.0 80-84 35.96295 38.0 38.0 38.0 35.0 38.0 85-89 35.635 38.0 38.0 38.0 34.0 38.0 90-94 35.541050000000006 38.0 38.0 38.0 33.8 38.0 95-99 35.6991 38.0 38.0 38.0 34.0 38.0 100-104 35.629949999999994 38.0 38.0 38.0 34.0 38.0 105-109 35.52305 38.0 38.0 38.0 33.2 38.0 110-114 35.3624 38.0 38.0 38.0 32.2 38.0 115-119 35.21175 38.0 37.8 38.0 31.0 38.0 120-124 35.02069999999999 38.0 37.6 38.0 30.4 38.0 125-129 34.56415 38.0 36.8 38.0 26.8 38.0 130-134 33.79215000000001 38.0 35.8 38.0 20.4 38.0 135-139 33.134100000000004 38.0 35.0 38.0 14.0 38.0 140-144 32.487750000000005 38.0 33.8 38.0 8.6 38.0 145-149 31.953500000000002 38.0 33.0 38.0 2.0 38.0 150-151 28.099625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 7.0 4 2.0 5 5.0 6 0.0 7 0.0 8 3.0 9 2.0 10 5.0 11 3.0 12 2.0 13 1.0 14 5.0 15 13.0 16 24.0 17 29.0 18 17.0 19 5.0 20 13.0 21 4.0 22 8.0 23 10.0 24 7.0 25 22.0 26 20.0 27 13.0 28 26.0 29 27.0 30 46.0 31 50.0 32 68.0 33 103.0 34 101.0 35 188.0 36 383.0 37 2752.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.853780671006504 21.632448673009513 18.602904356534804 23.910866299449175 2 28.71460786770233 28.664495114006517 25.933350037584564 16.68754698070659 3 22.51572327044025 30.59119496855346 29.20754716981132 17.68553459119497 4 24.892812105926858 32.938209331651954 22.723833543505677 19.44514501891551 5 26.4321608040201 34.54773869346734 22.512562814070353 16.507537688442213 6 21.7282089927154 35.26752072343633 24.415975885455914 18.588294398392364 7 22.456669178598343 23.813112283345895 34.86561165536297 18.86460688269279 8 24.008036162732296 25.464590657960823 26.845806127574086 23.681567051732795 9 22.50690781210751 27.756845013815624 28.058276814870638 21.67797035920623 10-14 24.697763449526498 28.284303848478743 25.816038686278457 21.2018940157163 15-19 24.42259203227433 27.639939485627835 27.13565305093293 20.8018154311649 20-24 24.007447290293364 28.662003723645146 26.724701856790624 20.60584712927087 25-29 24.39368018516655 28.575022642648683 26.300694374559725 20.73060279762504 30-34 23.99275690357628 28.469392887681703 27.594185403148735 19.94366480559328 35-39 23.83498083518257 27.496469638894496 27.60238047205971 21.066169053863224 40-44 24.511141427921782 27.598403314637963 27.52766408973776 20.36279116770249 45-49 24.370299328655797 27.61597092524355 26.68214628236838 21.33158346373227 50-54 23.143115942028984 28.55776972624799 27.61171497584541 20.687399355877616 55-59 23.704337325148437 28.37375465432223 28.03159907416725 19.890308946362083 60-64 23.167658030043352 29.74594213126323 26.479483818933357 20.606916019760057 65-69 23.574087113972436 29.393421184991446 26.948999094658483 20.08349260637763 70-74 23.97572839877639 28.965448071811846 27.009678551727596 20.04914497768417 75-79 23.526756607653343 28.697527458749185 27.30829028537038 20.467425648227092 80-84 23.38433662170324 28.5433863499094 27.516609623515198 20.555667404872153 85-89 24.726055194805195 28.424310064935064 27.323457792207794 19.526176948051948 90-94 23.634427144088857 28.63011614342953 27.71212659126642 20.023330121215192 95-99 23.79827031375704 28.46942880128721 27.690064360418344 20.04223652453741 100-104 23.7422727044278 28.521887721767104 28.06453234155903 19.67130723224607 105-109 24.001005277707968 28.293541090726315 27.52450364413169 20.18094998743403 110-114 23.80473074987418 28.40966280825365 27.78057372924006 20.005032712632108 115-119 24.337482433246336 29.075486850030114 27.158201164424817 19.428829552298733 120-124 23.452148192710684 28.650924951120473 28.15962300095252 19.73730385521632 125-129 23.861050715477575 28.740456085351674 28.062901350053092 19.335591849117662 130-134 24.297291752154287 28.31350020517029 28.210915059499385 19.178292983176036 135-139 24.250907205806115 28.94245723172628 27.433903576982893 19.372731985484705 140-144 24.6976647206005 28.5289824854045 27.877397831526274 18.895954962468725 145-149 25.07012086286909 28.823499413534602 27.461879749094802 18.644499974501507 150-151 25.681474003028775 29.2781423523473 26.274608783442705 18.76577486118122 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 3.0 2 1.0 3 1.5 4 2.0 5 2.5 6 3.0 7 2.0 8 1.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 4.0 25 4.5 26 4.5 27 5.0 28 5.5 29 8.0 30 15.5 31 20.0 32 25.5 33 37.0 34 46.0 35 53.0 36 65.5 37 94.0 38 127.0 39 156.0 40 188.5 41 212.0 42 244.0 43 266.5 44 275.5 45 292.5 46 289.0 47 267.5 48 241.5 49 211.5 50 173.0 51 144.0 52 120.0 53 99.0 54 75.0 55 54.5 56 41.0 57 27.5 58 19.5 59 12.5 60 9.5 61 6.5 62 6.5 63 7.0 64 5.5 65 4.0 66 2.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.22499999999999998 3 0.625 4 0.8750000000000001 5 0.5 6 0.475 7 0.475 8 0.44999999999999996 9 0.475 10-14 0.74 15-19 0.8500000000000001 20-24 0.635 25-29 0.63 30-34 0.5950000000000001 35-39 0.86 40-44 1.045 45-49 0.9450000000000001 50-54 0.64 55-59 0.63 60-64 0.8099999999999999 65-69 0.59 70-74 0.295 75-79 0.305 80-84 0.66 85-89 1.44 90-94 1.415 95-99 0.5599999999999999 100-104 0.515 105-109 0.525 110-114 0.65 115-119 0.38 120-124 0.265 125-129 1.115 130-134 2.52 135-139 3.55 140-144 4.08 145-149 1.955 150-151 0.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.71233582281741 95.825 2 1.1588977594643317 2.25 3 0.07725985063095545 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05150656708730364 1.7000000000000002 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 36 0.8999999999999999 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 32 0.8 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.7374999999999998 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.45 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.0625 0.0 0.0 0.0 0.0 132-133 4.387499999999999 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACAAA 10 0.0069124657 144.425 5 >>END_MODULE Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425235 spots for SRR7169998.sra Written 425235 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra Read 425234 spots for SRR7169998.sra Written 425234 spots for SRR7169998.sra SRR ids: ['SRR7169998.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wnco2d7q SRR7169998.sra spots: 8504681 blocks: [[1, 425234], [425235, 850468], [850469, 1275702], [1275703, 1700936], [1700937, 2126170], [2126171, 2551404], [2551405, 2976638], [2976639, 3401872], [3401873, 3827106], [3827107, 4252340], [4252341, 4677574], [4677575, 5102808], [5102809, 5528042], [5528043, 5953276], [5953277, 6378510], [6378511, 6803744], [6803745, 7228978], [7228979, 7654212], [7654213, 8079446], [8079447, 8504681]] SRR7169998 file size 2863177 SRR7169998 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169998 SRR7169998_1.fastq SRR7169998_2.fastq Input file: SRR7169998_1.fastq Paired file: SRR7169998_2.fastq trimmed: SRR7169998-trimmed-pair1.fastq, SRR7169998-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:20:13 2025 >> started Wed Feb 12 09:20:21 2025 >> done (8.783s) 8504681 read pairs processed; of these: 28284 ( 0.33%) short read pairs filtered out after trimming by size control 120881 ( 1.42%) empty read pairs filtered out after trimming by size control 8355516 (98.25%) read pairs available; of these: 4848735 (58.03%) trimmed read pairs available after processing 3506781 (41.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 3 0.00% 20 9 0.00% 21 8 0.00% 22 8 0.00% 23 3 0.00% 24 10 0.00% 25 8 0.00% 26 9 0.00% 27 9 0.00% 28 12 0.00% 29 10 0.00% 30 11 0.00% 31 12 0.00% 32 15 0.00% 33 13 0.00% 34 24 0.00% 35 15 0.00% 36 9 0.00% 37 24 0.00% 38 35 0.00% 39 38 0.00% 40 23 0.00% 41 29 0.00% 42 36 0.00% 43 43 0.00% 44 42 0.00% 45 58 0.00% 46 66 0.00% 47 72 0.00% 48 102 0.00% 49 115 0.00% 50 188 0.00% 51 279 0.00% 52 383 0.00% 53 337 0.00% 54 203 0.00% 55 227 0.00% 56 205 0.00% 57 213 0.00% 58 312 0.00% 59 274 0.00% 60 231 0.00% 61 278 0.00% 62 336 0.00% 63 460 0.01% 64 514 0.01% 65 801 0.01% 66 1655 0.02% 67 3881 0.05% 68 8677 0.10% 69 12486 0.15% 70 12239 0.15% 71 6339 0.08% 72 3849 0.05% 73 3063 0.04% 74 2506 0.03% 75 2251 0.03% 76 2060 0.02% 77 1926 0.02% 78 1763 0.02% 79 1661 0.02% 80 1802 0.02% 81 2049 0.02% 82 2281 0.03% 83 2653 0.03% 84 3761 0.05% 85 4460 0.05% 86 4547 0.05% 87 4808 0.06% 88 5052 0.06% 89 5178 0.06% 90 5605 0.07% 91 5868 0.07% 92 6199 0.07% 93 6552 0.08% 94 7102 0.08% 95 7368 0.09% 96 7790 0.09% 97 8197 0.10% 98 8396 0.10% 99 8771 0.10% 100 8937 0.11% 101 9425 0.11% 102 9857 0.12% 103 10432 0.12% 104 10995 0.13% 105 11712 0.14% 106 12211 0.15% 107 12765 0.15% 108 13372 0.16% 109 13902 0.17% 110 13709 0.16% 111 14266 0.17% 112 14731 0.18% 113 15510 0.19% 114 15989 0.19% 115 16599 0.20% 116 17228 0.21% 117 17754 0.21% 118 18029 0.22% 119 18424 0.22% 120 19088 0.23% 121 19820 0.24% 122 20905 0.25% 123 21958 0.26% 124 23158 0.28% 125 24013 0.29% 126 25480 0.30% 127 26512 0.32% 128 27580 0.33% 129 28583 0.34% 130 29951 0.36% 131 31346 0.38% 132 33015 0.40% 133 35290 0.42% 134 37321 0.45% 135 39627 0.47% 136 42689 0.51% 137 45325 0.54% 138 49923 0.60% 139 53746 0.64% 140 57599 0.69% 141 63649 0.76% 142 69688 0.83% 143 79336 0.95% 144 92211 1.10% 145 109568 1.31% 146 139883 1.67% 147 194567 2.33% 148 288407 3.45% 149 539678 6.46% 150 2124057 25.42% 151 3506781 41.97% 8355516 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=225.80 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.68 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=125.35 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=12.5 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169998 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:21:02 Started mapping on | Feb 12 09:21:02 Finished on | Feb 12 09:21:57 Mapping speed, Million of reads per hour | 546.91 Number of input reads | 8355516 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 7824150 Uniquely mapped reads % | 93.64% Average mapped length | 292.22 Number of splices: Total | 6623821 Number of splices: Annotated (sjdb) | 6493902 Number of splices: GT/AG | 6520962 Number of splices: GC/AG | 77991 Number of splices: AT/AC | 5940 Number of splices: Non-canonical | 18928 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 156403 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 14162 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.26% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395636 395636 395636 N_multimapping 156403 156403 156403 N_noFeature 178104 7720684 222952 N_ambiguous 89985 629 30925 UnstrandedReadsAssigned:7556061 PositiveStrandReadsAssigned:102837 NegativeStrandReadsAssigned:7570273 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169998 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169998-trimmed-pair1.fastq SRR7169998-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,355,516 reads, 7,556,649 reads pseudoaligned [quant] estimated average fragment length: 229.222 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR7169998.ke.tsv 34699 SRR7169998.se.tsv 87100 total ==> SRR7169998.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.78 122 7.59945 Potri.005G024800.1.v4.1 1035 806.778 25 3.45468 Potri.004G059700.1.v4.1 961 732.787 3 0.45642 Potri.007G009000.2.v4.1 1416 1187.78 0 0 Potri.003G141000.2.v4.1 2943 2714.78 87.0246 3.57379 Potri.016G087400.1.v4.1 270 78.9674 1123.06 1585.54 Potri.015G069301.1.v4.1 564 337.696 0 0 Potri.010G195200.1.v4.1 1773 1544.78 11 0.793867 Potri.012G127500.1.v4.1 977 748.783 3155 469.748 ==> SRR7169998.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 687 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169998 completed mapping pipeline successfully