Starting /dee2/code/volunteer_pipeline.sh SRR7170001 current disk space = 3049660956672 free memory = 1485300296 SRR7170001 SRAfilesize 4c1d6d678288cbd2395aaa4a7294cb13 SRR7170001.sra SRR7170001.sra file validated SRR7170001 is paired end SRR7170001 is conventional basespace SRR7170001 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170001_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01725 34.0 33.0 34.0 33.0 34.0 2 33.48675 34.0 34.0 34.0 33.0 34.0 3 33.471 34.0 34.0 34.0 33.0 34.0 4 33.5275 34.0 34.0 34.0 33.0 34.0 5 33.54125 34.0 34.0 34.0 33.0 34.0 6 37.325 38.0 38.0 38.0 36.0 38.0 7 37.5365 38.0 38.0 38.0 37.0 38.0 8 37.58975 38.0 38.0 38.0 38.0 38.0 9 37.5965 38.0 38.0 38.0 38.0 38.0 10-14 37.61955 38.0 38.0 38.0 38.0 38.0 15-19 37.5821 38.0 38.0 38.0 38.0 38.0 20-24 37.5466 38.0 38.0 38.0 38.0 38.0 25-29 37.50275 38.0 38.0 38.0 38.0 38.0 30-34 37.46554999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.4377 38.0 38.0 38.0 37.6 38.0 40-44 37.24594999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.174350000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.09845 38.0 38.0 38.0 36.0 38.0 55-59 37.044450000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.05585000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.04425 38.0 38.0 38.0 36.0 38.0 70-74 36.9349 38.0 38.0 38.0 36.0 38.0 75-79 36.7704 38.0 38.0 38.0 35.4 38.0 80-84 36.62295 38.0 38.0 38.0 34.4 38.0 85-89 36.575450000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.5469 38.0 38.0 38.0 34.6 38.0 95-99 36.3768 38.0 38.0 38.0 34.0 38.0 100-104 36.259 38.0 38.0 38.0 33.8 38.0 105-109 36.121599999999994 38.0 38.0 38.0 33.6 38.0 110-114 35.79665 38.0 37.4 38.0 32.2 38.0 115-119 35.61364999999999 38.0 37.0 38.0 31.0 38.0 120-124 35.49995 38.0 36.8 38.0 30.6 38.0 125-129 35.0899 38.0 36.0 38.0 28.6 38.0 130-134 34.795100000000005 38.0 35.8 38.0 27.8 38.0 135-139 34.29105 38.0 35.0 38.0 24.4 38.0 140-144 34.021699999999996 38.0 35.0 38.0 23.0 38.0 145-149 33.27505 38.0 34.6 38.0 15.8 38.0 150-151 29.571125000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 3.0 11 2.0 12 0.0 13 1.0 14 2.0 15 1.0 16 3.0 17 3.0 18 7.0 19 9.0 20 8.0 21 9.0 22 7.0 23 8.0 24 12.0 25 24.0 26 14.0 27 18.0 28 35.0 29 42.0 30 45.0 31 54.0 32 60.0 33 71.0 34 141.0 35 240.0 36 607.0 37 2573.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.845371312309254 12.843336724313325 8.367243133265513 34.9440488301119 2 23.474999999999998 15.425 33.050000000000004 28.050000000000004 3 20.175 20.8 26.200000000000003 32.824999999999996 4 23.35 28.4 22.85 25.4 5 21.349999999999998 33.975 23.549999999999997 21.125 6 19.8 36.175000000000004 24.25 19.775000000000002 7 14.45 27.85 39.4 18.3 8 18.4 26.85 29.775000000000002 24.975 9 16.925 25.05 33.45 24.575 10-14 19.73 30.220000000000002 27.279999999999998 22.770000000000003 15-19 19.845 29.12 27.42 23.615 20-24 19.950000000000003 29.054999999999996 27.33 23.665 25-29 19.875 29.935000000000002 26.8 23.39 30-34 19.68 29.625 26.735 23.96 35-39 19.24 29.225 27.145000000000003 24.39 40-44 19.96 29.485 26.99 23.565 45-49 19.634999999999998 28.660000000000004 27.68 24.025 50-54 20.175 28.975 26.939999999999998 23.91 55-59 20.51 28.235 26.939999999999998 24.315 60-64 20.005 29.215000000000003 26.82 23.96 65-69 20.1 28.68 27.275 23.945 70-74 19.875 28.825 27.279999999999998 24.02 75-79 20.1 28.555000000000003 27.555000000000003 23.79 80-84 20.294999999999998 27.875 27.425 24.404999999999998 85-89 20.005 28.555000000000003 27.165 24.275 90-94 20.43 27.93 27.474999999999998 24.165 95-99 20.68 28.46 26.790000000000003 24.07 100-104 20.580000000000002 28.67 26.735 24.015 105-109 20.455000000000002 28.59 26.715 24.240000000000002 110-114 20.424999999999997 28.265 26.97 24.34 115-119 20.515 28.07 26.650000000000002 24.765 120-124 21.425 27.894999999999996 25.97 24.709999999999997 125-129 21.295 27.750000000000004 26.740000000000002 24.215 130-134 21.21 27.694999999999997 26.700000000000003 24.395 135-139 21.115000000000002 28.410000000000004 25.985000000000003 24.490000000000002 140-144 21.605 28.015 26.27 24.11 145-149 21.645 27.810000000000002 26.11 24.435000000000002 150-151 21.05 28.050000000000004 25.912499999999998 24.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 2.0 24 4.5 25 5.5 26 5.0 27 5.5 28 7.5 29 11.5 30 17.0 31 24.5 32 39.5 33 46.0 34 55.5 35 76.0 36 91.0 37 115.0 38 131.0 39 149.0 40 184.5 41 197.5 42 209.0 43 248.0 44 273.0 45 262.0 46 250.5 47 242.5 48 216.0 49 194.0 50 178.5 51 152.5 52 141.5 53 130.0 54 95.5 55 69.5 56 47.5 57 32.0 58 25.5 59 13.0 60 9.0 61 9.0 62 5.5 63 5.0 64 4.0 65 2.0 66 2.5 67 2.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06589245140115 98.1 2 0.8836152486745772 1.7500000000000002 3 0.050492299924261554 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.7875 0.025 0.0 0.0 0.0 92-93 0.8875 0.025 0.0 0.0 0.0 94-95 1.0375 0.025 0.0 0.0 0.0 96-97 1.3375 0.025 0.0 0.0 0.0 98-99 1.6 0.025 0.0 0.0 0.0 100-101 1.8625 0.025 0.0 0.0 0.0 102-103 2.2249999999999996 0.025 0.0 0.0 0.0 104-105 2.6125 0.025 0.0 0.0 0.0 106-107 2.9875 0.025 0.0 0.0 0.0 108-109 3.4375 0.025 0.0 0.0 0.0 110-111 3.7875 0.025 0.0 0.0 0.0 112-113 4.325 0.025 0.0 0.0 0.0 114-115 4.737500000000001 0.025 0.0 0.0 0.0 116-117 5.362500000000001 0.025 0.0 0.0 0.0 118-119 5.9625 0.025 0.0 0.0 0.0 120-121 6.425000000000001 0.025 0.0 0.0 0.0 122-123 6.9 0.025 0.0 0.0 0.0 124-125 7.5 0.025 0.0 0.0 0.0 126-127 8.125 0.025 0.0 0.0 0.0 128-129 9.1875 0.025 0.0 0.0 0.0 130-131 10.0 0.025 0.0 0.0 0.0 132-133 10.5125 0.025 0.0 0.0 0.0 134-135 11.1125 0.025 0.0 0.0 0.0 136-137 11.8875 0.025 0.0 0.0 0.0 138-139 12.975000000000001 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170001 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170001_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.872 33.0 33.0 34.0 32.0 34.0 2 32.3895 34.0 33.0 34.0 32.0 34.0 3 32.39725 34.0 33.0 34.0 32.0 34.0 4 32.28225 34.0 33.0 34.0 32.0 34.0 5 32.166 34.0 33.0 34.0 32.0 34.0 6 36.42175 38.0 38.0 38.0 36.0 38.0 7 36.38825 38.0 38.0 38.0 36.0 38.0 8 36.429 38.0 38.0 38.0 36.0 38.0 9 36.42275 38.0 38.0 38.0 36.0 38.0 10-14 36.40735 38.0 38.0 38.0 36.2 38.0 15-19 36.14095 38.0 38.0 38.0 36.0 38.0 20-24 36.29 38.0 38.0 38.0 36.0 38.0 25-29 36.37349999999999 38.0 38.0 38.0 36.2 38.0 30-34 36.40625 38.0 38.0 38.0 36.8 38.0 35-39 36.28205 38.0 38.0 38.0 36.0 38.0 40-44 36.1207 38.0 38.0 38.0 36.0 38.0 45-49 36.0185 38.0 38.0 38.0 35.4 38.0 50-54 36.26655 38.0 38.0 38.0 36.0 38.0 55-59 36.26755 38.0 38.0 38.0 36.0 38.0 60-64 36.15554999999999 38.0 38.0 38.0 35.6 38.0 65-69 36.104049999999994 38.0 38.0 38.0 35.2 38.0 70-74 36.072900000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.0047 38.0 38.0 38.0 34.6 38.0 80-84 35.9835 38.0 38.0 38.0 34.6 38.0 85-89 35.609449999999995 38.0 38.0 38.0 33.6 38.0 90-94 35.217949999999995 38.0 38.0 38.0 31.0 38.0 95-99 35.509750000000004 38.0 38.0 38.0 32.6 38.0 100-104 35.59799999999999 38.0 38.0 38.0 32.8 38.0 105-109 35.435050000000004 38.0 38.0 38.0 32.4 38.0 110-114 35.22435 38.0 38.0 38.0 30.6 38.0 115-119 35.0052 38.0 37.4 38.0 29.0 38.0 120-124 34.74679999999999 38.0 37.0 38.0 27.2 38.0 125-129 34.32020000000001 38.0 36.4 38.0 24.8 38.0 130-134 33.350750000000005 38.0 35.6 38.0 15.4 38.0 135-139 32.28705 38.0 34.6 38.0 4.2 38.0 140-144 31.3544 38.0 33.6 38.0 2.0 38.0 145-149 30.766200000000005 38.0 31.8 38.0 2.0 38.0 150-151 26.942625 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 87.0 3 6.0 4 2.0 5 2.0 6 0.0 7 0.0 8 1.0 9 2.0 10 5.0 11 3.0 12 2.0 13 1.0 14 4.0 15 6.0 16 6.0 17 8.0 18 6.0 19 7.0 20 13.0 21 15.0 22 15.0 23 16.0 24 19.0 25 21.0 26 23.0 27 35.0 28 31.0 29 35.0 30 47.0 31 61.0 32 95.0 33 113.0 34 145.0 35 171.0 36 446.0 37 2551.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.93023255813954 21.93798449612403 13.049095607235142 24.08268733850129 2 27.770796682583565 26.363407891430008 28.75094244785122 17.114852978135207 3 20.403530895334175 29.1046658259773 30.491803278688522 20.0 4 25.28061224489796 32.88265306122449 23.010204081632654 18.8265306122449 5 24.22455780569085 35.34991027941554 22.301973852858243 18.123558062035375 6 22.408963585434176 37.50954927425516 22.663610898905016 17.417876241405654 7 21.483180428134556 22.069317023445464 37.20693170234455 19.240570846075432 8 21.470363775120834 25.61689137624014 27.651996947341644 25.260747901297382 9 21.655242447321655 25.61563848692562 29.09367859862909 23.635440467123637 10-14 24.394842786526016 28.30352137797483 25.286653416908727 22.014982418590428 15-19 24.01330944458664 27.93959559764525 26.711031481955466 21.336063475812644 20-24 24.56900948689177 27.302866469448126 27.093746812200347 21.034377231459757 25-29 24.46365022877478 28.06304016268429 26.9598373157092 20.513472292831725 30-34 24.42309647250178 27.940428992579037 26.979770255159092 20.656704279760092 35-39 24.395593185759463 27.685402427828215 26.859124757727226 21.059879628685096 40-44 23.696876600102406 28.172043010752688 27.147977470558114 20.98310291858679 45-49 24.197353574725614 27.23356241665812 27.8182377679762 20.750846240640065 50-54 23.926224079074743 28.231517807102463 26.942477199775823 20.899780914046975 55-59 24.593506294918193 27.799582037820482 27.417299556552322 20.189612110709007 60-64 24.63649813785011 27.51900413244222 27.891434110504566 19.9530636192031 65-69 24.080012215605436 27.490202066473252 27.668346312414112 20.7614394055072 70-74 24.19240506329114 27.746835443037977 27.437974683544304 20.622784810126582 75-79 24.21015443625719 27.33925507217119 28.21237508832139 20.238215403250226 80-84 24.61788452749708 27.39044330472757 27.481846341339562 20.50982582643579 85-89 24.412928420944453 27.439494373362113 27.614202764503364 20.533374441190073 90-94 24.010349288486417 27.353169469598964 27.653298835705048 20.983182406209572 95-99 24.72138822451784 26.940104829270773 28.548165487761434 19.79034145844995 100-104 24.803089587885562 27.760556938868845 27.328624421972663 20.10772905127293 105-109 24.159706661234466 27.984314524343045 27.36809940924832 20.48787940517417 110-114 25.09954058192956 27.866258295048496 26.72281776416539 20.31138335885656 115-119 25.010133765707337 27.487839481151195 27.766518038102962 19.735508715038506 120-124 25.457478449362302 28.119171245652062 26.82865352623885 19.594696778746787 125-129 26.03181097529791 27.970132460491996 26.435841047409603 19.562215516800492 130-134 25.60201458475421 27.96285609359425 27.02901211898641 19.406117202665126 135-139 26.07508166871954 27.783430621753336 27.039040325603814 19.102447383923312 140-144 26.054429144529976 27.485633741732624 26.92182587010734 19.538111243630055 145-149 26.42707240293809 27.869884575026234 26.416579223504723 19.286463798530956 150-151 26.47851186658114 26.991661321359846 26.568313021167416 19.961513790891598 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 31.0 1 18.0 2 4.5 3 3.5 4 2.5 5 4.0 6 4.0 7 4.5 8 4.5 9 1.5 10 1.5 11 1.5 12 1.0 13 1.5 14 1.0 15 0.5 16 1.5 17 2.0 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.0 25 1.0 26 2.0 27 2.0 28 4.0 29 5.0 30 5.0 31 12.0 32 17.5 33 24.0 34 34.5 35 43.5 36 59.5 37 82.5 38 115.0 39 146.5 40 185.0 41 231.0 42 244.0 43 246.5 44 261.0 45 292.5 46 278.5 47 260.0 48 262.0 49 220.5 50 173.5 51 144.0 52 131.0 53 115.0 54 82.0 55 56.0 56 53.5 57 46.5 58 29.0 59 16.0 60 10.5 61 8.5 62 6.0 63 3.5 64 3.5 65 1.5 66 0.5 67 1.0 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.25 2 0.525 3 0.8750000000000001 4 2.0 5 2.475 6 1.825 7 1.9 8 1.725 9 1.525 10-14 1.8849999999999998 15-19 2.325 20-24 1.97 25-29 1.6500000000000001 30-34 1.63 35-39 1.97 40-44 2.35 45-49 2.5100000000000002 50-54 1.865 55-59 1.905 60-64 1.9949999999999999 65-69 1.765 70-74 1.25 75-79 0.9299999999999999 80-84 1.5350000000000001 85-89 2.6950000000000003 90-94 3.375 95-99 1.745 100-104 1.6049999999999998 105-109 1.82 110-114 2.0500000000000003 115-119 1.32 120-124 0.815 125-129 2.235 130-134 4.695 135-139 6.635000000000001 140-144 7.7700000000000005 145-149 4.7 150-151 2.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95541401273886 97.1 2 0.8407643312101911 1.6500000000000001 3 0.07643312101910828 0.22499999999999998 4 0.05095541401273885 0.2 5 0.025477707006369425 0.125 6 0.0 0.0 7 0.025477707006369425 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025477707006369425 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.55 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.425 0.0 0.0 0.0 0.0 110-111 3.85 0.0 0.0 0.0 0.0 112-113 4.4125 0.0 0.0 0.0 0.0 114-115 4.824999999999999 0.0 0.0 0.0 0.0 116-117 5.375 0.0 0.0 0.0 0.0 118-119 6.050000000000001 0.0 0.0 0.0 0.0 120-121 6.5375 0.0 0.0 0.0 0.0 122-123 7.025 0.0 0.0 0.0 0.0 124-125 7.6375 0.0 0.0 0.0 0.0 126-127 8.225000000000001 0.0 0.0 0.0 0.0 128-129 9.212499999999999 0.0 0.0 0.0 0.0 130-131 9.95 0.0 0.0 0.0 0.0 132-133 10.45 0.0 0.0 0.0 0.0 134-135 10.925 0.0 0.0 0.0 0.0 136-137 11.6125 0.0 0.0 0.0 0.0 138-139 12.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACGAGG 10 0.0069790767 143.96251 9 AAAAAAA 65 0.0071201446 13.525542 125-129 >>END_MODULE Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688294 spots for SRR7170001.sra Written 688294 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra Read 688288 spots for SRR7170001.sra Written 688288 spots for SRR7170001.sra SRR ids: ['SRR7170001.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bfo93xz8 SRR7170001.sra spots: 13765766 blocks: [[1, 688288], [688289, 1376576], [1376577, 2064864], [2064865, 2753152], [2753153, 3441440], [3441441, 4129728], [4129729, 4818016], [4818017, 5506304], [5506305, 6194592], [6194593, 6882880], [6882881, 7571168], [7571169, 8259456], [8259457, 8947744], [8947745, 9636032], [9636033, 10324320], [10324321, 11012608], [11012609, 11700896], [11700897, 12389184], [12389185, 13077472], [13077473, 13765766]] SRR7170001 file size 4643066 SRR7170001 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170001 SRR7170001_1.fastq SRR7170001_2.fastq Input file: SRR7170001_1.fastq Paired file: SRR7170001_2.fastq trimmed: SRR7170001-trimmed-pair1.fastq, SRR7170001-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:34:44 2025 >> started Wed Feb 12 08:34:59 2025 >> done (14.712s) 13765766 read pairs processed; of these: 20652 ( 0.15%) short read pairs filtered out after trimming by size control 43337 ( 0.31%) empty read pairs filtered out after trimming by size control 13701777 (99.54%) read pairs available; of these: 7015369 (51.20%) trimmed read pairs available after processing 6686408 (48.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 6 0.00% 21 6 0.00% 22 8 0.00% 23 15 0.00% 24 7 0.00% 25 15 0.00% 26 14 0.00% 27 14 0.00% 28 20 0.00% 29 14 0.00% 30 17 0.00% 31 14 0.00% 32 20 0.00% 33 24 0.00% 34 20 0.00% 35 28 0.00% 36 35 0.00% 37 38 0.00% 38 30 0.00% 39 37 0.00% 40 40 0.00% 41 40 0.00% 42 47 0.00% 43 71 0.00% 44 82 0.00% 45 77 0.00% 46 73 0.00% 47 98 0.00% 48 106 0.00% 49 115 0.00% 50 161 0.00% 51 194 0.00% 52 190 0.00% 53 216 0.00% 54 185 0.00% 55 276 0.00% 56 253 0.00% 57 273 0.00% 58 356 0.00% 59 418 0.00% 60 466 0.00% 61 556 0.00% 62 610 0.00% 63 685 0.00% 64 882 0.01% 65 873 0.01% 66 929 0.01% 67 1085 0.01% 68 1285 0.01% 69 1587 0.01% 70 2118 0.02% 71 2068 0.02% 72 2145 0.02% 73 2534 0.02% 74 2692 0.02% 75 3165 0.02% 76 3200 0.02% 77 3364 0.02% 78 3828 0.03% 79 4447 0.03% 80 4887 0.04% 81 5741 0.04% 82 6522 0.05% 83 7497 0.05% 84 9156 0.07% 85 10221 0.07% 86 10663 0.08% 87 11468 0.08% 88 12041 0.09% 89 12514 0.09% 90 13718 0.10% 91 14911 0.11% 92 16144 0.12% 93 18062 0.13% 94 19248 0.14% 95 20376 0.15% 96 21219 0.15% 97 21790 0.16% 98 22124 0.16% 99 22829 0.17% 100 24535 0.18% 101 25934 0.19% 102 27948 0.20% 103 29577 0.22% 104 31500 0.23% 105 33494 0.24% 106 34345 0.25% 107 34669 0.25% 108 35345 0.26% 109 35690 0.26% 110 36688 0.27% 111 37863 0.28% 112 40145 0.29% 113 42692 0.31% 114 44885 0.33% 115 46952 0.34% 116 47914 0.35% 117 48195 0.35% 118 48521 0.35% 119 48917 0.36% 120 49835 0.36% 121 50993 0.37% 122 52633 0.38% 123 55546 0.41% 124 58227 0.42% 125 60510 0.44% 126 62258 0.45% 127 62344 0.46% 128 62814 0.46% 129 63861 0.47% 130 64502 0.47% 131 65708 0.48% 132 68889 0.50% 133 72144 0.53% 134 74648 0.54% 135 79125 0.58% 136 81879 0.60% 137 84891 0.62% 138 89228 0.65% 139 91820 0.67% 140 95003 0.69% 141 100388 0.73% 142 106794 0.78% 143 114905 0.84% 144 125112 0.91% 145 138770 1.01% 146 161407 1.18% 147 199162 1.45% 148 275892 2.01% 149 504663 3.68% 150 2762302 20.16% 151 6686408 48.80% 13701777 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=42 prefix-density=0.28 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=374.16 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=18.6 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=44 prefix-density=0.29 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=79.02 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=14.7 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7170001 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:35:45 Started mapping on | Feb 12 08:35:45 Finished on | Feb 12 08:37:50 Mapping speed, Million of reads per hour | 394.61 Number of input reads | 13701777 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12520215 Uniquely mapped reads % | 91.38% Average mapped length | 288.49 Number of splices: Total | 10535222 Number of splices: Annotated (sjdb) | 10337654 Number of splices: GT/AG | 10384029 Number of splices: GC/AG | 118414 Number of splices: AT/AC | 9145 Number of splices: Non-canonical | 23634 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213421 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 17649 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.89% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 984685 984685 984685 N_multimapping 213421 213421 213421 N_noFeature 259916 12325901 340673 N_ambiguous 161961 1026 47652 UnstrandedReadsAssigned:12098338 PositiveStrandReadsAssigned:193288 NegativeStrandReadsAssigned:12131890 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7170001 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170001-trimmed-pair1.fastq SRR7170001-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,701,777 reads, 12,111,861 reads pseudoaligned [quant] estimated average fragment length: 209.146 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,252 rounds 52401 SRR7170001.ke.tsv 34699 SRR7170001.se.tsv 87100 total ==> SRR7170001.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.85 207 8.6073 Potri.005G024800.1.v4.1 1035 826.854 26 2.36638 Potri.004G059700.1.v4.1 961 752.864 3 0.299878 Potri.007G009000.2.v4.1 1416 1207.85 0 0 Potri.003G141000.2.v4.1 2943 2734.85 140 3.85243 Potri.016G087400.1.v4.1 270 95.8993 1349 1058.61 Potri.015G069301.1.v4.1 564 358.391 0 0 Potri.010G195200.1.v4.1 1773 1564.85 6 0.288548 Potri.012G127500.1.v4.1 977 768.864 3971 388.679 ==> SRR7170001.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 969 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170001 completed mapping pipeline successfully