Starting /dee2/code/volunteer_pipeline.sh SRR7170005 current disk space = 3049675452416 free memory = 1300434176 SRR7170005 SRAfilesize c4af8984bc1b1db9c5064e8e254a08a3 SRR7170005.sra SRR7170005.sra file validated SRR7170005 is paired end SRR7170005 is conventional basespace SRR7170005 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170005_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91525 34.0 33.0 34.0 33.0 34.0 2 33.399 34.0 34.0 34.0 33.0 34.0 3 33.3895 34.0 34.0 34.0 33.0 34.0 4 33.49275 34.0 34.0 34.0 33.0 34.0 5 33.50275 34.0 34.0 34.0 33.0 34.0 6 37.1755 38.0 38.0 38.0 36.0 38.0 7 37.4175 38.0 38.0 38.0 37.0 38.0 8 37.5145 38.0 38.0 38.0 38.0 38.0 9 37.57875 38.0 38.0 38.0 38.0 38.0 10-14 37.5572 38.0 38.0 38.0 38.0 38.0 15-19 37.530100000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5227 38.0 38.0 38.0 38.0 38.0 25-29 37.5062 38.0 38.0 38.0 38.0 38.0 30-34 37.465700000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.398399999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.230999999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.134949999999996 38.0 38.0 38.0 36.2 38.0 50-54 37.16155 38.0 38.0 38.0 36.4 38.0 55-59 37.050650000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.96785 38.0 38.0 38.0 36.0 38.0 65-69 36.925900000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.84985 38.0 38.0 38.0 35.8 38.0 75-79 36.726150000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.5779 38.0 38.0 38.0 34.4 38.0 85-89 36.51485 38.0 38.0 38.0 34.0 38.0 90-94 36.396100000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.164550000000006 38.0 38.0 38.0 33.6 38.0 100-104 36.036350000000006 38.0 37.2 38.0 33.2 38.0 105-109 35.90755 38.0 37.2 38.0 33.0 38.0 110-114 35.84770000000001 38.0 37.0 38.0 32.6 38.0 115-119 35.532 38.0 36.4 38.0 31.0 38.0 120-124 35.29639999999999 38.0 36.0 38.0 29.6 38.0 125-129 34.74355 38.0 35.6 38.0 27.0 38.0 130-134 34.3192 38.0 35.0 38.0 24.2 38.0 135-139 33.96795 38.0 34.4 38.0 23.0 38.0 140-144 33.660199999999996 38.0 34.8 38.0 19.4 38.0 145-149 32.660900000000005 38.0 33.0 38.0 15.4 38.0 150-151 28.339875 36.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 0.0 14 1.0 15 2.0 16 3.0 17 4.0 18 8.0 19 6.0 20 9.0 21 9.0 22 8.0 23 14.0 24 13.0 25 20.0 26 17.0 27 23.0 28 38.0 29 44.0 30 37.0 31 67.0 32 55.0 33 102.0 34 133.0 35 287.0 36 754.0 37 2341.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.328585961342824 12.054933875890132 8.748728382502543 34.86775178026449 2 23.549999999999997 14.725 32.175 29.549999999999997 3 20.549999999999997 19.15 26.474999999999998 33.825 4 21.95 27.150000000000002 24.65 26.25 5 22.925 31.3 24.775 21.0 6 19.775000000000002 33.875 25.424999999999997 20.925 7 14.475 27.425 39.25 18.85 8 17.45 25.900000000000002 31.574999999999996 25.074999999999996 9 17.9 25.4 33.375 23.325000000000003 10-14 20.064999999999998 29.735 26.685 23.515 15-19 19.814999999999998 28.415000000000003 27.845 23.925 20-24 20.335 28.38 27.125 24.16 25-29 19.99 28.76 27.6 23.65 30-34 20.13 28.84 27.560000000000002 23.47 35-39 20.575 28.28 27.025 24.12 40-44 19.585 28.444999999999997 27.555000000000003 24.415 45-49 19.919999999999998 28.38 27.755000000000003 23.945 50-54 20.055 28.035 27.91 24.0 55-59 20.724999999999998 28.065 26.765 24.445 60-64 20.419999999999998 27.650000000000002 27.755000000000003 24.175 65-69 20.419999999999998 27.62 27.815 24.145 70-74 20.49 29.01 26.66 23.84 75-79 20.805 27.875 27.43 23.89 80-84 20.455000000000002 27.625 27.565 24.355 85-89 20.32 28.095 27.605 23.98 90-94 20.8539820793913 28.297542173499522 26.905941833108077 23.942533914001103 95-99 20.67237837567012 27.63665514304324 27.656696227265897 24.034270254020743 100-104 20.815 28.095 27.284999999999997 23.805 105-109 20.580000000000002 27.705000000000002 27.689999999999998 24.025 110-114 20.635 28.325 27.500000000000004 23.54 115-119 20.849999999999998 27.47 27.22 24.46 120-124 20.810000000000002 27.07 27.265 24.855 125-129 21.17 27.66 27.400000000000002 23.77 130-134 21.044999999999998 27.939999999999998 26.939999999999998 24.075 135-139 21.329265853170636 27.730546109221844 26.710342068413684 24.22984596919384 140-144 21.404999999999998 27.325 26.939999999999998 24.33 145-149 21.88 28.02 26.229999999999997 23.87 150-151 21.5375 27.3375 26.8625 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 2.0 22 2.5 23 1.0 24 0.5 25 2.0 26 4.0 27 5.0 28 6.0 29 14.0 30 16.5 31 16.5 32 28.5 33 41.5 34 46.0 35 53.5 36 74.5 37 102.5 38 124.0 39 147.5 40 179.0 41 199.5 42 208.0 43 257.0 44 295.0 45 268.5 46 241.0 47 241.0 48 258.5 49 234.0 50 183.0 51 151.0 52 129.0 53 111.5 54 93.5 55 68.0 56 42.5 57 30.0 58 27.5 59 22.0 60 13.5 61 11.0 62 10.5 63 8.0 64 6.5 65 4.5 66 2.5 67 3.5 68 3.0 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.11499999999999999 95-99 0.20500000000000002 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 3.0375 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 3.9000000000000004 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.575 0.0 0.0 0.0 0.0 122-123 4.95 0.0 0.0 0.0 0.0 124-125 5.3875 0.0 0.0 0.0 0.0 126-127 5.9125 0.0 0.0 0.0 0.0 128-129 6.3875 0.0 0.0 0.0 0.0 130-131 6.8125 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 7.887499999999999 0.0 0.0 0.0 0.0 136-137 8.399999999999999 0.0 0.0 0.0 0.0 138-139 8.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACTG 10 0.006832588 144.9875 7 >>END_MODULE SRR7170005 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170005_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7945 33.0 33.0 34.0 32.0 34.0 2 32.203 34.0 33.0 34.0 31.0 34.0 3 32.064 34.0 33.0 34.0 32.0 34.0 4 31.70975 34.0 33.0 34.0 31.0 34.0 5 31.70675 34.0 33.0 34.0 31.0 34.0 6 36.0215 38.0 38.0 38.0 34.0 38.0 7 36.106 38.0 38.0 38.0 34.0 38.0 8 36.119 38.0 38.0 38.0 35.0 38.0 9 36.2005 38.0 38.0 38.0 35.0 38.0 10-14 36.06035000000001 38.0 38.0 38.0 35.6 38.0 15-19 35.83655 38.0 38.0 38.0 35.2 38.0 20-24 35.92505 38.0 38.0 38.0 35.2 38.0 25-29 35.9879 38.0 38.0 38.0 35.6 38.0 30-34 35.95635 38.0 38.0 38.0 36.0 38.0 35-39 35.8719 38.0 38.0 38.0 35.2 38.0 40-44 35.685900000000004 38.0 38.0 38.0 34.6 38.0 45-49 35.63585 38.0 38.0 38.0 34.0 38.0 50-54 35.837599999999995 38.0 38.0 38.0 34.8 38.0 55-59 35.80475 38.0 38.0 38.0 34.8 38.0 60-64 35.788850000000004 38.0 38.0 38.0 34.8 38.0 65-69 35.673750000000005 38.0 38.0 38.0 34.2 38.0 70-74 35.63635 38.0 38.0 38.0 33.8 38.0 75-79 35.5702 38.0 38.0 38.0 33.8 38.0 80-84 35.55794999999999 38.0 38.0 38.0 33.6 38.0 85-89 35.08515 38.0 38.0 38.0 31.4 38.0 90-94 34.69545 38.0 38.0 38.0 27.6 38.0 95-99 35.049350000000004 38.0 38.0 38.0 29.4 38.0 100-104 35.12355 38.0 38.0 38.0 30.6 38.0 105-109 34.91655 38.0 37.6 38.0 29.0 38.0 110-114 34.81985 38.0 37.8 38.0 28.2 38.0 115-119 34.445 38.0 37.0 38.0 24.6 38.0 120-124 34.2505 38.0 36.2 38.0 23.6 38.0 125-129 33.7019 38.0 35.6 38.0 18.2 38.0 130-134 32.761849999999995 38.0 34.4 38.0 8.8 38.0 135-139 31.327199999999998 38.0 32.8 38.0 2.0 38.0 140-144 30.4267 38.0 31.0 38.0 2.0 38.0 145-149 29.765049999999995 38.0 29.8 38.0 2.0 38.0 150-151 24.886875 33.0 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 104.0 3 26.0 4 3.0 5 4.0 6 1.0 7 6.0 8 1.0 9 2.0 10 1.0 11 4.0 12 1.0 13 3.0 14 3.0 15 8.0 16 5.0 17 10.0 18 12.0 19 8.0 20 12.0 21 11.0 22 15.0 23 12.0 24 21.0 25 22.0 26 29.0 27 41.0 28 38.0 29 30.0 30 59.0 31 61.0 32 86.0 33 125.0 34 153.0 35 203.0 36 488.0 37 2392.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.98529791075574 22.311065256641733 12.483879288109364 24.219757544493163 2 26.981707317073173 27.03252032520325 28.988821138211385 16.996951219512198 3 20.630445925166583 28.60071758072783 31.804202972834446 18.964633521271143 4 24.158467115484207 33.3764888658726 22.3459347488348 20.119109269808387 5 24.591015320695924 34.84809140482991 22.539600103869127 18.021293170605038 6 21.710189452124936 37.45519713261648 23.04147465437788 17.793138760880698 7 22.010178117048344 21.653944020356235 36.0559796437659 20.279898218829516 8 22.171370455123316 25.298754131706076 27.409102466310703 25.120772946859905 9 22.137404580152673 25.190839694656486 28.676844783715012 23.994910941475826 10-14 23.877613776137764 28.705412054120544 25.835383353833542 21.581590815908157 15-19 23.53789869634668 28.036275570670377 27.031483485340342 21.3943422476426 20-24 23.347022587268995 28.064681724845997 27.29466119096509 21.293634496919918 25-29 24.344127895060463 27.96679647468744 26.696044271367082 20.993031358885016 30-34 23.430447271235124 28.067295855560115 27.58514567090685 20.917111202297907 35-39 23.475312130709554 27.888814673996816 27.4007090376612 21.23516415763243 40-44 23.254853366377528 28.201156546881457 27.01363073110285 21.530359355638165 45-49 23.98409665926576 28.32137140496721 27.071823204419886 20.622708731347135 50-54 24.007377427122293 27.506532096931195 27.14278395409601 21.343306521850504 55-59 24.117405582922824 27.919745484400654 27.00636288998358 20.95648604269294 60-64 23.733949666153055 27.416538263995893 27.914740626605035 20.93477144324602 65-69 23.5523613963039 28.059548254620125 27.120123203285424 21.267967145790553 70-74 23.741337138198123 28.52629433346922 27.0485120260905 20.68385650224215 75-79 24.250445405955716 27.319928735047082 27.050139984728936 21.379485874268262 80-84 24.037822642473806 27.74341937132635 27.87630973677485 20.342448249424994 85-89 24.130953616270624 27.87693265539068 27.368475666701254 20.62363806163744 90-94 23.7918410041841 27.4163179916318 27.703974895397486 21.08786610878661 95-99 24.118100128369704 27.856225930680363 27.58408215661104 20.441591784338897 100-104 24.623397845069704 27.763876831946078 26.742582852474083 20.870142470510135 105-109 24.14695469239058 28.087639181076508 27.394940735799683 20.370465390733234 110-114 24.538394280717995 28.071799619400302 26.75513038111402 20.63467571876768 115-119 24.76659484969734 28.408741151123422 26.387606443008103 20.43705755617113 120-124 24.923795976427556 27.33692338955497 26.823816297500507 20.91546433651697 125-129 25.005156765676567 27.851691419141915 26.784240924092412 20.358910891089106 130-134 24.895607590253185 28.458163750726783 26.676885670489987 19.96934298853005 135-139 25.140449438202246 27.852203975799483 26.84745030250648 20.159896283491786 140-144 25.372970601140853 27.906976744186046 26.771610355419046 19.94844229925406 145-149 26.04855344581372 28.48151478288465 25.789390172951816 19.68054159834982 150-151 25.24535123966942 27.16942148760331 27.298553719008268 20.28667355371901 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 65.0 1 32.5 2 0.5 3 1.0 4 1.5 5 3.5 6 5.0 7 5.0 8 5.5 9 3.0 10 1.5 11 2.5 12 1.5 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.5 21 2.0 22 2.5 23 1.0 24 0.5 25 2.0 26 3.5 27 3.5 28 5.5 29 4.5 30 6.0 31 12.5 32 12.5 33 19.0 34 31.0 35 47.5 36 68.5 37 89.0 38 112.5 39 142.0 40 182.5 41 227.0 42 260.0 43 268.0 44 271.0 45 288.0 46 278.5 47 252.0 48 236.0 49 206.5 50 173.5 51 149.0 52 128.0 53 105.0 54 79.0 55 53.5 56 39.0 57 32.0 58 27.0 59 18.5 60 10.5 61 9.5 62 9.0 63 10.0 64 7.5 65 3.5 66 1.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.075 2 1.6 3 2.45 4 3.45 5 3.7249999999999996 6 2.35 7 1.7500000000000002 8 1.675 9 1.7500000000000002 10-14 2.44 15-19 2.965 20-24 2.6 25-29 2.42 30-34 2.52 35-39 2.685 40-44 3.16 45-49 3.1649999999999996 50-54 2.405 55-59 2.56 60-64 2.65 65-69 2.6 70-74 1.8800000000000001 75-79 1.775 80-84 2.175 85-89 3.63 90-94 4.3999999999999995 95-99 2.625 100-104 2.085 105-109 2.555 110-114 2.785 115-119 2.53 120-124 1.58 125-129 3.04 130-134 5.405 135-139 7.4399999999999995 140-144 8.84 145-149 5.465 150-151 3.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.61734693877551 97.625 2 0.28061224489795916 0.5499999999999999 3 0.07653061224489796 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025510204081632654 1.6 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 64 1.6 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.05 0.0 0.0 0.0 0.0 120-121 4.3875 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.2125 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.15 0.0 0.0 0.0 0.0 130-131 6.525 0.0 0.0 0.0 0.0 132-133 7.1 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 7.975 0.0 0.0 0.0 0.0 138-139 8.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 45 6.9782935E-4 19.151054 60-64 >>END_MODULE Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761239 spots for SRR7170005.sra Written 761239 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra Read 761222 spots for SRR7170005.sra Written 761222 spots for SRR7170005.sra SRR ids: ['SRR7170005.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m4apqcyi SRR7170005.sra spots: 15224457 blocks: [[1, 761222], [761223, 1522444], [1522445, 2283666], [2283667, 3044888], [3044889, 3806110], [3806111, 4567332], [4567333, 5328554], [5328555, 6089776], [6089777, 6850998], [6850999, 7612220], [7612221, 8373442], [8373443, 9134664], [9134665, 9895886], [9895887, 10657108], [10657109, 11418330], [11418331, 12179552], [12179553, 12940774], [12940775, 13701996], [13701997, 14463218], [14463219, 15224457]] SRR7170005 file size 5137368 SRR7170005 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170005 SRR7170005_1.fastq SRR7170005_2.fastq Input file: SRR7170005_1.fastq Paired file: SRR7170005_2.fastq trimmed: SRR7170005-trimmed-pair1.fastq, SRR7170005-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:48:20 2025 >> started Wed Feb 12 08:48:37 2025 >> done (17.173s) 15224457 read pairs processed; of these: 29188 ( 0.19%) short read pairs filtered out after trimming by size control 49514 ( 0.33%) empty read pairs filtered out after trimming by size control 15145755 (99.48%) read pairs available; of these: 7897640 (52.14%) trimmed read pairs available after processing 7248115 (47.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 10 0.00% 23 7 0.00% 24 9 0.00% 25 5 0.00% 26 7 0.00% 27 7 0.00% 28 10 0.00% 29 9 0.00% 30 7 0.00% 31 17 0.00% 32 9 0.00% 33 15 0.00% 34 7 0.00% 35 14 0.00% 36 13 0.00% 37 18 0.00% 38 14 0.00% 39 26 0.00% 40 25 0.00% 41 31 0.00% 42 45 0.00% 43 45 0.00% 44 52 0.00% 45 52 0.00% 46 67 0.00% 47 57 0.00% 48 68 0.00% 49 82 0.00% 50 103 0.00% 51 141 0.00% 52 133 0.00% 53 158 0.00% 54 142 0.00% 55 193 0.00% 56 209 0.00% 57 214 0.00% 58 239 0.00% 59 320 0.00% 60 323 0.00% 61 368 0.00% 62 462 0.00% 63 509 0.00% 64 561 0.00% 65 672 0.00% 66 742 0.00% 67 876 0.01% 68 991 0.01% 69 1321 0.01% 70 1593 0.01% 71 1550 0.01% 72 1673 0.01% 73 1952 0.01% 74 2070 0.01% 75 2349 0.02% 76 2492 0.02% 77 2740 0.02% 78 3094 0.02% 79 3444 0.02% 80 3820 0.03% 81 4265 0.03% 82 4955 0.03% 83 5616 0.04% 84 7121 0.05% 85 8310 0.05% 86 8746 0.06% 87 9344 0.06% 88 9818 0.06% 89 10244 0.07% 90 10734 0.07% 91 11720 0.08% 92 12681 0.08% 93 13727 0.09% 94 14696 0.10% 95 15538 0.10% 96 16452 0.11% 97 17084 0.11% 98 17391 0.11% 99 18168 0.12% 100 18997 0.13% 101 19975 0.13% 102 21257 0.14% 103 22222 0.15% 104 23825 0.16% 105 24937 0.16% 106 26049 0.17% 107 26703 0.18% 108 27560 0.18% 109 28542 0.19% 110 29041 0.19% 111 30072 0.20% 112 31492 0.21% 113 33002 0.22% 114 34894 0.23% 115 36244 0.24% 116 37645 0.25% 117 38780 0.26% 118 39659 0.26% 119 40069 0.26% 120 40992 0.27% 121 42054 0.28% 122 43600 0.29% 123 45246 0.30% 124 47792 0.32% 125 49327 0.33% 126 51753 0.34% 127 53281 0.35% 128 54937 0.36% 129 56649 0.37% 130 58699 0.39% 131 60452 0.40% 132 62932 0.42% 133 65897 0.44% 134 69504 0.46% 135 73335 0.48% 136 77503 0.51% 137 81493 0.54% 138 88535 0.58% 139 94716 0.63% 140 100995 0.67% 141 107538 0.71% 142 115916 0.77% 143 126398 0.83% 144 139952 0.92% 145 160731 1.06% 146 194755 1.29% 147 253065 1.67% 148 359756 2.38% 149 697248 4.60% 150 3578818 23.63% 151 7248115 47.86% 15145755 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=42 prefix-density=0.15 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=578.18 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=25.4 sequence=AAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCCTGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=43 prefix-density=0.21 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=275.47 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=27.7 sequence=AAGAAGAAGAAA SRR7170005 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:49:19 Started mapping on | Feb 12 08:49:19 Finished on | Feb 12 08:50:56 Mapping speed, Million of reads per hour | 562.11 Number of input reads | 15145755 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14141470 Uniquely mapped reads % | 93.37% Average mapped length | 291.16 Number of splices: Total | 13180982 Number of splices: Annotated (sjdb) | 12947432 Number of splices: GT/AG | 12974161 Number of splices: GC/AG | 162036 Number of splices: AT/AC | 11247 Number of splices: Non-canonical | 33538 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273308 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 29356 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.59% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753555 753555 753555 N_multimapping 273308 273308 273308 N_noFeature 316524 13973476 404768 N_ambiguous 139532 2384 57671 UnstrandedReadsAssigned:13685414 PositiveStrandReadsAssigned:165610 NegativeStrandReadsAssigned:13679031 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170005 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170005-trimmed-pair1.fastq SRR7170005-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,145,755 reads, 13,640,905 reads pseudoaligned [quant] estimated average fragment length: 222.559 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7170005.ke.tsv 34699 SRR7170005.se.tsv 87100 total ==> SRR7170005.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.44 330 13.5418 Potri.005G024800.1.v4.1 1035 813.441 79 7.15941 Potri.004G059700.1.v4.1 961 739.458 1 0.0996926 Potri.007G009000.2.v4.1 1416 1194.44 0 0 Potri.003G141000.2.v4.1 2943 2721.44 272.039 7.369 Potri.016G087400.1.v4.1 270 87.885 1403.53 1177.29 Potri.015G069301.1.v4.1 564 346.037 0 0 Potri.010G195200.1.v4.1 1773 1551.44 143 6.79481 Potri.012G127500.1.v4.1 977 755.446 7984 779.1 ==> SRR7170005.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1442 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 411 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170005 completed mapping pipeline successfully