Starting /dee2/code/volunteer_pipeline.sh SRR7170004 current disk space = 3049679020032 free memory = 1438251860 SRR7170004 SRAfilesize bc51d267da05b48778a9d061b9f4c1b7 SRR7170004.sra SRR7170004.sra file validated SRR7170004 is paired end SRR7170004 is conventional basespace SRR7170004 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170004_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8845 34.0 33.0 34.0 33.0 34.0 2 33.36225 34.0 33.0 34.0 33.0 34.0 3 33.3505 34.0 34.0 34.0 33.0 34.0 4 33.49825 34.0 34.0 34.0 33.0 34.0 5 33.48825 34.0 34.0 34.0 33.0 34.0 6 37.0825 38.0 37.0 38.0 36.0 38.0 7 37.35625 38.0 38.0 38.0 37.0 38.0 8 37.51925 38.0 38.0 38.0 37.0 38.0 9 37.52625 38.0 38.0 38.0 38.0 38.0 10-14 37.46785 38.0 38.0 38.0 37.2 38.0 15-19 37.46155 38.0 38.0 38.0 37.8 38.0 20-24 37.4082 38.0 38.0 38.0 37.4 38.0 25-29 37.3517 38.0 38.0 38.0 37.0 38.0 30-34 37.30735 38.0 38.0 38.0 37.0 38.0 35-39 37.263349999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.0456 38.0 38.0 38.0 36.0 38.0 45-49 36.95504999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.9668 38.0 38.0 38.0 35.8 38.0 55-59 36.9002 38.0 38.0 38.0 35.4 38.0 60-64 36.80585 38.0 38.0 38.0 35.0 38.0 65-69 36.7818 38.0 38.0 38.0 35.0 38.0 70-74 36.65 38.0 38.0 38.0 34.4 38.0 75-79 36.48795 38.0 38.0 38.0 34.0 38.0 80-84 36.44035 38.0 38.0 38.0 34.0 38.0 85-89 36.3182 38.0 37.6 38.0 34.0 38.0 90-94 36.164100000000005 38.0 37.4 38.0 33.4 38.0 95-99 36.149649999999994 38.0 37.4 38.0 33.4 38.0 100-104 35.8885 38.0 37.0 38.0 32.2 38.0 105-109 35.817150000000005 38.0 37.0 38.0 32.2 38.0 110-114 35.463699999999996 38.0 36.6 38.0 30.2 38.0 115-119 35.16459999999999 38.0 36.0 38.0 28.4 38.0 120-124 34.92535 38.0 35.8 38.0 27.8 38.0 125-129 34.6628 38.0 35.6 38.0 27.0 38.0 130-134 34.14345 38.0 34.6 38.0 23.6 38.0 135-139 33.716 38.0 34.6 38.0 21.8 38.0 140-144 33.517649999999996 38.0 34.4 38.0 21.0 38.0 145-149 32.89155 38.0 34.0 38.0 14.2 38.0 150-151 29.07625 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 2.0 14 1.0 15 0.0 16 5.0 17 4.0 18 5.0 19 12.0 20 9.0 21 14.0 22 17.0 23 12.0 24 19.0 25 22.0 26 16.0 27 29.0 28 39.0 29 42.0 30 55.0 31 73.0 32 58.0 33 92.0 34 135.0 35 311.0 36 753.0 37 2272.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.653944020356235 13.206106870229007 10.432569974554708 34.70737913486005 2 23.875 15.525 31.825 28.775000000000002 3 20.575 18.75 25.7 34.975 4 21.349999999999998 26.950000000000003 23.525 28.175 5 23.0 30.95 23.5 22.55 6 20.3 34.300000000000004 24.7 20.7 7 15.85 27.175 38.625 18.35 8 18.475 27.400000000000002 28.95 25.174999999999997 9 16.075 26.174999999999997 33.900000000000006 23.849999999999998 10-14 19.485 29.69 27.26 23.565 15-19 19.82 28.355000000000004 27.815 24.01 20-24 20.13 29.104999999999997 27.11 23.655 25-29 20.265 29.18 26.87 23.685000000000002 30-34 19.675 28.970000000000002 27.51 23.845 35-39 20.349999999999998 28.64 27.02 23.990000000000002 40-44 19.950000000000003 29.165000000000003 27.42 23.465 45-49 20.175 28.470000000000002 26.93 24.425 50-54 19.650000000000002 28.32 27.744999999999997 24.285 55-59 20.34 28.605000000000004 27.150000000000002 23.905 60-64 19.689999999999998 28.27 27.52 24.52 65-69 19.515 29.095 27.08 24.310000000000002 70-74 20.32 28.465 27.195000000000004 24.02 75-79 20.73 28.345 27.18 23.745 80-84 20.419999999999998 28.46 26.88 24.240000000000002 85-89 20.665 28.18 27.095000000000002 24.060000000000002 90-94 20.525 28.994999999999997 26.63 23.849999999999998 95-99 20.72 28.305000000000003 27.115000000000002 23.86 100-104 20.9 28.634999999999998 27.125 23.34 105-109 20.64 28.025 27.18 24.154999999999998 110-114 20.875 28.37 26.479999999999997 24.275 115-119 21.279999999999998 28.349999999999998 26.575 23.794999999999998 120-124 21.07 28.255000000000003 26.915 23.76 125-129 21.13 27.650000000000002 26.950000000000003 24.27 130-134 20.544999999999998 28.249999999999996 26.41 24.795 135-139 21.02 28.03 26.76 24.19 140-144 21.04 27.839999999999996 26.695 24.425 145-149 20.9 28.015 26.474999999999998 24.610000000000003 150-151 21.1375 28.499999999999996 26.4125 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 1.5 25 3.5 26 6.0 27 8.5 28 11.5 29 13.0 30 16.0 31 23.0 32 32.0 33 37.0 34 43.0 35 58.0 36 78.5 37 98.5 38 126.0 39 147.5 40 166.0 41 199.5 42 241.0 43 260.0 44 269.0 45 277.0 46 268.0 47 255.0 48 241.5 49 221.5 50 181.5 51 147.0 52 123.5 53 110.0 54 94.5 55 68.5 56 49.5 57 31.0 58 16.0 59 11.0 60 11.5 61 10.5 62 9.0 63 6.5 64 3.0 65 5.5 66 6.5 67 2.5 68 0.0 69 0.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.6046863189720333 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02519526329050139 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAACTAATCTCGTATGC 8 0.2 TruSeq Adapter, Index 23 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.9625000000000001 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.85 0.0 0.0 0.0 0.0 130-131 5.4 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.2625 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170004 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170004_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63375 33.0 33.0 34.0 31.0 34.0 2 32.10875 33.0 33.0 34.0 31.0 34.0 3 32.1395 34.0 33.0 34.0 31.0 34.0 4 31.72125 34.0 33.0 34.0 31.0 34.0 5 31.7775 34.0 33.0 34.0 31.0 34.0 6 36.07175 38.0 38.0 38.0 34.0 38.0 7 36.0915 38.0 38.0 38.0 34.0 38.0 8 36.1135 38.0 38.0 38.0 34.0 38.0 9 36.163 38.0 38.0 38.0 34.0 38.0 10-14 36.04695 38.0 38.0 38.0 34.8 38.0 15-19 35.8207 38.0 38.0 38.0 34.0 38.0 20-24 35.990500000000004 38.0 38.0 38.0 35.0 38.0 25-29 36.01375 38.0 38.0 38.0 34.8 38.0 30-34 36.0689 38.0 38.0 38.0 35.0 38.0 35-39 35.926700000000004 38.0 38.0 38.0 34.4 38.0 40-44 35.742000000000004 38.0 38.0 38.0 33.8 38.0 45-49 35.646049999999995 38.0 38.0 38.0 33.4 38.0 50-54 35.86344999999999 38.0 38.0 38.0 34.0 38.0 55-59 35.83115 38.0 38.0 38.0 33.8 38.0 60-64 35.7367 38.0 38.0 38.0 33.8 38.0 65-69 35.70915 38.0 38.0 38.0 33.2 38.0 70-74 35.5886 38.0 38.0 38.0 32.6 38.0 75-79 35.516949999999994 38.0 38.0 38.0 32.0 38.0 80-84 35.454449999999994 38.0 38.0 38.0 32.0 38.0 85-89 34.9681 38.0 38.0 38.0 28.8 38.0 90-94 34.6507 38.0 38.0 38.0 27.4 38.0 95-99 34.89365 38.0 37.8 38.0 27.6 38.0 100-104 35.08685 38.0 38.0 38.0 29.4 38.0 105-109 34.849450000000004 38.0 37.4 38.0 28.0 38.0 110-114 34.71079999999999 38.0 37.0 38.0 27.4 38.0 115-119 34.423249999999996 38.0 36.8 38.0 24.6 38.0 120-124 34.17015 38.0 36.0 38.0 22.6 38.0 125-129 33.7174 38.0 35.4 38.0 16.8 38.0 130-134 32.6837 38.0 35.0 38.0 11.2 38.0 135-139 31.643949999999997 38.0 33.8 38.0 2.0 38.0 140-144 30.9604 38.0 33.0 38.0 2.0 38.0 145-149 30.227050000000002 38.0 31.2 38.0 2.0 38.0 150-151 26.691125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 94.0 3 13.0 4 2.0 5 2.0 6 4.0 7 2.0 8 3.0 9 3.0 10 2.0 11 5.0 12 5.0 13 4.0 14 2.0 15 10.0 16 5.0 17 17.0 18 9.0 19 13.0 20 10.0 21 13.0 22 21.0 23 25.0 24 15.0 25 31.0 26 32.0 27 35.0 28 35.0 29 42.0 30 56.0 31 60.0 32 90.0 33 150.0 34 128.0 35 198.0 36 466.0 37 2398.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.25806451612903 22.374193548387098 16.206451612903226 25.161290322580644 2 27.8899545683998 26.779404341241797 28.041393235739527 17.289247854618882 3 21.486555048198884 29.604261796042618 28.61491628614916 20.294266869609334 4 23.7362073389787 33.872209391839874 23.27431357454452 19.117269694636903 5 25.0 35.35457348406988 21.32579650565262 18.319630010277493 6 21.488442976885956 36.16967233934468 23.241046482092965 19.100838201676403 7 20.74752097635393 22.629036359013476 37.2743452834986 19.349097381133994 8 23.650190114068444 25.779467680608363 26.108998732572875 24.461343472750315 9 22.80568239472349 25.139523084728566 29.198376458650433 22.856418061897514 10-14 23.91282207964151 27.737040431815867 26.046440574396577 22.303696914146045 15-19 23.763440860215056 27.557603686635947 27.29646697388633 21.382488479262673 20-24 23.874057468921947 28.00081516201345 27.06337884654575 21.06174852251885 25-29 23.966858130432573 28.216337111777563 26.73206933360443 21.084735424185432 30-34 23.48003052658357 28.277791910455353 27.19918595777156 21.04299160518952 35-39 23.873598369011212 27.59429153924567 27.237512742099902 21.294597349643222 40-44 24.494703986081973 27.764416926776853 26.62846031827253 21.11241876886865 45-49 24.12716289546432 27.654346268045458 27.42909798300399 20.78939285348623 50-54 24.175824175824175 27.96092796092796 26.856939356939357 21.006308506308507 55-59 24.156016090432303 27.679617088446456 27.03803655990631 21.126330261214928 60-64 23.721995926680243 27.637474541751526 28.192464358452142 20.44806517311609 65-69 24.45032573289902 27.534609120521175 27.453175895765476 20.561889250814332 70-74 24.70427661510464 27.428975836619145 27.23182691335558 20.634920634920633 75-79 23.63498483316481 28.276036400404447 27.451971688574318 20.63700707785642 80-84 24.54937801472455 27.204874333587203 27.692307692307693 20.553439959380555 85-89 24.922902960526315 27.63671875 27.066200657894733 20.374177631578945 90-94 24.383179020327937 27.145295608544973 27.595303367299433 20.876222003827653 95-99 24.303397687331262 27.599205338495235 27.130558810045336 20.966838164128166 100-104 24.048636548636548 27.431827431827433 28.04232804232804 20.47720797720798 105-109 24.315242846960594 27.380103859077487 27.991039609001124 20.3136136849608 110-114 24.660818116902988 26.98663674385392 27.756809140059165 20.595735999183923 115-119 24.682837714401707 27.651476707601745 27.326702527149095 20.33898305084746 120-124 24.597283239913146 27.076705549664194 27.95031055900621 20.37570065141645 125-129 24.681764735954197 27.544604059097182 27.457696436787487 20.315934768161135 130-134 24.792607371626588 27.53859078021632 27.17630998634884 20.492491861808254 135-139 24.948963146019125 27.83926077146234 27.404104437520143 19.807671644998386 140-144 25.2321729213056 27.464291533155922 27.02981589094661 20.273719654591865 145-149 26.291769396212562 27.356659497455805 26.643235587263288 19.708335519068353 150-151 25.08965163934426 28.53483606557377 26.664959016393443 19.710553278688526 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 38.0 1 19.0 2 2.0 3 3.5 4 4.0 5 5.0 6 4.5 7 2.0 8 1.0 9 3.0 10 2.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.5 21 1.5 22 1.0 23 0.5 24 1.0 25 1.5 26 2.5 27 4.0 28 5.0 29 4.5 30 9.0 31 12.5 32 11.0 33 17.0 34 26.5 35 31.5 36 54.0 37 83.5 38 107.0 39 137.5 40 169.0 41 212.0 42 254.0 43 258.0 44 267.5 45 285.5 46 290.5 47 297.5 48 279.0 49 236.5 50 195.0 51 160.0 52 124.5 53 103.0 54 80.5 55 50.5 56 43.0 57 36.0 58 20.0 59 13.0 60 11.5 61 10.5 62 7.0 63 3.0 64 2.0 65 2.5 66 1.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.125 2 0.95 3 1.4500000000000002 4 2.5749999999999997 5 2.7 6 1.575 7 1.675 8 1.375 9 1.4500000000000002 10-14 1.81 15-19 2.35 20-24 1.8599999999999999 25-29 1.635 30-34 1.725 35-39 1.9 40-44 2.2849999999999997 45-49 2.33 50-54 1.72 55-59 1.805 60-64 1.7999999999999998 65-69 1.76 70-74 1.09 75-79 1.0999999999999999 80-84 1.525 85-89 2.7199999999999998 90-94 3.335 95-99 1.8450000000000002 100-104 1.72 105-109 1.79 110-114 1.97 115-119 1.47 120-124 0.985 125-129 2.1950000000000003 130-134 4.77 135-139 6.93 140-144 7.9350000000000005 145-149 4.6850000000000005 150-151 2.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4653767820774 97.675 2 0.3818737270875764 0.75 3 0.02545824847250509 0.075 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.02545824847250509 0.15 7 0.0 0.0 8 0.02545824847250509 0.2 9 0.0 0.0 >10 0.02545824847250509 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 38 0.95 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.275 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGGCA 20 3.4389924E-4 109.83116 4 >>END_MODULE Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784144 spots for SRR7170004.sra Written 784144 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra Read 784130 spots for SRR7170004.sra Written 784130 spots for SRR7170004.sra SRR ids: ['SRR7170004.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zb1xzro0 SRR7170004.sra spots: 15682614 blocks: [[1, 784130], [784131, 1568260], [1568261, 2352390], [2352391, 3136520], [3136521, 3920650], [3920651, 4704780], [4704781, 5488910], [5488911, 6273040], [6273041, 7057170], [7057171, 7841300], [7841301, 8625430], [8625431, 9409560], [9409561, 10193690], [10193691, 10977820], [10977821, 11761950], [11761951, 12546080], [12546081, 13330210], [13330211, 14114340], [14114341, 14898470], [14898471, 15682614]] SRR7170004 file size 5292622 SRR7170004 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170004 SRR7170004_1.fastq SRR7170004_2.fastq Input file: SRR7170004_1.fastq Paired file: SRR7170004_2.fastq trimmed: SRR7170004-trimmed-pair1.fastq, SRR7170004-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:01:41 2025 >> started Wed Feb 12 09:01:58 2025 >> done (16.865s) 15682614 read pairs processed; of these: 43984 ( 0.28%) short read pairs filtered out after trimming by size control 81201 ( 0.52%) empty read pairs filtered out after trimming by size control 15557429 (99.20%) read pairs available; of these: 7487380 (48.13%) trimmed read pairs available after processing 8070049 (51.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 3 0.00% 21 11 0.00% 22 7 0.00% 23 7 0.00% 24 11 0.00% 25 9 0.00% 26 13 0.00% 27 10 0.00% 28 12 0.00% 29 14 0.00% 30 14 0.00% 31 10 0.00% 32 10 0.00% 33 12 0.00% 34 20 0.00% 35 15 0.00% 36 27 0.00% 37 18 0.00% 38 31 0.00% 39 33 0.00% 40 26 0.00% 41 25 0.00% 42 43 0.00% 43 46 0.00% 44 56 0.00% 45 52 0.00% 46 56 0.00% 47 65 0.00% 48 57 0.00% 49 91 0.00% 50 101 0.00% 51 79 0.00% 52 134 0.00% 53 127 0.00% 54 132 0.00% 55 174 0.00% 56 189 0.00% 57 209 0.00% 58 202 0.00% 59 231 0.00% 60 304 0.00% 61 288 0.00% 62 337 0.00% 63 395 0.00% 64 433 0.00% 65 474 0.00% 66 591 0.00% 67 681 0.00% 68 762 0.00% 69 1014 0.01% 70 1520 0.01% 71 1410 0.01% 72 1261 0.01% 73 1312 0.01% 74 1412 0.01% 75 1529 0.01% 76 1687 0.01% 77 1912 0.01% 78 2135 0.01% 79 2341 0.02% 80 2610 0.02% 81 2832 0.02% 82 3439 0.02% 83 3875 0.02% 84 6228 0.04% 85 7342 0.05% 86 7659 0.05% 87 8014 0.05% 88 8276 0.05% 89 8651 0.06% 90 8969 0.06% 91 9457 0.06% 92 10213 0.07% 93 11206 0.07% 94 11895 0.08% 95 12623 0.08% 96 13570 0.09% 97 14269 0.09% 98 15033 0.10% 99 15629 0.10% 100 16606 0.11% 101 17325 0.11% 102 18623 0.12% 103 19451 0.13% 104 21109 0.14% 105 22511 0.14% 106 23268 0.15% 107 24006 0.15% 108 25557 0.16% 109 25995 0.17% 110 26946 0.17% 111 27897 0.18% 112 29339 0.19% 113 31048 0.20% 114 32631 0.21% 115 34235 0.22% 116 35546 0.23% 117 36646 0.24% 118 37443 0.24% 119 38466 0.25% 120 39716 0.26% 121 40834 0.26% 122 42335 0.27% 123 43977 0.28% 124 46328 0.30% 125 48390 0.31% 126 50304 0.32% 127 52528 0.34% 128 53573 0.34% 129 55488 0.36% 130 57441 0.37% 131 59812 0.38% 132 62128 0.40% 133 64784 0.42% 134 68046 0.44% 135 72071 0.46% 136 76008 0.49% 137 80810 0.52% 138 87030 0.56% 139 92410 0.59% 140 98669 0.63% 141 105896 0.68% 142 113930 0.73% 143 123237 0.79% 144 136618 0.88% 145 155958 1.00% 146 187161 1.20% 147 246896 1.59% 148 338863 2.18% 149 647327 4.16% 150 3388182 21.78% 151 8070049 51.87% 15557429 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=38 prefix-density=0.27 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=93.61 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=15.3 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=44 prefix-density=0.27 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=149.14 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170004 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:02:42 Started mapping on | Feb 12 09:02:42 Finished on | Feb 12 09:04:09 Mapping speed, Million of reads per hour | 643.76 Number of input reads | 15557429 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14622076 Uniquely mapped reads % | 93.99% Average mapped length | 292.25 Number of splices: Total | 13153442 Number of splices: Annotated (sjdb) | 12918935 Number of splices: GT/AG | 12964270 Number of splices: GC/AG | 147607 Number of splices: AT/AC | 11274 Number of splices: Non-canonical | 30291 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263631 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 18485 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 703575 703575 703575 N_multimapping 263631 263631 263631 N_noFeature 293233 14417369 376869 N_ambiguous 181768 989 59978 UnstrandedReadsAssigned:14147075 PositiveStrandReadsAssigned:203718 NegativeStrandReadsAssigned:14185229 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170004 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170004-trimmed-pair1.fastq SRR7170004-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,557,429 reads, 14,112,340 reads pseudoaligned [quant] estimated average fragment length: 229.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7170004.ke.tsv 34699 SRR7170004.se.tsv 87100 total ==> SRR7170004.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.71 243 8.90474 Potri.005G024800.1.v4.1 1035 806.715 28 2.27634 Potri.004G059700.1.v4.1 961 732.73 12 1.07408 Potri.007G009000.2.v4.1 1416 1187.71 0 0 Potri.003G141000.2.v4.1 2943 2714.71 203.031 4.90498 Potri.016G087400.1.v4.1 270 84.6904 1449.56 1122.54 Potri.015G069301.1.v4.1 564 338.95 0 0 Potri.010G195200.1.v4.1 1773 1544.71 9 0.382114 Potri.012G127500.1.v4.1 977 748.725 5651 494.996 ==> SRR7170004.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170004 completed mapping pipeline successfully