Starting /dee2/code/volunteer_pipeline.sh SRR7170002 current disk space = 3049721446400 free memory = 1582047484 SRR7170002 SRAfilesize 45692828cee36addd3c24b75dd1b2704 SRR7170002.sra SRR7170002.sra file validated SRR7170002 is paired end SRR7170002 is conventional basespace SRR7170002 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170002_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91125 34.0 33.0 34.0 33.0 34.0 2 33.391 34.0 33.0 34.0 33.0 34.0 3 33.38025 34.0 34.0 34.0 33.0 34.0 4 33.42875 34.0 34.0 34.0 33.0 34.0 5 33.48275 34.0 34.0 34.0 33.0 34.0 6 37.148 38.0 37.0 38.0 36.0 38.0 7 37.4505 38.0 38.0 38.0 37.0 38.0 8 37.48475 38.0 38.0 38.0 37.0 38.0 9 37.54375 38.0 38.0 38.0 38.0 38.0 10-14 37.54535 38.0 38.0 38.0 38.0 38.0 15-19 37.527300000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.505449999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.460300000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.45185 38.0 38.0 38.0 37.2 38.0 35-39 37.36035 38.0 38.0 38.0 37.2 38.0 40-44 37.1863 38.0 38.0 38.0 36.4 38.0 45-49 37.17865 38.0 38.0 38.0 36.2 38.0 50-54 37.097 38.0 38.0 38.0 36.0 38.0 55-59 37.064049999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.0272 38.0 38.0 38.0 36.0 38.0 65-69 37.001850000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.8421 38.0 38.0 38.0 35.2 38.0 75-79 36.7381 38.0 38.0 38.0 35.2 38.0 80-84 36.59695 38.0 38.0 38.0 34.2 38.0 85-89 36.482549999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.402049999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.30335 38.0 38.0 38.0 34.0 38.0 100-104 36.1103 38.0 37.2 38.0 33.2 38.0 105-109 36.036249999999995 38.0 37.0 38.0 33.0 38.0 110-114 35.79215 38.0 37.0 38.0 32.2 38.0 115-119 35.6069 38.0 36.8 38.0 31.0 38.0 120-124 35.2966 38.0 36.0 38.0 29.6 38.0 125-129 34.96475 38.0 35.6 38.0 28.0 38.0 130-134 34.36935 38.0 35.0 38.0 25.0 38.0 135-139 33.94225 38.0 34.8 38.0 22.6 38.0 140-144 33.623900000000006 38.0 34.4 38.0 22.2 38.0 145-149 32.784349999999996 38.0 33.8 38.0 15.4 38.0 150-151 28.844125 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 1.0 14 0.0 15 2.0 16 3.0 17 2.0 18 3.0 19 9.0 20 13.0 21 4.0 22 7.0 23 12.0 24 11.0 25 26.0 26 16.0 27 25.0 28 24.0 29 24.0 30 49.0 31 51.0 32 95.0 33 121.0 34 166.0 35 285.0 36 688.0 37 2359.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.09669211195929 12.51908396946565 8.804071246819339 34.58015267175573 2 22.975 14.549999999999999 33.275 29.2 3 20.5 19.85 26.025 33.625 4 22.7 27.400000000000002 22.925 26.974999999999998 5 22.5 30.775000000000002 24.95 21.775 6 20.625 33.95 25.1 20.325 7 15.875 25.900000000000002 39.725 18.5 8 18.15 26.200000000000003 30.15 25.5 9 17.075000000000003 24.2 34.825 23.9 10-14 20.200000000000003 28.89 27.310000000000002 23.599999999999998 15-19 19.794999999999998 29.265 27.13 23.810000000000002 20-24 19.895 28.18 28.144999999999996 23.78 25-29 20.015 28.804999999999996 27.310000000000002 23.87 30-34 20.06 28.744999999999997 27.29 23.905 35-39 20.119999999999997 28.27 27.495000000000005 24.115000000000002 40-44 20.405 28.375 27.544999999999998 23.674999999999997 45-49 20.59 27.700000000000003 27.439999999999998 24.27 50-54 20.125 27.87 28.16 23.845 55-59 20.455000000000002 28.335 27.500000000000004 23.71 60-64 19.865 27.944999999999997 27.685 24.505 65-69 20.294999999999998 28.799999999999997 27.065 23.84 70-74 20.14 28.43 27.675 23.755000000000003 75-79 20.655 28.42 26.474999999999998 24.45 80-84 20.75 28.52 26.705000000000002 24.025 85-89 20.465 28.749999999999996 27.189999999999998 23.595 90-94 20.865000000000002 28.225 27.185 23.724999999999998 95-99 21.0 27.955000000000002 27.275 23.77 100-104 21.51 27.875 27.065 23.549999999999997 105-109 20.74 28.455000000000002 27.015 23.79 110-114 20.810000000000002 28.175 27.125 23.89 115-119 20.875 28.13 27.115000000000002 23.880000000000003 120-124 21.09 27.98 26.705000000000002 24.224999999999998 125-129 20.36 27.215 27.485 24.94 130-134 20.775 27.175 27.845 24.205 135-139 20.715 28.110000000000003 27.334999999999997 23.84 140-144 21.305 27.725 26.974999999999998 23.995 145-149 21.115000000000002 28.21 26.529999999999998 24.145 150-151 21.2375 26.637499999999996 28.275 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 2.0 25 4.0 26 3.5 27 4.5 28 6.5 29 10.0 30 16.5 31 20.0 32 23.0 33 32.5 34 42.0 35 59.5 36 75.0 37 94.5 38 121.0 39 137.5 40 177.5 41 205.5 42 217.5 43 262.0 44 296.5 45 285.0 46 259.5 47 262.0 48 257.5 49 219.0 50 184.5 51 168.5 52 141.5 53 115.0 54 89.5 55 56.0 56 42.0 57 29.5 58 18.0 59 14.0 60 12.0 61 6.5 62 6.0 63 8.5 64 3.5 65 1.5 66 2.0 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.2 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.074999999999999 0.0 0.0 0.0 0.0 130-131 5.4 0.0 0.0 0.0 0.0 132-133 5.7 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170002 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170002_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65525 33.0 33.0 34.0 31.0 34.0 2 32.197 33.0 33.0 34.0 31.0 34.0 3 32.2115 34.0 33.0 34.0 31.0 34.0 4 31.905 34.0 33.0 34.0 31.0 34.0 5 31.87925 34.0 33.0 34.0 31.0 34.0 6 36.29525 38.0 38.0 38.0 35.0 38.0 7 36.184 38.0 38.0 38.0 35.0 38.0 8 36.2675 38.0 38.0 38.0 35.0 38.0 9 36.36275 38.0 38.0 38.0 36.0 38.0 10-14 36.2294 38.0 38.0 38.0 35.4 38.0 15-19 35.97814999999999 38.0 38.0 38.0 34.6 38.0 20-24 36.1074 38.0 38.0 38.0 35.0 38.0 25-29 36.2474 38.0 38.0 38.0 35.8 38.0 30-34 36.2679 38.0 38.0 38.0 36.0 38.0 35-39 36.094550000000005 38.0 38.0 38.0 35.2 38.0 40-44 35.96679999999999 38.0 38.0 38.0 35.0 38.0 45-49 35.86405 38.0 38.0 38.0 34.0 38.0 50-54 36.10145 38.0 38.0 38.0 34.8 38.0 55-59 36.0296 38.0 38.0 38.0 34.6 38.0 60-64 35.975350000000006 38.0 38.0 38.0 34.4 38.0 65-69 35.91525 38.0 38.0 38.0 34.0 38.0 70-74 35.828950000000006 38.0 38.0 38.0 34.0 38.0 75-79 35.8164 38.0 38.0 38.0 33.8 38.0 80-84 35.7151 38.0 38.0 38.0 33.4 38.0 85-89 35.2299 38.0 38.0 38.0 30.2 38.0 90-94 34.895849999999996 38.0 38.0 38.0 28.4 38.0 95-99 35.18294999999999 38.0 37.8 38.0 29.2 38.0 100-104 35.307399999999994 38.0 38.0 38.0 31.0 38.0 105-109 35.214349999999996 38.0 38.0 38.0 30.0 38.0 110-114 35.08195 38.0 38.0 38.0 29.8 38.0 115-119 34.76665 38.0 37.0 38.0 27.4 38.0 120-124 34.5324 38.0 36.2 38.0 25.8 38.0 125-129 34.095949999999995 38.0 35.8 38.0 22.8 38.0 130-134 33.09589999999999 38.0 35.0 38.0 14.0 38.0 135-139 32.089749999999995 38.0 34.2 38.0 4.2 38.0 140-144 31.22425 38.0 33.0 38.0 2.0 38.0 145-149 30.77845 38.0 31.4 38.0 2.0 38.0 150-151 27.027749999999997 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 82.0 3 15.0 4 4.0 5 2.0 6 3.0 7 0.0 8 1.0 9 1.0 10 6.0 11 0.0 12 1.0 13 4.0 14 5.0 15 5.0 16 2.0 17 12.0 18 9.0 19 7.0 20 9.0 21 15.0 22 13.0 23 12.0 24 17.0 25 25.0 26 33.0 27 31.0 28 38.0 29 37.0 30 61.0 31 76.0 32 113.0 33 140.0 34 148.0 35 194.0 36 463.0 37 2416.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.09836914315299 22.417809992234012 13.279834325653637 24.203986538959356 2 26.750948166877368 28.192161820480404 29.582806573957015 15.47408343868521 3 20.28911995942176 29.393862541212272 29.44458534111083 20.872432158255137 4 23.70922167993835 34.67762650911893 22.16799383508862 19.445157975854098 5 23.911363050760112 36.58850811646483 22.004637979902085 17.495490852872972 6 20.96978928662097 36.68443767453668 23.381568926123382 18.964204112718964 7 21.524777636594663 22.770012706480305 35.83227445997459 19.872935196950444 8 22.7998985544002 24.346943951306113 26.933806746132387 25.919350748161296 9 23.211567732115675 25.038051750380518 28.513444951801116 23.236935565702687 10-14 23.93920848633211 28.809669522643823 25.928192574459402 21.32292941656467 15-19 23.92710472279261 28.16735112936345 26.65811088295688 21.247433264887064 20-24 24.09497064079653 28.45545059994894 26.285422517232576 21.164156242021956 25-29 23.59727586907908 28.56271599918683 26.77881683268957 21.06119129904452 30-34 23.47551664460959 28.280566018527946 27.364348976890966 20.879568359971497 35-39 23.68232890704801 28.176710929519917 27.446373850868234 20.69458631256384 40-44 23.62955745859187 28.22932157325265 26.8088815958156 21.33223937233988 45-49 24.574358974358972 28.02051282051282 26.620512820512822 20.784615384615385 50-54 23.472505091649694 28.35030549898167 27.143584521384927 21.033604887983707 55-59 24.149191285269655 27.47078932598602 27.429970916883516 20.95004847186081 60-64 23.66474519206244 27.69474060092843 27.51109524052441 21.12941896648472 65-69 23.603465851172274 27.56371049949032 28.093781855249745 20.739041794087665 70-74 23.903575407677504 27.868935480603668 27.256153144940747 20.97133596677808 75-79 23.99858206309819 27.426950929255078 27.740922671798245 20.833544335848483 80-84 24.208973445925324 27.937735273171228 27.449384474514193 20.40390680638926 85-89 24.6314812905886 27.95588083702711 27.151840016493146 20.260797855891145 90-94 24.145986917246393 27.3128439414391 27.67625376388745 20.86491537742706 95-99 24.425067564122177 27.571261026974657 27.107235735046658 20.89643567385651 100-104 24.2760445824215 27.77749503791542 27.222759427960714 20.723700951702376 105-109 24.149538430152496 28.270515632172184 27.077064313765494 20.502881623909825 110-114 24.40646745804339 27.29226361031519 27.57367990176013 20.727589029881294 115-119 24.7649062166421 27.514868093325877 27.30137752249276 20.418848167539267 120-124 24.601608741842465 27.606617089087877 27.024839378762582 20.766934790307076 125-129 25.113968140142397 28.212877119295186 26.578906930287356 20.09424781027506 130-134 25.46342488053353 27.710969910203225 26.807750879588298 20.017854329674947 135-139 25.206390050391335 27.313176798541868 27.18987884636003 20.290554304706767 140-144 25.421058350537866 27.615994784309468 27.110724763664024 19.852222101488646 145-149 25.339912856317916 27.80723397553677 26.51582760249882 20.337025565646492 150-151 26.375881975625397 27.030147530468252 26.132135984605515 20.461834509300832 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 47.0 1 25.5 2 2.5 3 1.0 4 1.0 5 1.5 6 2.0 7 1.0 8 1.5 9 2.0 10 1.0 11 0.5 12 1.5 13 2.0 14 1.5 15 2.0 16 1.5 17 2.0 18 1.5 19 0.0 20 1.0 21 2.5 22 3.0 23 2.0 24 1.5 25 1.0 26 0.0 27 1.5 28 5.0 29 8.0 30 11.5 31 15.5 32 18.0 33 22.0 34 31.5 35 38.5 36 51.5 37 83.0 38 109.5 39 140.0 40 186.0 41 226.0 42 254.0 43 270.0 44 293.5 45 296.0 46 283.0 47 271.5 48 250.0 49 218.0 50 166.5 51 132.5 52 113.0 53 95.5 54 86.0 55 69.5 56 55.0 57 35.5 58 17.5 59 15.5 60 12.5 61 8.0 62 8.0 63 6.5 64 1.5 65 1.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.4250000000000003 2 1.125 3 1.425 4 2.675 5 2.9749999999999996 6 1.525 7 1.625 8 1.425 9 1.4500000000000002 10-14 1.96 15-19 2.6 20-24 2.075 25-29 1.6199999999999999 30-34 1.77 35-39 2.1 40-44 2.495 45-49 2.5 50-54 1.7999999999999998 55-59 2.005 60-64 1.9849999999999999 65-69 1.9 70-74 1.27 75-79 1.265 80-84 1.71 85-89 2.9899999999999998 90-94 3.6900000000000004 95-99 1.9449999999999998 100-104 1.755 105-109 1.965 110-114 2.2800000000000002 115-119 1.635 120-124 1.165 125-129 2.385 130-134 4.784999999999999 135-139 6.7299999999999995 140-144 7.969999999999999 145-149 4.755 150-151 2.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4655128531433 97.7 2 0.43268007126495295 0.8500000000000001 3 0.025451768897938407 0.075 4 0.0 0.0 5 0.050903537795876815 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025451768897938407 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 45 1.125 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.475 0.0 0.0 0.0 0.0 122-123 3.7750000000000004 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.487500000000001 0.0 0.0 0.0 0.0 128-129 4.925000000000001 0.0 0.0 0.0 0.0 130-131 5.2125 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 6.0 0.0 0.0 0.0 0.0 136-137 6.449999999999999 0.0 0.0 0.0 0.0 138-139 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCAA 10 0.0068116155 145.06493 4 CCAAGCT 10 0.0068116155 145.06493 3 >>END_MODULE Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra Read 803408 spots for SRR7170002.sra Written 803408 spots for SRR7170002.sra Read 803403 spots for SRR7170002.sra Written 803403 spots for SRR7170002.sra SRR ids: ['SRR7170002.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0punbimt SRR7170002.sra spots: 16068065 blocks: [[1, 803403], [803404, 1606806], [1606807, 2410209], [2410210, 3213612], [3213613, 4017015], [4017016, 4820418], [4820419, 5623821], [5623822, 6427224], [6427225, 7230627], [7230628, 8034030], [8034031, 8837433], [8837434, 9640836], [9640837, 10444239], [10444240, 11247642], [11247643, 12051045], [12051046, 12854448], [12854449, 13657851], [13657852, 14461254], [14461255, 15264657], [15264658, 16068065]] SRR7170002 file size 5423239 SRR7170002 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170002 SRR7170002_1.fastq SRR7170002_2.fastq Input file: SRR7170002_1.fastq Paired file: SRR7170002_2.fastq trimmed: SRR7170002-trimmed-pair1.fastq, SRR7170002-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:50:35 2025 >> started Wed Feb 12 09:50:55 2025 >> done (19.893s) 16068065 read pairs processed; of these: 21581 ( 0.13%) short read pairs filtered out after trimming by size control 37101 ( 0.23%) empty read pairs filtered out after trimming by size control 16009383 (99.63%) read pairs available; of these: 8124224 (50.75%) trimmed read pairs available after processing 7885159 (49.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 17 0.00% 27 11 0.00% 28 11 0.00% 29 8 0.00% 30 16 0.00% 31 19 0.00% 32 13 0.00% 33 15 0.00% 34 16 0.00% 35 33 0.00% 36 22 0.00% 37 20 0.00% 38 27 0.00% 39 22 0.00% 40 36 0.00% 41 27 0.00% 42 36 0.00% 43 40 0.00% 44 45 0.00% 45 58 0.00% 46 58 0.00% 47 70 0.00% 48 71 0.00% 49 99 0.00% 50 105 0.00% 51 124 0.00% 52 132 0.00% 53 159 0.00% 54 154 0.00% 55 177 0.00% 56 203 0.00% 57 221 0.00% 58 249 0.00% 59 285 0.00% 60 308 0.00% 61 335 0.00% 62 439 0.00% 63 503 0.00% 64 528 0.00% 65 559 0.00% 66 621 0.00% 67 735 0.00% 68 802 0.01% 69 962 0.01% 70 1216 0.01% 71 1252 0.01% 72 1466 0.01% 73 1597 0.01% 74 1798 0.01% 75 1989 0.01% 76 2096 0.01% 77 2291 0.01% 78 2457 0.02% 79 2822 0.02% 80 3114 0.02% 81 3522 0.02% 82 4267 0.03% 83 4864 0.03% 84 6254 0.04% 85 7009 0.04% 86 7380 0.05% 87 8090 0.05% 88 8615 0.05% 89 8747 0.05% 90 9597 0.06% 91 10396 0.06% 92 11100 0.07% 93 12080 0.08% 94 13078 0.08% 95 14113 0.09% 96 15027 0.09% 97 15690 0.10% 98 15923 0.10% 99 16684 0.10% 100 17874 0.11% 101 18415 0.12% 102 20462 0.13% 103 21497 0.13% 104 22989 0.14% 105 23909 0.15% 106 25190 0.16% 107 25734 0.16% 108 26868 0.17% 109 27442 0.17% 110 28237 0.18% 111 29339 0.18% 112 30813 0.19% 113 33165 0.21% 114 34498 0.22% 115 36623 0.23% 116 37786 0.24% 117 38940 0.24% 118 39561 0.25% 119 40004 0.25% 120 41299 0.26% 121 42495 0.27% 122 44295 0.28% 123 46465 0.29% 124 49036 0.31% 125 51389 0.32% 126 52980 0.33% 127 54611 0.34% 128 55977 0.35% 129 58251 0.36% 130 59727 0.37% 131 62061 0.39% 132 64818 0.40% 133 68003 0.42% 134 71333 0.45% 135 76330 0.48% 136 81413 0.51% 137 85320 0.53% 138 91633 0.57% 139 98008 0.61% 140 103777 0.65% 141 112263 0.70% 142 121171 0.76% 143 132659 0.83% 144 149170 0.93% 145 171861 1.07% 146 209675 1.31% 147 280361 1.75% 148 383635 2.40% 149 733830 4.58% 150 3668066 22.91% 151 7885159 49.25% 16009383 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=299.93 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=29.13 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.0 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAG SRR7170002 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:51:37 Started mapping on | Feb 12 09:51:37 Finished on | Feb 12 09:53:31 Mapping speed, Million of reads per hour | 505.56 Number of input reads | 16009383 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15030148 Uniquely mapped reads % | 93.88% Average mapped length | 291.99 Number of splices: Total | 13707536 Number of splices: Annotated (sjdb) | 13480833 Number of splices: GT/AG | 13519344 Number of splices: GC/AG | 148690 Number of splices: AT/AC | 10387 Number of splices: Non-canonical | 29115 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272117 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 25019 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.22% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 724936 724936 724936 N_multimapping 272117 272117 272117 N_noFeature 253622 14854096 319627 N_ambiguous 171232 645 60786 UnstrandedReadsAssigned:14605294 PositiveStrandReadsAssigned:175407 NegativeStrandReadsAssigned:14649735 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170002 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170002-trimmed-pair1.fastq SRR7170002-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,009,383 reads, 14,571,029 reads pseudoaligned [quant] estimated average fragment length: 225.813 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7170002.ke.tsv 34699 SRR7170002.se.tsv 87100 total ==> SRR7170002.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.19 240 8.69512 Potri.005G024800.1.v4.1 1035 810.187 39 3.1273 Potri.004G059700.1.v4.1 961 736.195 6 0.529478 Potri.007G009000.2.v4.1 1416 1191.19 0 0 Potri.003G141000.2.v4.1 2943 2718.19 223.029 5.33054 Potri.016G087400.1.v4.1 270 86.1861 1787.97 1347.76 Potri.015G069301.1.v4.1 564 342.526 0 0 Potri.010G195200.1.v4.1 1773 1548.19 12 0.503556 Potri.012G127500.1.v4.1 977 752.187 2321 200.465 ==> SRR7170002.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1041 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170002 completed mapping pipeline successfully