Starting /dee2/code/volunteer_pipeline.sh SRR7169999 current disk space = 3049605685248 free memory = 1482815732 SRR7169999 SRAfilesize 0f9d9abdb9f67501a421d1b14b281f53 SRR7169999.sra SRR7169999.sra file validated SRR7169999 is paired end SRR7169999 is conventional basespace SRR7169999 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169999_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1355 34.0 33.0 34.0 33.0 34.0 2 33.42975 34.0 34.0 34.0 33.0 34.0 3 33.45175 34.0 34.0 34.0 33.0 34.0 4 33.49575 34.0 34.0 34.0 33.0 34.0 5 33.52875 34.0 34.0 34.0 33.0 34.0 6 37.21025 38.0 38.0 38.0 36.0 38.0 7 37.467 38.0 38.0 38.0 37.0 38.0 8 37.53125 38.0 38.0 38.0 37.0 38.0 9 37.5585 38.0 38.0 38.0 38.0 38.0 10-14 37.508449999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.545649999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.490249999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.4606 38.0 38.0 38.0 37.6 38.0 30-34 37.4751 38.0 38.0 38.0 38.0 38.0 35-39 37.423500000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.26415 38.0 38.0 38.0 37.0 38.0 45-49 37.1827 38.0 38.0 38.0 36.8 38.0 50-54 37.1974 38.0 38.0 38.0 36.8 38.0 55-59 37.116099999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.1235 38.0 38.0 38.0 36.0 38.0 65-69 37.036899999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.99059999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.86915 38.0 38.0 38.0 35.8 38.0 80-84 36.76935 38.0 38.0 38.0 35.2 38.0 85-89 36.64340000000001 38.0 38.0 38.0 34.8 38.0 90-94 36.4696 38.0 38.0 38.0 34.2 38.0 95-99 36.22455 38.0 38.0 38.0 34.0 38.0 100-104 36.239 38.0 38.0 38.0 34.0 38.0 105-109 36.145450000000004 38.0 38.0 38.0 34.0 38.0 110-114 35.9997 38.0 37.8 38.0 33.2 38.0 115-119 35.93315 38.0 37.2 38.0 33.0 38.0 120-124 35.73195 38.0 37.0 38.0 31.8 38.0 125-129 35.4366 38.0 36.6 38.0 30.6 38.0 130-134 34.869550000000004 38.0 35.6 38.0 27.4 38.0 135-139 34.527049999999996 38.0 35.2 38.0 26.0 38.0 140-144 34.4464 38.0 35.0 38.0 26.6 38.0 145-149 33.540549999999996 38.0 34.8 38.0 19.6 38.0 150-151 29.977874999999997 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 0.0 17 5.0 18 4.0 19 11.0 20 4.0 21 5.0 22 14.0 23 8.0 24 12.0 25 9.0 26 18.0 27 24.0 28 35.0 29 26.0 30 51.0 31 44.0 32 71.0 33 89.0 34 115.0 35 273.0 36 551.0 37 2622.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.60474507824331 12.443210499747602 10.348308934881373 34.603735487127715 2 24.275 14.374999999999998 32.025 29.325000000000003 3 20.25 19.400000000000002 25.775 34.575 4 23.125 25.900000000000002 23.375 27.6 5 22.400000000000002 29.575000000000003 23.849999999999998 24.175 6 20.200000000000003 34.175 24.4 21.224999999999998 7 16.175 26.224999999999998 38.875 18.725 8 18.2 27.224999999999998 30.099999999999998 24.474999999999998 9 16.675 25.1 33.125 25.1 10-14 20.165 29.549999999999997 27.04 23.244999999999997 15-19 20.005 28.485 27.83 23.68 20-24 20.395 29.104999999999997 26.855 23.645 25-29 20.150000000000002 28.525 27.145000000000003 24.18 30-34 20.02 28.955 26.99 24.035 35-39 19.86 27.950000000000003 27.644999999999996 24.545 40-44 20.285 28.485 27.12 24.11 45-49 20.89776309863384 27.70354801581344 27.438322574188064 23.96036631136466 50-54 20.474999999999998 27.944999999999997 27.565 24.015 55-59 20.575 28.155 27.005000000000003 24.265 60-64 20.455000000000002 28.465 26.915 24.165 65-69 20.015 28.59 27.089999999999996 24.305 70-74 20.419999999999998 28.46 26.985 24.135 75-79 20.845 27.944999999999997 27.045 24.165 80-84 20.47 28.384999999999998 27.279999999999998 23.865 85-89 20.690172543135784 28.127031757939484 27.41685421355339 23.765941485371343 90-94 20.390977443609025 27.79949874686717 26.902255639097746 24.907268170426065 95-99 20.81049826537282 27.844537181356525 27.316607169792345 24.028357383478305 100-104 20.816224336504757 28.42263395092639 27.110665998998495 23.650475713570355 105-109 20.717071707170717 27.542754275427544 27.577757775777577 24.162416241624165 110-114 20.61958860917872 27.736349532055453 26.89555077323457 24.748511085531256 115-119 20.595 28.634999999999998 26.66 24.11 120-124 20.595 27.865000000000002 26.700000000000003 24.84 125-129 20.200000000000003 28.18 27.125 24.495 130-134 20.92650155419633 28.206156622881778 26.85250175473779 24.0148400681841 135-139 21.15374943419001 27.611527435497663 27.339938641050143 23.894784489262182 140-144 21.053159478435308 27.833500501504517 26.64493480441324 24.46840521564694 145-149 21.047094188376754 27.92084168336673 26.64328657314629 24.38877755511022 150-151 21.6635397123202 27.49218261413383 26.391494684177612 24.452782989368355 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 0.0 22 2.0 23 2.5 24 1.0 25 2.0 26 2.5 27 3.0 28 7.5 29 9.5 30 11.5 31 18.5 32 31.5 33 40.0 34 39.5 35 53.0 36 76.5 37 85.0 38 104.5 39 136.0 40 175.0 41 211.5 42 224.0 43 235.5 44 256.5 45 280.5 46 290.0 47 268.5 48 248.0 49 227.5 50 199.0 51 171.0 52 136.5 53 112.0 54 86.0 55 57.0 56 38.5 57 35.0 58 29.0 59 22.0 60 16.5 61 10.0 62 8.5 63 7.0 64 7.0 65 5.5 66 3.5 67 2.5 68 1.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.08499999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.25 95-99 0.555 100-104 0.15 105-109 0.01 110-114 0.095 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.27 135-139 0.585 140-144 0.3 145-149 0.2 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64815280221161 99.125 2 0.30158331239004776 0.6 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025131942699170642 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.75 0.0 0.0 0.0 0.0 126-127 5.2875 0.0 0.0 0.0 0.0 128-129 5.825 0.0 0.0 0.0 0.0 130-131 6.525 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.675 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169999 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169999_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11175 33.0 33.0 34.0 32.0 34.0 2 32.14325 34.0 33.0 34.0 32.0 34.0 3 32.19925 34.0 33.0 34.0 32.0 34.0 4 31.9065 34.0 33.0 34.0 32.0 34.0 5 31.8715 34.0 33.0 34.0 32.0 34.0 6 35.91675 38.0 38.0 38.0 34.0 38.0 7 35.99525 38.0 38.0 38.0 35.0 38.0 8 35.98125 38.0 38.0 38.0 35.0 38.0 9 35.96075 38.0 38.0 38.0 35.0 38.0 10-14 35.9114 38.0 38.0 38.0 34.8 38.0 15-19 35.6457 38.0 38.0 38.0 34.0 38.0 20-24 35.8164 38.0 38.0 38.0 34.0 38.0 25-29 35.93 38.0 38.0 38.0 35.2 38.0 30-34 35.9499 38.0 38.0 38.0 35.0 38.0 35-39 35.8688 38.0 38.0 38.0 34.8 38.0 40-44 35.66930000000001 38.0 38.0 38.0 34.2 38.0 45-49 35.60235 38.0 38.0 38.0 33.4 38.0 50-54 35.907500000000006 38.0 38.0 38.0 34.8 38.0 55-59 35.87740000000001 38.0 38.0 38.0 35.0 38.0 60-64 35.8312 38.0 38.0 38.0 34.2 38.0 65-69 35.73725 38.0 38.0 38.0 34.0 38.0 70-74 35.68919999999999 38.0 38.0 38.0 33.8 38.0 75-79 35.63935 38.0 38.0 38.0 33.6 38.0 80-84 35.543350000000004 38.0 38.0 38.0 33.4 38.0 85-89 35.05365 38.0 38.0 38.0 30.4 38.0 90-94 34.676100000000005 38.0 38.0 38.0 27.4 38.0 95-99 35.12505 38.0 38.0 38.0 29.2 38.0 100-104 35.1945 38.0 38.0 38.0 30.6 38.0 105-109 34.95915 38.0 38.0 38.0 29.0 38.0 110-114 34.9018 38.0 37.8 38.0 28.6 38.0 115-119 34.56665 38.0 37.0 38.0 25.8 38.0 120-124 34.4423 38.0 36.4 38.0 25.0 38.0 125-129 33.9611 38.0 36.0 38.0 19.8 38.0 130-134 32.95035 38.0 35.4 38.0 11.4 38.0 135-139 31.767199999999995 38.0 34.0 38.0 2.0 38.0 140-144 30.849400000000003 38.0 32.8 38.0 2.0 38.0 145-149 30.2238 38.0 31.4 38.0 2.0 38.0 150-151 26.52675 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 125.0 3 2.0 4 1.0 5 3.0 6 0.0 7 0.0 8 2.0 9 3.0 10 0.0 11 3.0 12 4.0 13 6.0 14 3.0 15 5.0 16 3.0 17 9.0 18 6.0 19 16.0 20 5.0 21 13.0 22 12.0 23 14.0 24 18.0 25 24.0 26 36.0 27 37.0 28 31.0 29 36.0 30 60.0 31 82.0 32 88.0 33 136.0 34 160.0 35 209.0 36 433.0 37 2415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.50677576067502 21.631296343646124 14.139606238813604 25.722321656865255 2 27.481500382750703 27.838734371013015 26.588415412094925 18.09134983414136 3 21.212896622313202 29.22210849539406 30.01535312180143 19.549641760491298 4 23.05505298526751 33.62626001550788 23.882140087878003 19.4365469113466 5 26.133126133126133 34.31753431753432 22.403522403522402 17.145817145817148 6 21.967550862735 35.17898532062838 22.817409219675508 20.03605459696111 7 20.957775489186407 21.85890834191555 36.50875386199794 20.6745623069001 8 23.63356428021555 26.17397998460354 26.353605337439056 23.838850397741854 9 23.104693140794225 24.1103661681279 30.29912325941207 22.485817431665808 10-14 23.82131435056226 28.236871969462502 26.436603734653875 21.505209945321365 15-19 24.206473098137163 27.417004891247785 27.09439067540847 21.28213133520658 20-24 24.148606811145513 28.281733746130033 26.738906088751293 20.83075335397317 25-29 23.75186769024679 28.3579782575094 26.87413055798856 21.016023494255244 30-34 23.97938144329897 27.876288659793815 27.195876288659793 20.948453608247423 35-39 23.62969468409361 27.643746448313273 27.34927933047476 21.377279537118355 40-44 24.301443855822168 27.983795574945464 27.324192375610263 20.390568193622105 45-49 23.543752269308573 27.75040199180455 27.9838165879973 20.72202915088957 50-54 24.085977271558594 27.67007764693783 26.929603537820746 21.31434154368283 55-59 23.652093310675113 27.22591276584788 27.854163448169317 21.26783047530769 60-64 23.50339436329973 27.864636905986423 27.597202221765073 21.034766508948778 65-69 23.989717223650388 28.174807197943448 27.033419023136247 20.802056555269925 70-74 24.410817442871018 27.82577577833444 26.675527836000207 21.087878942794337 75-79 23.95093278814209 27.44186046511628 27.339637107078968 21.26756963966266 80-84 23.504603199094788 28.0255104664918 27.650054004011725 20.819832330401685 85-89 24.127133239392514 27.613381347528836 27.9056416679714 20.353843745107252 90-94 24.498160798738834 27.69311613242249 27.320021019442986 20.48870204939569 95-99 24.487794808277854 27.501677246219746 27.243639366258964 20.766888579243435 100-104 24.462130937098845 27.501925545571243 27.707317073170735 20.328626444159177 105-109 24.883984737547696 27.482726616479326 27.121790244405485 20.511498401567497 110-114 24.69944791290439 27.232856921727468 27.3308910788917 20.736804086476447 115-119 25.06798009337643 27.41778256631266 27.263865373762247 20.250371966548663 120-124 24.73743244621189 27.827062302437035 26.53206893035587 20.90343632099521 125-129 25.134492033933377 27.948479205462444 26.582867783985105 20.334160976619078 130-134 25.585364552776145 27.772147847885222 26.43874339964798 20.20374419969065 135-139 25.276772991340568 26.816836566918777 27.682779787350654 20.223610654390004 140-144 26.120315801178695 27.21561214277772 26.954297787167796 19.709774268875794 145-149 26.07743658210948 27.802403204272363 25.970627503337784 20.149532710280376 150-151 26.194184839044652 28.154205607476634 26.44080996884735 19.21079958463136 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 83.0 1 42.5 2 1.0 3 1.5 4 4.5 5 4.0 6 2.0 7 1.5 8 2.0 9 2.0 10 1.5 11 2.5 12 1.5 13 0.5 14 1.0 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 1.0 21 1.5 22 0.5 23 1.0 24 3.0 25 3.5 26 2.5 27 3.0 28 4.5 29 7.5 30 8.5 31 8.0 32 11.0 33 20.5 34 35.5 35 43.0 36 53.5 37 85.5 38 113.5 39 132.0 40 171.5 41 216.5 42 242.5 43 274.0 44 280.5 45 276.0 46 289.5 47 281.5 48 251.5 49 213.0 50 176.5 51 156.5 52 142.5 53 106.0 54 72.0 55 52.5 56 35.5 57 25.0 58 24.0 59 20.0 60 10.0 61 7.5 62 7.5 63 3.5 64 2.5 65 3.5 66 2.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.225 2 2.025 3 2.3 4 3.2750000000000004 5 3.4750000000000005 6 2.9250000000000003 7 2.9000000000000004 8 2.5749999999999997 9 3.05 10-14 3.0700000000000003 15-19 3.91 20-24 3.1 25-29 2.955 30-34 3.0 35-39 3.215 40-44 3.73 45-49 3.605 50-54 2.765 55-59 2.905 60-64 2.78 65-69 2.75 70-74 2.1950000000000003 75-79 2.175 80-84 2.785 85-89 4.195 90-94 4.8500000000000005 95-99 3.115 100-104 2.625 105-109 3.0300000000000002 110-114 3.0949999999999998 115-119 2.545 120-124 1.9300000000000002 125-129 3.34 130-134 6.254999999999999 135-139 8.77 140-144 10.07 145-149 6.375 150-151 3.6999999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64102564102564 97.15 2 0.28205128205128205 0.5499999999999999 3 0.0 0.0 4 0.02564102564102564 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02564102564102564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02564102564102564 2.025 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 81 2.025 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 1.8250000000000002 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.35 0.0 0.0 0.0 0.0 124-125 4.675 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.699999999999999 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138-139 8.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra Read 873316 spots for SRR7169999.sra Written 873316 spots for SRR7169999.sra Read 873311 spots for SRR7169999.sra Written 873311 spots for SRR7169999.sra SRR ids: ['SRR7169999.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1jev7u_2 SRR7169999.sra spots: 17466225 blocks: [[1, 873311], [873312, 1746622], [1746623, 2619933], [2619934, 3493244], [3493245, 4366555], [4366556, 5239866], [5239867, 6113177], [6113178, 6986488], [6986489, 7859799], [7859800, 8733110], [8733111, 9606421], [9606422, 10479732], [10479733, 11353043], [11353044, 12226354], [12226355, 13099665], [13099666, 13972976], [13972977, 14846287], [14846288, 15719598], [15719599, 16592909], [16592910, 17466225]] SRR7169999 file size 5897030 SRR7169999 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169999 SRR7169999_1.fastq SRR7169999_2.fastq Input file: SRR7169999_1.fastq Paired file: SRR7169999_2.fastq trimmed: SRR7169999-trimmed-pair1.fastq, SRR7169999-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:12:50 2025 >> started Wed Feb 12 08:13:08 2025 >> done (18.329s) 17466225 read pairs processed; of these: 22866 ( 0.13%) short read pairs filtered out after trimming by size control 64911 ( 0.37%) empty read pairs filtered out after trimming by size control 17378448 (99.50%) read pairs available; of these: 8381805 (48.23%) trimmed read pairs available after processing 8996643 (51.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 8 0.00% 21 6 0.00% 22 4 0.00% 23 7 0.00% 24 7 0.00% 25 6 0.00% 26 13 0.00% 27 9 0.00% 28 15 0.00% 29 16 0.00% 30 11 0.00% 31 15 0.00% 32 10 0.00% 33 11 0.00% 34 13 0.00% 35 16 0.00% 36 17 0.00% 37 16 0.00% 38 28 0.00% 39 24 0.00% 40 28 0.00% 41 48 0.00% 42 36 0.00% 43 43 0.00% 44 54 0.00% 45 55 0.00% 46 57 0.00% 47 78 0.00% 48 90 0.00% 49 92 0.00% 50 119 0.00% 51 117 0.00% 52 140 0.00% 53 141 0.00% 54 162 0.00% 55 204 0.00% 56 210 0.00% 57 237 0.00% 58 255 0.00% 59 275 0.00% 60 327 0.00% 61 390 0.00% 62 434 0.00% 63 537 0.00% 64 570 0.00% 65 648 0.00% 66 734 0.00% 67 850 0.00% 68 981 0.01% 69 1295 0.01% 70 1656 0.01% 71 1411 0.01% 72 1577 0.01% 73 1803 0.01% 74 1956 0.01% 75 2163 0.01% 76 2474 0.01% 77 2629 0.02% 78 2834 0.02% 79 3246 0.02% 80 3513 0.02% 81 4035 0.02% 82 4702 0.03% 83 5370 0.03% 84 6904 0.04% 85 8052 0.05% 86 8679 0.05% 87 9124 0.05% 88 9697 0.06% 89 10127 0.06% 90 10927 0.06% 91 11625 0.07% 92 12621 0.07% 93 13856 0.08% 94 14772 0.09% 95 15748 0.09% 96 16640 0.10% 97 17257 0.10% 98 18246 0.10% 99 18721 0.11% 100 20057 0.12% 101 20838 0.12% 102 22270 0.13% 103 23684 0.14% 104 25184 0.14% 105 26508 0.15% 106 28186 0.16% 107 28553 0.16% 108 29454 0.17% 109 30188 0.17% 110 31244 0.18% 111 32243 0.19% 112 33960 0.20% 113 35770 0.21% 114 37841 0.22% 115 39142 0.23% 116 39973 0.23% 117 41629 0.24% 118 42169 0.24% 119 42978 0.25% 120 43936 0.25% 121 45204 0.26% 122 46646 0.27% 123 48679 0.28% 124 51181 0.29% 125 52746 0.30% 126 55488 0.32% 127 56954 0.33% 128 58571 0.34% 129 60211 0.35% 130 62366 0.36% 131 64035 0.37% 132 66507 0.38% 133 69978 0.40% 134 73700 0.42% 135 77619 0.45% 136 81731 0.47% 137 87299 0.50% 138 93256 0.54% 139 101178 0.58% 140 106771 0.61% 141 114579 0.66% 142 124185 0.71% 143 134006 0.77% 144 150281 0.86% 145 170613 0.98% 146 206625 1.19% 147 266878 1.54% 148 379047 2.18% 149 708145 4.07% 150 3839690 22.09% 151 8996643 51.77% 17378448 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=41 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=118.95 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=11.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.03 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=4.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=98.19 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.4 sequence=CACCACCACTGGTAACAAGGACATCATCATGGTTGATCACATGAGGAAGATGAAGAACAATGCCATTGTCTGCAACATCGGTCACTTCGATAATGAAATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCATCAAGCCCCAAACTGACAGGTGGGTCTTCCCTGACACCAACTCCGGCATCATTGTCCTGGCTGAGGGACGTCTCATGAACCTGGGATGTGCCACCGGTCACCCC SRR7169999 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:13:53 Started mapping on | Feb 12 08:13:54 Finished on | Feb 12 08:15:46 Mapping speed, Million of reads per hour | 558.59 Number of input reads | 17378448 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16189328 Uniquely mapped reads % | 93.16% Average mapped length | 292.15 Number of splices: Total | 15256794 Number of splices: Annotated (sjdb) | 15003700 Number of splices: GT/AG | 15037621 Number of splices: GC/AG | 176551 Number of splices: AT/AC | 11737 Number of splices: Non-canonical | 30885 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286597 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 108762 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.49% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 922928 922928 922928 N_multimapping 286597 286597 286597 N_noFeature 291277 16002655 369543 N_ambiguous 169515 853 60542 UnstrandedReadsAssigned:15728536 PositiveStrandReadsAssigned:185820 NegativeStrandReadsAssigned:15759243 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169999 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169999-trimmed-pair1.fastq SRR7169999-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,378,448 reads, 15,753,768 reads pseudoaligned [quant] estimated average fragment length: 230.372 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,324 rounds 52401 SRR7169999.ke.tsv 34699 SRR7169999.se.tsv 87100 total ==> SRR7169999.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.63 309 10.8538 Potri.005G024800.1.v4.1 1035 805.628 46 3.58729 Potri.004G059700.1.v4.1 961 731.659 17 1.45977 Potri.007G009000.2.v4.1 1416 1186.63 0 0 Potri.003G141000.2.v4.1 2943 2713.63 263 6.08904 Potri.016G087400.1.v4.1 270 86.9707 1562 1128.37 Potri.015G069301.1.v4.1 564 338.653 0 0 Potri.010G195200.1.v4.1 1773 1543.63 25 1.01751 Potri.012G127500.1.v4.1 977 747.638 6574 552.435 ==> SRR7169999.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1100 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169999 completed mapping pipeline successfully