Starting /dee2/code/volunteer_pipeline.sh SRR7170007 current disk space = 3049610678272 free memory = 1436073976 SRR7170007 SRAfilesize 476d2de2fa791b1898ccd217e4962105 SRR7170007.sra SRR7170007.sra file validated SRR7170007 is paired end SRR7170007 is conventional basespace SRR7170007 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170007_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6365 34.0 33.0 34.0 32.0 34.0 2 33.3615 34.0 33.0 34.0 33.0 34.0 3 33.3675 34.0 34.0 34.0 33.0 34.0 4 33.4255 34.0 34.0 34.0 33.0 34.0 5 33.4295 34.0 34.0 34.0 33.0 34.0 6 37.0885 38.0 37.0 38.0 36.0 38.0 7 37.417 38.0 38.0 38.0 37.0 38.0 8 37.492 38.0 38.0 38.0 37.0 38.0 9 37.4875 38.0 38.0 38.0 37.0 38.0 10-14 37.50485 38.0 38.0 38.0 37.6 38.0 15-19 37.486549999999994 38.0 38.0 38.0 37.6 38.0 20-24 37.422900000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.3668 38.0 38.0 38.0 37.0 38.0 30-34 37.364149999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.298049999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.08105 38.0 38.0 38.0 36.0 38.0 45-49 37.014599999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.957750000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.9133 38.0 38.0 38.0 35.4 38.0 60-64 36.89975 38.0 38.0 38.0 35.2 38.0 65-69 36.8508 38.0 38.0 38.0 35.0 38.0 70-74 36.803200000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.62205 38.0 38.0 38.0 34.0 38.0 80-84 36.543 38.0 38.0 38.0 34.0 38.0 85-89 36.3849 38.0 37.8 38.0 33.8 38.0 90-94 36.3395 38.0 37.8 38.0 33.8 38.0 95-99 36.159400000000005 38.0 37.4 38.0 33.4 38.0 100-104 35.977700000000006 38.0 37.0 38.0 32.6 38.0 105-109 35.95085 38.0 37.0 38.0 33.0 38.0 110-114 35.58540000000001 38.0 36.6 38.0 30.2 38.0 115-119 35.41345 38.0 36.0 38.0 29.8 38.0 120-124 35.057599999999994 38.0 36.0 38.0 28.0 38.0 125-129 34.82305 38.0 35.2 38.0 27.8 38.0 130-134 34.29685 38.0 34.6 38.0 25.4 38.0 135-139 33.87505 38.0 34.4 38.0 23.0 38.0 140-144 33.67895 38.0 34.2 38.0 21.4 38.0 145-149 32.91325 38.0 34.2 38.0 16.8 38.0 150-151 28.896625 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 6.0 19 9.0 20 9.0 21 11.0 22 17.0 23 9.0 24 17.0 25 15.0 26 16.0 27 26.0 28 26.0 29 39.0 30 60.0 31 59.0 32 75.0 33 131.0 34 181.0 35 334.0 36 718.0 37 2237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.86131761086901 12.355806203537554 10.561394514227121 36.22148167136632 2 22.900000000000002 15.024999999999999 34.475 27.6 3 19.35 19.950000000000003 27.575 33.125 4 22.8 28.525 23.200000000000003 25.474999999999998 5 22.95 31.55 24.474999999999998 21.025 6 20.150000000000002 35.075 23.875 20.9 7 15.25 26.900000000000002 39.45 18.4 8 18.175 26.200000000000003 30.599999999999998 25.025 9 17.05 24.775 32.025 26.150000000000002 10-14 20.315 29.805 26.58 23.3 15-19 20.335 28.715000000000003 27.01 23.94 20-24 20.055 28.305000000000003 27.279999999999998 24.36 25-29 20.015 28.54 27.305 24.14 30-34 20.125 28.64 27.145000000000003 24.09 35-39 20.23 28.645 27.35 23.775 40-44 20.605 28.694999999999997 27.32 23.380000000000003 45-49 20.615 28.634999999999998 26.985 23.765 50-54 20.810000000000002 28.76 27.08 23.35 55-59 19.919999999999998 28.694999999999997 27.395000000000003 23.990000000000002 60-64 19.97 28.7 27.105 24.224999999999998 65-69 20.16 28.845 27.47 23.525 70-74 20.73 27.900000000000002 27.22 24.15 75-79 20.175 28.505000000000003 27.47 23.849999999999998 80-84 20.66 27.915 27.26 24.165 85-89 20.21 27.845 27.295 24.65 90-94 20.544999999999998 28.349999999999998 27.18 23.925 95-99 20.18 28.525 27.52 23.775 100-104 20.49 28.155 27.255000000000003 24.099999999999998 105-109 20.919999999999998 28.71 27.025 23.345 110-114 20.73 28.125 26.775 24.37 115-119 21.005 28.265 27.145000000000003 23.585 120-124 21.07 28.005000000000003 26.735 24.19 125-129 20.535 27.97 26.979999999999997 24.515 130-134 20.745 27.889999999999997 27.265 24.099999999999998 135-139 20.73 28.255000000000003 27.034999999999997 23.98 140-144 20.405 28.235 27.36 24.0 145-149 21.16 28.599999999999998 26.445 23.794999999999998 150-151 20.4625 28.025 26.4625 25.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.5 25 1.0 26 3.0 27 6.0 28 8.5 29 14.5 30 18.5 31 19.0 32 27.0 33 41.0 34 53.5 35 60.0 36 69.5 37 91.0 38 126.5 39 158.5 40 174.0 41 192.0 42 231.5 43 258.5 44 265.0 45 273.0 46 282.0 47 267.0 48 237.0 49 213.0 50 195.0 51 159.5 52 129.5 53 112.5 54 82.0 55 56.0 56 37.0 57 36.5 58 28.0 59 16.5 60 11.5 61 8.5 62 8.5 63 6.5 64 4.0 65 2.5 66 2.0 67 1.5 68 2.0 69 2.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.1375 0.0 0.0 0.0 0.0 118-119 3.475 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.55 0.0 0.0 0.0 0.0 126-127 4.9875 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.725 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 6.6125 0.0 0.0 0.0 0.0 138-139 7.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAGT 10 0.006832588 144.9875 7 ATCAACC 10 0.006832588 144.9875 8 >>END_MODULE SRR7170007 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170007_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.99975 33.0 33.0 34.0 27.0 34.0 2 31.76825 33.0 33.0 34.0 28.0 34.0 3 31.78875 33.0 33.0 34.0 28.0 34.0 4 31.31525 33.0 33.0 34.0 30.0 34.0 5 31.31075 33.0 33.0 34.0 30.0 34.0 6 35.7775 38.0 38.0 38.0 31.0 38.0 7 35.82725 38.0 38.0 38.0 33.0 38.0 8 35.779 38.0 38.0 38.0 34.0 38.0 9 35.89675 38.0 38.0 38.0 34.0 38.0 10-14 35.70335 38.0 38.0 38.0 33.8 38.0 15-19 35.34245 38.0 38.0 38.0 31.4 38.0 20-24 35.628600000000006 38.0 38.0 38.0 33.4 38.0 25-29 35.72950000000001 38.0 38.0 38.0 34.0 38.0 30-34 35.8053 38.0 38.0 38.0 34.0 38.0 35-39 35.5481 38.0 38.0 38.0 33.0 38.0 40-44 35.3255 38.0 38.0 38.0 32.2 38.0 45-49 35.2007 38.0 38.0 38.0 29.8 38.0 50-54 35.517100000000006 38.0 38.0 38.0 32.6 38.0 55-59 35.484449999999995 38.0 38.0 38.0 33.0 38.0 60-64 35.440000000000005 38.0 38.0 38.0 32.4 38.0 65-69 35.41 38.0 38.0 38.0 32.0 38.0 70-74 35.3442 38.0 38.0 38.0 31.6 38.0 75-79 35.238800000000005 38.0 38.0 38.0 30.0 38.0 80-84 35.226749999999996 38.0 38.0 38.0 30.6 38.0 85-89 34.4485 38.0 37.4 38.0 24.2 38.0 90-94 33.99634999999999 38.0 37.0 38.0 18.8 38.0 95-99 34.5157 38.0 37.0 38.0 26.0 38.0 100-104 34.675650000000005 38.0 37.0 38.0 26.8 38.0 105-109 34.5064 38.0 37.0 38.0 25.8 38.0 110-114 34.26715 38.0 37.0 38.0 23.6 38.0 115-119 34.0989 38.0 36.2 38.0 21.4 38.0 120-124 33.8767 38.0 36.0 38.0 20.2 38.0 125-129 33.2117 38.0 35.2 38.0 15.6 38.0 130-134 31.6847 38.0 34.0 38.0 4.2 38.0 135-139 30.489800000000002 38.0 31.8 38.0 2.0 38.0 140-144 29.593349999999997 38.0 28.6 38.0 2.0 38.0 145-149 28.99045 38.0 26.6 38.0 2.0 38.0 150-151 25.4565 34.5 12.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 120.0 3 11.0 4 2.0 5 5.0 6 1.0 7 1.0 8 2.0 9 6.0 10 3.0 11 4.0 12 2.0 13 5.0 14 10.0 15 9.0 16 7.0 17 9.0 18 9.0 19 14.0 20 14.0 21 13.0 22 20.0 23 15.0 24 27.0 25 37.0 26 37.0 27 33.0 28 45.0 29 54.0 30 83.0 31 89.0 32 111.0 33 157.0 34 155.0 35 239.0 36 462.0 37 2189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.26315789473684 22.026315789473685 15.552631578947368 26.157894736842106 2 27.92586951002793 26.85960903782686 29.119065752729117 16.095455699416096 3 20.240224891387683 29.389215435727063 30.999233324814718 19.371326348070532 4 23.50950273366311 33.975527206456654 23.769851601145536 18.745118458734705 5 25.35872684581268 34.72475867466736 21.680146099660842 18.23636837985912 6 20.746994116142236 36.505500127909954 23.919160910718855 18.82834484522896 7 20.38934426229508 20.876024590163937 38.83196721311475 19.90266393442623 8 21.468638449770523 25.26772055073942 26.54258031616522 26.721060683324833 9 21.861416517514705 25.15980567629762 29.941191511122472 23.0375862950652 10-14 23.20905116996657 28.2334790434559 26.54667009514014 22.010799691437388 15-19 23.476590885497767 27.07360116266999 27.98193709124883 21.46787086058341 20-24 22.800061788785335 28.103599196745794 27.629885175840585 21.46645383862829 25-29 23.265222512418703 27.64889639985661 27.546474112766937 21.53940697495775 30-34 23.035494460402134 28.24169060320066 27.636438243742305 21.086376692654905 35-39 23.091583393427424 28.201298032347786 28.077675903986815 20.62944267023797 40-44 23.794462304262158 27.361816861972414 27.652182930623248 21.191537903142176 45-49 23.65758754863813 27.455252918287936 28.010376134889754 20.876783398184177 50-54 23.113231747986248 27.941101020984043 27.833358986198757 21.112308244830945 55-59 23.292181069958847 27.541152263374485 28.307613168724277 20.859053497942387 60-64 23.4686005246104 27.639767525587615 28.478115517152702 20.41351643264928 65-69 23.561151079136692 27.49229188078109 28.23741007194245 20.709146968139773 70-74 23.975597356380273 27.75800711743772 27.961362480935435 20.305033045246567 75-79 24.89320585842148 27.257933279088693 27.313873067534583 20.53498779495525 80-84 24.27701284741772 27.43512309975943 27.51701898960946 20.77084506321339 85-89 23.75450886089184 27.7379894401171 27.544565842438185 20.96293585655288 90-94 24.02326196140629 27.639439598202486 27.776896642876025 20.560401797515198 95-99 24.1574479032673 27.476202727038846 27.414458451247746 20.951890918446104 100-104 24.067709669145934 27.930238522698126 27.294177994357526 20.70787381379841 105-109 24.311408016443988 27.697841726618705 27.538540596094553 20.452209660842755 110-114 24.48115642746515 27.98141455859577 26.819824470831183 20.7176045431079 115-119 24.708469721767596 27.674918166939445 27.04582651391162 20.57078559738134 120-124 24.79435361023662 28.11008428963136 26.87112826241495 20.224433837717072 125-129 25.196646657006834 27.602980749327262 27.328710411922998 19.87166218174291 130-134 25.20922196425679 27.03957669672264 27.692889152853517 20.058312186167054 135-139 25.28199144301828 26.693337778518643 27.2767683502806 20.747902428182474 140-144 25.096023497514686 27.63217352010845 27.377993673746047 19.893809308630818 145-149 25.08071459319845 27.469866551872578 26.99095996556177 20.458458889367197 150-151 25.172100272762698 28.18547863358878 26.40602675672165 20.236394336926875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 61.0 1 30.5 2 1.0 3 3.0 4 4.0 5 5.0 6 6.0 7 5.0 8 4.0 9 2.5 10 1.5 11 1.0 12 0.5 13 1.0 14 1.0 15 3.0 16 2.5 17 0.5 18 1.0 19 0.5 20 1.0 21 1.0 22 1.5 23 3.0 24 2.0 25 2.5 26 3.0 27 2.5 28 6.0 29 7.0 30 8.0 31 12.5 32 19.5 33 30.5 34 48.0 35 57.0 36 66.5 37 97.0 38 140.0 39 163.5 40 187.5 41 227.5 42 245.5 43 262.5 44 267.0 45 262.0 46 261.5 47 262.5 48 247.0 49 210.0 50 182.5 51 154.5 52 114.0 53 84.0 54 69.5 55 51.5 56 35.5 57 25.0 58 17.5 59 12.5 60 11.5 61 9.5 62 4.0 63 3.0 64 3.5 65 2.0 66 2.5 67 3.0 68 2.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.0 2 1.525 3 2.175 4 3.975 5 4.175 6 2.275 7 2.4 8 1.95 9 2.225 10-14 2.775 15-19 3.6700000000000004 20-24 2.895 25-29 2.365 30-34 2.52 35-39 2.93 40-44 3.5700000000000003 45-49 3.6249999999999996 50-54 2.545 55-59 2.8000000000000003 60-64 2.785 65-69 2.7 70-74 1.6500000000000001 75-79 1.68 80-84 2.315 85-89 4.3549999999999995 90-94 5.425 95-99 2.825 100-104 2.5250000000000004 105-109 2.7 110-114 3.15 115-119 2.2399999999999998 120-124 1.53 125-129 3.38 130-134 7.3950000000000005 135-139 10.015 140-144 11.48 145-149 7.08 150-151 3.7624999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64240102171136 97.52499999999999 2 0.22988505747126436 0.44999999999999996 3 0.05108556832694764 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.05108556832694764 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554278416347382 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 61 1.525 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 4.0625 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.1875 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.3625 0.0 0.0 0.0 0.0 138-139 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGAT 10 0.0065174014 147.19737 1 >>END_MODULE Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009731 spots for SRR7170007.sra Written 1009731 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra Read 1009719 spots for SRR7170007.sra Written 1009719 spots for SRR7170007.sra SRR ids: ['SRR7170007.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pbxbc6gk SRR7170007.sra spots: 20194392 blocks: [[1, 1009719], [1009720, 2019438], [2019439, 3029157], [3029158, 4038876], [4038877, 5048595], [5048596, 6058314], [6058315, 7068033], [7068034, 8077752], [8077753, 9087471], [9087472, 10097190], [10097191, 11106909], [11106910, 12116628], [12116629, 13126347], [13126348, 14136066], [14136067, 15145785], [15145786, 16155504], [16155505, 17165223], [17165224, 18174942], [18174943, 19184661], [19184662, 20194392]] SRR7170007 file size 6821516 SRR7170007 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170007 SRR7170007_1.fastq SRR7170007_2.fastq Input file: SRR7170007_1.fastq Paired file: SRR7170007_2.fastq trimmed: SRR7170007-trimmed-pair1.fastq, SRR7170007-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:29:13 2025 >> started Wed Feb 12 09:29:34 2025 >> done (20.980s) 20194392 read pairs processed; of these: 52026 ( 0.26%) short read pairs filtered out after trimming by size control 81174 ( 0.40%) empty read pairs filtered out after trimming by size control 20061192 (99.34%) read pairs available; of these: 9759566 (48.65%) trimmed read pairs available after processing 10301626 (51.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 6 0.00% 21 5 0.00% 22 6 0.00% 23 7 0.00% 24 10 0.00% 25 8 0.00% 26 10 0.00% 27 9 0.00% 28 9 0.00% 29 9 0.00% 30 14 0.00% 31 11 0.00% 32 16 0.00% 33 12 0.00% 34 15 0.00% 35 27 0.00% 36 22 0.00% 37 23 0.00% 38 32 0.00% 39 26 0.00% 40 39 0.00% 41 47 0.00% 42 52 0.00% 43 56 0.00% 44 56 0.00% 45 80 0.00% 46 71 0.00% 47 81 0.00% 48 92 0.00% 49 122 0.00% 50 141 0.00% 51 151 0.00% 52 171 0.00% 53 158 0.00% 54 209 0.00% 55 232 0.00% 56 232 0.00% 57 273 0.00% 58 298 0.00% 59 366 0.00% 60 414 0.00% 61 484 0.00% 62 576 0.00% 63 607 0.00% 64 652 0.00% 65 737 0.00% 66 881 0.00% 67 946 0.00% 68 1097 0.01% 69 1217 0.01% 70 1624 0.01% 71 1761 0.01% 72 1887 0.01% 73 2191 0.01% 74 2238 0.01% 75 2558 0.01% 76 2747 0.01% 77 3004 0.01% 78 3416 0.02% 79 3860 0.02% 80 4249 0.02% 81 4844 0.02% 82 5460 0.03% 83 6368 0.03% 84 9206 0.05% 85 10352 0.05% 86 10804 0.05% 87 11343 0.06% 88 11866 0.06% 89 12324 0.06% 90 12668 0.06% 91 13702 0.07% 92 14874 0.07% 93 16121 0.08% 94 16855 0.08% 95 18149 0.09% 96 19223 0.10% 97 19900 0.10% 98 20351 0.10% 99 21610 0.11% 100 22683 0.11% 101 23792 0.12% 102 25292 0.13% 103 26582 0.13% 104 28036 0.14% 105 29678 0.15% 106 30415 0.15% 107 31919 0.16% 108 32786 0.16% 109 33852 0.17% 110 34536 0.17% 111 35757 0.18% 112 37569 0.19% 113 39391 0.20% 114 41425 0.21% 115 43540 0.22% 116 45125 0.22% 117 46318 0.23% 118 47223 0.24% 119 47943 0.24% 120 49312 0.25% 121 50769 0.25% 122 52798 0.26% 123 55081 0.27% 124 58159 0.29% 125 61066 0.30% 126 63806 0.32% 127 65370 0.33% 128 67610 0.34% 129 69343 0.35% 130 72441 0.36% 131 74519 0.37% 132 78093 0.39% 133 82357 0.41% 134 85794 0.43% 135 91697 0.46% 136 97171 0.48% 137 103289 0.51% 138 111505 0.56% 139 119304 0.59% 140 126964 0.63% 141 137558 0.69% 142 147031 0.73% 143 161170 0.80% 144 180280 0.90% 145 207248 1.03% 146 249158 1.24% 147 330799 1.65% 148 455311 2.27% 149 867830 4.33% 150 4386495 21.87% 151 10301626 51.35% 20061192 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=372.11 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=18.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.55 fanout-score-rank=23 prefix-density=0.35 prefix-fanout=3.4 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=242.22 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=25.9 sequence=GAAGAAGAAGAAA SRR7170007 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:30:19 Started mapping on | Feb 12 09:30:19 Finished on | Feb 12 09:32:16 Mapping speed, Million of reads per hour | 617.27 Number of input reads | 20061192 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18882754 Uniquely mapped reads % | 94.13% Average mapped length | 292.03 Number of splices: Total | 18138868 Number of splices: Annotated (sjdb) | 17839516 Number of splices: GT/AG | 17877344 Number of splices: GC/AG | 210755 Number of splices: AT/AC | 15389 Number of splices: Non-canonical | 35380 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348100 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 25831 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 868320 868320 868320 N_multimapping 348100 348100 348100 N_noFeature 375911 18662145 484378 N_ambiguous 183807 1234 70761 UnstrandedReadsAssigned:18323036 PositiveStrandReadsAssigned:219375 NegativeStrandReadsAssigned:18327615 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170007 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170007-trimmed-pair1.fastq SRR7170007-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,061,192 reads, 18,232,150 reads pseudoaligned [quant] estimated average fragment length: 238.686 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR7170007.ke.tsv 34699 SRR7170007.se.tsv 87100 total ==> SRR7170007.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.31 338.503 10.6123 Potri.005G024800.1.v4.1 1035 797.314 45 3.15013 Potri.004G059700.1.v4.1 961 723.361 7 0.540117 Potri.007G009000.2.v4.1 1416 1178.31 0 0 Potri.003G141000.2.v4.1 2943 2705.31 292.025 6.02487 Potri.016G087400.1.v4.1 270 86.0961 1635.7 1060.39 Potri.015G069301.1.v4.1 564 332.563 0 0 Potri.010G195200.1.v4.1 1773 1535.31 32 1.16332 Potri.012G127500.1.v4.1 977 739.341 8793 663.801 ==> SRR7170007.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 877 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170007 completed mapping pipeline successfully