Starting /dee2/code/volunteer_pipeline.sh SRR7170003 current disk space = 3049798279168 free memory = 1581550552 SRR7170003 SRAfilesize dedecef44a175e9b3d8581e0de0fbdea SRR7170003.sra SRR7170003.sra file validated SRR7170003 is paired end SRR7170003 is conventional basespace SRR7170003 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170003_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2555 34.0 34.0 34.0 33.0 34.0 2 33.579 34.0 34.0 34.0 33.0 34.0 3 33.58175 34.0 34.0 34.0 33.0 34.0 4 33.637 34.0 34.0 34.0 33.0 34.0 5 33.60125 34.0 34.0 34.0 33.0 34.0 6 37.439 38.0 38.0 38.0 37.0 38.0 7 37.59675 38.0 38.0 38.0 38.0 38.0 8 37.67825 38.0 38.0 38.0 38.0 38.0 9 37.65775 38.0 38.0 38.0 38.0 38.0 10-14 37.679700000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.673449999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.666199999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.672349999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.6394 38.0 38.0 38.0 38.0 38.0 35-39 37.5921 38.0 38.0 38.0 38.0 38.0 40-44 37.4276 38.0 38.0 38.0 37.4 38.0 45-49 37.285399999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.362649999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.3162 38.0 38.0 38.0 37.0 38.0 60-64 37.29015 38.0 38.0 38.0 37.0 38.0 65-69 37.21545 38.0 38.0 38.0 36.6 38.0 70-74 37.2 38.0 38.0 38.0 36.4 38.0 75-79 37.15415 38.0 38.0 38.0 36.4 38.0 80-84 37.02435 38.0 38.0 38.0 36.0 38.0 85-89 36.838699999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.675850000000004 38.0 38.0 38.0 35.4 38.0 95-99 36.55055 38.0 38.0 38.0 34.8 38.0 100-104 36.603750000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.52865 38.0 38.0 38.0 34.2 38.0 110-114 36.34815 38.0 38.0 38.0 34.0 38.0 115-119 36.158750000000005 38.0 38.0 38.0 33.6 38.0 120-124 35.98935 38.0 37.2 38.0 33.0 38.0 125-129 35.7313 38.0 36.6 38.0 32.2 38.0 130-134 35.353249999999996 38.0 36.0 38.0 30.6 38.0 135-139 34.94955 38.0 36.0 38.0 28.2 38.0 140-144 34.7305 38.0 35.8 38.0 28.0 38.0 145-149 34.07690000000001 38.0 35.0 38.0 25.2 38.0 150-151 30.67925 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 3.0 16 2.0 17 2.0 18 4.0 19 6.0 20 4.0 21 6.0 22 5.0 23 5.0 24 13.0 25 10.0 26 19.0 27 16.0 28 16.0 29 25.0 30 41.0 31 33.0 32 53.0 33 71.0 34 133.0 35 188.0 36 555.0 37 2787.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.871587462082914 12.714863498483316 9.327603640040445 35.085945399393324 2 23.7 14.35 31.3 30.65 3 21.125 17.974999999999998 24.925 35.975 4 22.85 24.925 23.974999999999998 28.249999999999996 5 23.125 30.475 22.225 24.175 6 21.475 33.125 24.95 20.45 7 16.025 28.725 37.325 17.925 8 18.5 27.1 29.575000000000003 24.825 9 18.45 26.075 32.975 22.5 10-14 20.330000000000002 30.04 26.790000000000003 22.84 15-19 20.465 28.449999999999996 27.24 23.845 20-24 20.375 29.035 27.095000000000002 23.494999999999997 25-29 20.19 28.92 26.979999999999997 23.91 30-34 20.565 28.825 27.224999999999998 23.385 35-39 20.665 27.71 27.36 24.265 40-44 20.63222127744711 28.374931225929075 27.224528585004755 23.768318911619065 45-49 20.32801685224195 28.287691844718626 27.204333433644294 24.179957869395125 50-54 20.645 28.735 27.415 23.205000000000002 55-59 20.349999999999998 28.405 27.0 24.245 60-64 20.14 28.849999999999998 27.485 23.525 65-69 20.895 27.52 27.43 24.154999999999998 70-74 21.23 28.110000000000003 26.950000000000003 23.71 75-79 21.295 27.57 26.939999999999998 24.195 80-84 20.5 28.675 26.815 24.01 85-89 20.888265075943657 27.83598175347135 27.530202015138606 23.745551155446385 90-94 20.97585513078471 27.414486921529175 26.836016096579478 24.77364185110664 95-99 20.72348561078688 28.43630509156772 26.886697524652845 23.953511772992552 100-104 20.71832890848069 28.282322296248058 27.115163051645546 23.884185743625707 105-109 20.73 28.185 27.355 23.73 110-114 21.762643965948925 28.23234852278418 26.394591887831748 23.610415623435152 115-119 20.751037551877594 28.466423321166058 26.80134006700335 23.981199059953 120-124 21.43 28.08 26.584999999999997 23.905 125-129 21.45 28.134999999999998 26.965 23.45 130-134 21.38954333550554 27.2895884505489 27.229435059401474 24.091433154544088 135-139 21.620942618832277 28.595116068736807 26.032559541754598 23.751381770676314 140-144 21.471930968745298 28.881753875482868 25.871670094817638 23.774645060954196 145-149 21.46541793960034 28.42189612861221 26.18320228376822 23.929483648019232 150-151 20.25 29.15 25.825 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.5 25 3.0 26 4.0 27 4.0 28 7.5 29 9.5 30 17.0 31 23.0 32 24.0 33 32.5 34 40.0 35 54.0 36 74.0 37 97.0 38 121.0 39 134.0 40 166.0 41 201.0 42 220.5 43 231.5 44 257.0 45 285.0 46 276.5 47 253.5 48 251.0 49 233.5 50 195.5 51 180.5 52 146.5 53 112.0 54 93.0 55 64.0 56 40.5 57 35.0 58 29.0 59 18.5 60 15.5 61 14.0 62 10.0 63 5.0 64 4.0 65 3.5 66 3.5 67 3.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.034999999999999996 45-49 0.31 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.255 90-94 0.6 95-99 0.62 100-104 0.185 105-109 0.0 110-114 0.15 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.255 135-139 0.49 140-144 0.335 145-149 0.165 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.7000000000000002 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.7874999999999996 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.4125 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 60-64 >>END_MODULE SRR7170003 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170003_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33225 33.0 33.0 34.0 32.0 34.0 2 32.4645 34.0 33.0 34.0 32.0 34.0 3 32.45425 34.0 33.0 34.0 32.0 34.0 4 32.20575 34.0 33.0 34.0 32.0 34.0 5 32.245 34.0 33.0 34.0 32.0 34.0 6 36.442 38.0 38.0 38.0 36.0 38.0 7 36.348 38.0 38.0 38.0 36.0 38.0 8 36.46325 38.0 38.0 38.0 37.0 38.0 9 36.36975 38.0 38.0 38.0 36.0 38.0 10-14 36.37635 38.0 38.0 38.0 36.6 38.0 15-19 36.18535000000001 38.0 38.0 38.0 36.2 38.0 20-24 36.2832 38.0 38.0 38.0 36.6 38.0 25-29 36.373900000000006 38.0 38.0 38.0 37.0 38.0 30-34 36.38805 38.0 38.0 38.0 37.0 38.0 35-39 36.3458 38.0 38.0 38.0 37.0 38.0 40-44 36.1603 38.0 38.0 38.0 36.2 38.0 45-49 36.087599999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.26365 38.0 38.0 38.0 36.0 38.0 55-59 36.2524 38.0 38.0 38.0 36.0 38.0 60-64 36.205799999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.143899999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.13315 38.0 38.0 38.0 36.0 38.0 75-79 36.1057 38.0 38.0 38.0 36.0 38.0 80-84 35.95635 38.0 38.0 38.0 35.0 38.0 85-89 35.6361 38.0 38.0 38.0 34.4 38.0 90-94 35.3937 38.0 38.0 38.0 33.4 38.0 95-99 35.61795 38.0 38.0 38.0 33.6 38.0 100-104 35.588499999999996 38.0 38.0 38.0 33.8 38.0 105-109 35.485049999999994 38.0 38.0 38.0 33.2 38.0 110-114 35.23585 38.0 38.0 38.0 31.4 38.0 115-119 35.2404 38.0 38.0 38.0 31.0 38.0 120-124 34.99325 38.0 37.8 38.0 29.4 38.0 125-129 34.514 38.0 37.0 38.0 25.8 38.0 130-134 33.8964 38.0 36.2 38.0 19.2 38.0 135-139 33.152750000000005 38.0 35.4 38.0 13.6 38.0 140-144 32.39885 38.0 33.2 38.0 4.2 38.0 145-149 31.872750000000003 38.0 33.4 38.0 2.0 38.0 150-151 28.005249999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 92.0 3 11.0 4 1.0 5 0.0 6 4.0 7 0.0 8 5.0 9 5.0 10 4.0 11 3.0 12 2.0 13 2.0 14 2.0 15 4.0 16 5.0 17 4.0 18 9.0 19 4.0 20 10.0 21 4.0 22 9.0 23 14.0 24 14.0 25 19.0 26 14.0 27 23.0 28 30.0 29 36.0 30 38.0 31 61.0 32 82.0 33 117.0 34 94.0 35 161.0 36 384.0 37 2733.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.71996939556236 22.162713593471054 13.695485845447589 26.421831165519 2 28.491761723700886 27.579214195183777 27.249683143219265 16.67934093789607 3 21.1088504577823 30.34079348931841 28.763987792472022 19.786368260427263 4 24.17948717948718 33.48717948717949 23.256410256410255 19.076923076923077 5 25.731895223420647 36.9542886492039 20.724191063174114 16.589625064201336 6 21.087567015573143 36.8904774061782 23.28312484043911 18.738830737809547 7 22.159816185856524 21.802399795762064 35.07786571355629 20.95991830482512 8 22.77480234634022 25.911757204794693 26.0902830910482 25.223157357816884 9 21.84788157223073 26.442062276671773 29.5048494129658 22.2052067381317 10-14 24.313545022242675 28.485964104924065 25.448688449148644 21.751802423684612 15-19 23.684751335799426 28.118577887381836 26.87011919441019 21.32655158240855 20-24 23.49422231311995 28.382247673586257 26.919930463237552 21.203599550056243 25-29 24.260385263910887 28.16412038219815 26.88161054621634 20.69388380767462 30-34 24.127535639466558 28.072147565275152 26.753870522712177 21.046446272546117 35-39 23.554713502995543 27.78432075375083 27.564135388396743 21.09683035485688 40-44 24.238220029803195 26.75093777298186 27.490879194286006 21.519963002928936 45-49 24.139171548977284 27.61332099907493 27.06855791962175 21.178949532326037 50-54 23.87350567078778 28.27730663124553 26.897925819965263 20.951261878001432 55-59 23.655968928863448 28.091782502044154 27.22812755519215 21.024121013900245 60-64 23.956043956043956 27.789419882443138 26.971633018144647 21.28290314336826 65-69 24.82645977950184 26.786443446304613 27.495916700694163 20.891180073499388 70-74 23.775120834393284 27.74357669804121 27.0516408038667 21.429661663698806 75-79 23.89799450269775 27.089483864399877 27.949709864603484 21.06281176829889 80-84 23.978966714314886 27.532162548499077 27.2973248927915 21.191545844394525 85-89 23.998968008255932 27.791537667698655 27.275541795665635 20.933952528379773 90-94 23.60621761658031 27.445595854922278 27.99481865284974 20.95336787564767 95-99 24.32722807735598 27.100173948633994 27.489000306968176 21.08359766704185 100-104 24.327771825093116 27.409561712332263 27.79223429766825 20.47043216490637 105-109 24.273933309429903 26.983557854837887 27.516262869436048 21.226245966296165 110-114 24.450140989489874 27.885157651884136 27.31607280184568 20.348628556780312 115-119 24.57358798896946 27.36186293534879 27.06056582575835 21.0039832499234 120-124 24.97838360205483 27.25700625603988 27.012868114541476 20.751742027363818 125-129 24.933155080213904 28.049156725627313 26.784245166598108 20.233443027560675 130-134 25.21228640318692 28.021805220673023 25.951357584652477 20.814550791487576 135-139 25.207402680280794 27.32397362263348 27.068708785364816 20.39991491172091 140-144 26.057511421660845 27.358237033055634 26.62725073904864 19.957000806234884 145-149 26.20469306515818 27.739367274251 26.377540331028705 19.678399329562122 150-151 25.28661599896947 27.759886641762204 26.39443514105372 20.559062218214606 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 61.0 1 34.5 2 4.5 3 0.5 4 0.0 5 2.0 6 2.5 7 1.0 8 1.0 9 1.5 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 2.5 26 4.0 27 3.0 28 4.5 29 6.0 30 8.0 31 11.5 32 12.5 33 19.5 34 26.5 35 37.5 36 52.0 37 71.0 38 102.0 39 133.0 40 175.0 41 216.5 42 244.0 43 275.0 44 280.0 45 267.0 46 281.0 47 281.5 48 254.5 49 235.0 50 199.5 51 162.0 52 139.0 53 111.5 54 86.0 55 65.0 56 38.0 57 19.0 58 20.0 59 17.0 60 15.0 61 12.5 62 6.0 63 4.0 64 1.5 65 1.5 66 2.5 67 2.5 68 1.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.975 2 1.375 3 1.7000000000000002 4 2.5 5 2.65 6 2.075 7 2.075 8 1.975 9 2.0500000000000003 10-14 2.215 15-19 2.68 20-24 2.21 25-29 2.145 30-34 2.145 35-39 2.355 40-44 2.6950000000000003 45-49 2.71 50-54 2.13 55-59 2.16 60-64 2.175 65-69 2.04 70-74 1.725 75-79 1.77 80-84 2.06 85-89 3.1 90-94 3.5000000000000004 95-99 2.27 100-104 2.005 105-109 2.385 110-114 2.475 115-119 2.09 120-124 1.695 125-129 2.76 130-134 4.61 135-139 5.9799999999999995 140-144 6.9750000000000005 145-149 4.54 150-151 2.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.33588761174968 97.225 2 0.5363984674329502 1.05 3 0.07662835249042146 0.22499999999999998 4 0.0 0.0 5 0.02554278416347382 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554278416347382 1.375 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 55 1.375 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.0375 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.4375 0.0 0.0 0.0 0.0 124-125 4.862500000000001 0.0 0.0 0.0 0.0 126-127 5.35 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.2375 0.0 0.0 0.0 0.0 132-133 6.825 0.0 0.0 0.0 0.0 134-135 7.3875 0.0 0.0 0.0 0.0 136-137 7.9875 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587758 spots for SRR7170003.sra Written 587758 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra Read 587754 spots for SRR7170003.sra Written 587754 spots for SRR7170003.sra SRR ids: ['SRR7170003.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vdi2uby3 SRR7170003.sra spots: 11755084 blocks: [[1, 587754], [587755, 1175508], [1175509, 1763262], [1763263, 2351016], [2351017, 2938770], [2938771, 3526524], [3526525, 4114278], [4114279, 4702032], [4702033, 5289786], [5289787, 5877540], [5877541, 6465294], [6465295, 7053048], [7053049, 7640802], [7640803, 8228556], [8228557, 8816310], [8816311, 9404064], [9404065, 9991818], [9991819, 10579572], [10579573, 11167326], [11167327, 11755084]] SRR7170003 file size 3961711 SRR7170003 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170003 SRR7170003_1.fastq SRR7170003_2.fastq Input file: SRR7170003_1.fastq Paired file: SRR7170003_2.fastq trimmed: SRR7170003-trimmed-pair1.fastq, SRR7170003-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:54:09 2025 >> started Wed Feb 12 09:54:22 2025 >> done (12.756s) 11755084 read pairs processed; of these: 18036 ( 0.15%) short read pairs filtered out after trimming by size control 35717 ( 0.30%) empty read pairs filtered out after trimming by size control 11701331 (99.54%) read pairs available; of these: 5551303 (47.44%) trimmed read pairs available after processing 6150028 (52.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 7 0.00% 21 0 0.00% 22 4 0.00% 23 7 0.00% 24 3 0.00% 25 5 0.00% 26 7 0.00% 27 9 0.00% 28 11 0.00% 29 7 0.00% 30 10 0.00% 31 11 0.00% 32 12 0.00% 33 18 0.00% 34 6 0.00% 35 18 0.00% 36 12 0.00% 37 14 0.00% 38 17 0.00% 39 15 0.00% 40 19 0.00% 41 12 0.00% 42 21 0.00% 43 27 0.00% 44 30 0.00% 45 47 0.00% 46 35 0.00% 47 57 0.00% 48 68 0.00% 49 83 0.00% 50 67 0.00% 51 84 0.00% 52 91 0.00% 53 86 0.00% 54 115 0.00% 55 117 0.00% 56 154 0.00% 57 146 0.00% 58 202 0.00% 59 182 0.00% 60 225 0.00% 61 250 0.00% 62 278 0.00% 63 348 0.00% 64 391 0.00% 65 402 0.00% 66 471 0.00% 67 524 0.00% 68 647 0.01% 69 835 0.01% 70 1303 0.01% 71 1474 0.01% 72 1411 0.01% 73 1345 0.01% 74 1338 0.01% 75 1420 0.01% 76 1575 0.01% 77 1708 0.01% 78 1855 0.02% 79 2002 0.02% 80 2323 0.02% 81 2613 0.02% 82 3046 0.03% 83 3436 0.03% 84 4551 0.04% 85 5413 0.05% 86 5704 0.05% 87 5971 0.05% 88 6543 0.06% 89 6976 0.06% 90 7367 0.06% 91 7699 0.07% 92 8361 0.07% 93 9082 0.08% 94 9765 0.08% 95 10464 0.09% 96 11530 0.10% 97 12105 0.10% 98 12444 0.11% 99 12769 0.11% 100 13362 0.11% 101 14226 0.12% 102 15277 0.13% 103 16073 0.14% 104 16725 0.14% 105 18257 0.16% 106 18966 0.16% 107 20015 0.17% 108 20023 0.17% 109 20921 0.18% 110 21443 0.18% 111 22117 0.19% 112 23302 0.20% 113 24340 0.21% 114 25481 0.22% 115 26518 0.23% 116 27796 0.24% 117 28864 0.25% 118 29303 0.25% 119 29750 0.25% 120 30757 0.26% 121 31351 0.27% 122 31988 0.27% 123 33481 0.29% 124 35012 0.30% 125 36166 0.31% 126 37704 0.32% 127 39518 0.34% 128 40329 0.34% 129 41594 0.36% 130 43003 0.37% 131 44041 0.38% 132 45569 0.39% 133 47402 0.41% 134 49058 0.42% 135 51684 0.44% 136 54239 0.46% 137 57633 0.49% 138 61764 0.53% 139 66947 0.57% 140 69476 0.59% 141 74759 0.64% 142 80563 0.69% 143 86758 0.74% 144 95730 0.82% 145 109179 0.93% 146 129490 1.11% 147 162636 1.39% 148 238049 2.03% 149 453002 3.87% 150 2569853 21.96% 151 6150028 52.56% 11701331 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=100.61 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=17.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.47 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=107.80 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=12.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7170003 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:55:04 Started mapping on | Feb 12 09:55:04 Finished on | Feb 12 09:56:11 Mapping speed, Million of reads per hour | 628.73 Number of input reads | 11701331 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11102683 Uniquely mapped reads % | 94.88% Average mapped length | 292.18 Number of splices: Total | 10480712 Number of splices: Annotated (sjdb) | 10306067 Number of splices: GT/AG | 10330405 Number of splices: GC/AG | 119271 Number of splices: AT/AC | 8643 Number of splices: Non-canonical | 22393 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214736 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 28001 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.99% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 398836 398836 398836 N_multimapping 214736 214736 214736 N_noFeature 192159 10975901 246972 N_ambiguous 111995 891 39308 UnstrandedReadsAssigned:10798529 PositiveStrandReadsAssigned:125891 NegativeStrandReadsAssigned:10816403 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170003 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170003-trimmed-pair1.fastq SRR7170003-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,701,331 reads, 10,751,957 reads pseudoaligned [quant] estimated average fragment length: 222.981 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7170003.ke.tsv 34699 SRR7170003.se.tsv 87100 total ==> SRR7170003.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.02 171 7.88087 Potri.005G024800.1.v4.1 1035 813.019 20 2.03619 Potri.004G059700.1.v4.1 961 739.032 1 0.112002 Potri.007G009000.2.v4.1 1416 1194.02 0 0 Potri.003G141000.2.v4.1 2943 2721.02 177.058 5.38609 Potri.016G087400.1.v4.1 270 86.4117 1338.27 1281.92 Potri.015G069301.1.v4.1 564 344.754 0 0 Potri.010G195200.1.v4.1 1773 1551.02 4 0.213468 Potri.012G127500.1.v4.1 977 755.026 4298 471.187 ==> SRR7170003.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 464 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170003 completed mapping pipeline successfully