Starting /dee2/code/volunteer_pipeline.sh SRR7170008 current disk space = 3050248863744 free memory = 1574170524 SRR7170008 SRAfilesize 635898c324bb61188190857ac234b84e SRR7170008.sra SRR7170008.sra file validated SRR7170008 is paired end SRR7170008 is conventional basespace SRR7170008 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170008_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81325 34.0 33.0 34.0 33.0 34.0 2 33.3555 34.0 33.0 34.0 33.0 34.0 3 33.31225 34.0 34.0 34.0 33.0 34.0 4 33.47825 34.0 34.0 34.0 33.0 34.0 5 33.42175 34.0 34.0 34.0 33.0 34.0 6 37.0885 38.0 37.0 38.0 36.0 38.0 7 37.3575 38.0 38.0 38.0 37.0 38.0 8 37.40275 38.0 38.0 38.0 37.0 38.0 9 37.504 38.0 38.0 38.0 37.0 38.0 10-14 37.487700000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.46315 38.0 38.0 38.0 37.8 38.0 20-24 37.3906 38.0 38.0 38.0 37.0 38.0 25-29 37.36825 38.0 38.0 38.0 37.0 38.0 30-34 37.372 38.0 38.0 38.0 37.0 38.0 35-39 37.28845 38.0 38.0 38.0 36.8 38.0 40-44 37.0493 38.0 38.0 38.0 36.2 38.0 45-49 36.994 38.0 38.0 38.0 36.0 38.0 50-54 36.975 38.0 38.0 38.0 36.0 38.0 55-59 36.89795 38.0 38.0 38.0 35.6 38.0 60-64 36.8393 38.0 38.0 38.0 35.0 38.0 65-69 36.832049999999995 38.0 38.0 38.0 35.2 38.0 70-74 36.69395 38.0 38.0 38.0 34.6 38.0 75-79 36.624199999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.476600000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.4091 38.0 37.8 38.0 34.0 38.0 90-94 36.326550000000005 38.0 37.6 38.0 34.0 38.0 95-99 36.2291 38.0 37.6 38.0 33.8 38.0 100-104 35.98075 38.0 37.0 38.0 32.6 38.0 105-109 35.84775 38.0 37.0 38.0 31.8 38.0 110-114 35.583999999999996 38.0 36.8 38.0 30.4 38.0 115-119 35.339099999999995 38.0 36.0 38.0 29.0 38.0 120-124 35.0757 38.0 36.0 38.0 28.2 38.0 125-129 34.76435 38.0 35.2 38.0 27.2 38.0 130-134 34.34555 38.0 34.8 38.0 25.2 38.0 135-139 33.8489 38.0 34.6 38.0 21.4 38.0 140-144 33.649550000000005 38.0 34.4 38.0 21.4 38.0 145-149 32.953849999999996 38.0 34.0 38.0 16.6 38.0 150-151 28.86425 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 0.0 18 3.0 19 7.0 20 6.0 21 12.0 22 15.0 23 7.0 24 15.0 25 21.0 26 26.0 27 27.0 28 35.0 29 41.0 30 53.0 31 66.0 32 84.0 33 97.0 34 166.0 35 304.0 36 775.0 37 2230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.13775510204081 12.729591836734693 8.775510204081632 35.35714285714286 2 22.45 15.475 33.324999999999996 28.749999999999996 3 17.599999999999998 20.474999999999998 28.725 33.2 4 21.3 28.925 25.05 24.725 5 22.75 32.5 24.5 20.25 6 19.15 36.375 24.925 19.55 7 14.924999999999999 26.25 41.25 17.575 8 17.925 26.275 29.95 25.85 9 16.825000000000003 26.450000000000003 32.45 24.275 10-14 19.68 29.525000000000002 27.500000000000004 23.294999999999998 15-19 19.79 29.220000000000002 27.205000000000002 23.785 20-24 19.945 28.754999999999995 27.49 23.810000000000002 25-29 20.26 29.335 26.915 23.49 30-34 19.6 29.154999999999998 27.73 23.515 35-39 20.200000000000003 29.110000000000003 26.790000000000003 23.9 40-44 20.185 29.84 26.590000000000003 23.385 45-49 19.955000000000002 28.685 27.255000000000003 24.104999999999997 50-54 20.34 28.92 26.83 23.91 55-59 20.119999999999997 29.044999999999998 26.6 24.235 60-64 20.165 29.26 26.86 23.715 65-69 20.155 28.63 27.339999999999996 23.875 70-74 20.69 28.499999999999996 26.965 23.845 75-79 20.36 27.905 27.82 23.915 80-84 20.080000000000002 28.384999999999998 27.6 23.935000000000002 85-89 20.645 28.625 27.18 23.549999999999997 90-94 20.68 28.815 27.3 23.205000000000002 95-99 20.46 28.17 27.595 23.775 100-104 20.39 29.354999999999997 26.705000000000002 23.549999999999997 105-109 20.735 28.08 27.13 24.055 110-114 20.955 28.439999999999998 26.68 23.925 115-119 20.865000000000002 28.38 26.455000000000002 24.3 120-124 20.915 28.96 26.39 23.735 125-129 20.86 28.694999999999997 26.279999999999998 24.165 130-134 20.655 28.470000000000002 26.71 24.165 135-139 20.715 28.465 26.6 24.22 140-144 21.05 28.549999999999997 26.275 24.125 145-149 20.724999999999998 28.96 26.479999999999997 23.835 150-151 20.3 29.325000000000003 26.0 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 2.5 25 2.5 26 3.5 27 8.5 28 9.5 29 9.5 30 15.0 31 27.5 32 33.0 33 42.0 34 60.0 35 66.5 36 87.0 37 112.0 38 133.0 39 155.5 40 182.0 41 231.0 42 257.0 43 259.0 44 258.0 45 264.5 46 265.5 47 236.0 48 211.5 49 189.0 50 171.0 51 151.0 52 129.5 53 106.0 54 78.0 55 65.0 56 51.5 57 34.5 58 22.0 59 15.0 60 12.0 61 9.0 62 6.5 63 6.0 64 5.0 65 3.0 66 2.0 67 2.5 68 2.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.35 0.0 0.0 0.0 0.0 106-107 2.9000000000000004 0.0 0.0 0.0 0.0 108-109 3.2625 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 3.9749999999999996 0.0 0.0 0.0 0.0 114-115 4.550000000000001 0.0 0.0 0.0 0.0 116-117 5.0875 0.0 0.0 0.0 0.0 118-119 5.625 0.0 0.0 0.0 0.0 120-121 6.199999999999999 0.0 0.0 0.0 0.0 122-123 6.762499999999999 0.0 0.0 0.0 0.0 124-125 7.425000000000001 0.0 0.0 0.0 0.0 126-127 8.1375 0.0 0.0 0.0 0.0 128-129 8.75 0.0 0.0 0.0 0.0 130-131 9.287500000000001 0.0 0.0 0.0 0.0 132-133 10.0 0.0 0.0 0.0 0.0 134-135 10.899999999999999 0.0 0.0 0.0 0.0 136-137 11.850000000000001 0.0 0.0 0.0 0.0 138-139 12.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGTAG 10 0.006832588 144.9875 3 >>END_MODULE SRR7170008 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170008_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6405 33.0 33.0 34.0 31.0 34.0 2 32.119 33.0 33.0 34.0 31.0 34.0 3 32.1575 34.0 33.0 34.0 31.0 34.0 4 31.808 34.0 33.0 34.0 31.0 34.0 5 31.8165 34.0 33.0 34.0 31.0 34.0 6 36.1305 38.0 38.0 38.0 34.0 38.0 7 36.17375 38.0 38.0 38.0 35.0 38.0 8 36.22625 38.0 38.0 38.0 35.0 38.0 9 36.26275 38.0 38.0 38.0 36.0 38.0 10-14 36.1712 38.0 38.0 38.0 35.8 38.0 15-19 35.848650000000006 38.0 38.0 38.0 34.6 38.0 20-24 36.02929999999999 38.0 38.0 38.0 35.4 38.0 25-29 36.07685 38.0 38.0 38.0 35.2 38.0 30-34 36.184450000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.02785 38.0 38.0 38.0 35.2 38.0 40-44 35.89165 38.0 38.0 38.0 35.2 38.0 45-49 35.849599999999995 38.0 38.0 38.0 34.8 38.0 50-54 35.9966 38.0 38.0 38.0 35.0 38.0 55-59 35.909 38.0 38.0 38.0 34.6 38.0 60-64 35.9184 38.0 38.0 38.0 34.4 38.0 65-69 35.83225 38.0 38.0 38.0 34.0 38.0 70-74 35.750049999999995 38.0 38.0 38.0 34.0 38.0 75-79 35.6572 38.0 38.0 38.0 33.8 38.0 80-84 35.61405 38.0 38.0 38.0 33.4 38.0 85-89 35.17425 38.0 38.0 38.0 30.6 38.0 90-94 34.842499999999994 38.0 38.0 38.0 28.4 38.0 95-99 35.0861 38.0 38.0 38.0 29.0 38.0 100-104 35.22345 38.0 38.0 38.0 30.6 38.0 105-109 35.075 38.0 38.0 38.0 30.0 38.0 110-114 34.86995 38.0 37.8 38.0 28.2 38.0 115-119 34.58045 38.0 36.8 38.0 26.2 38.0 120-124 34.39465 38.0 36.2 38.0 24.6 38.0 125-129 33.90259999999999 38.0 35.8 38.0 19.4 38.0 130-134 32.791999999999994 38.0 35.0 38.0 11.2 38.0 135-139 31.673450000000003 38.0 33.8 38.0 2.0 38.0 140-144 30.612849999999998 38.0 32.2 38.0 2.0 38.0 145-149 30.16425 38.0 31.0 38.0 2.0 38.0 150-151 26.133125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 100.0 3 13.0 4 4.0 5 0.0 6 4.0 7 0.0 8 3.0 9 3.0 10 0.0 11 1.0 12 6.0 13 2.0 14 5.0 15 5.0 16 9.0 17 8.0 18 7.0 19 6.0 20 11.0 21 12.0 22 17.0 23 22.0 24 18.0 25 21.0 26 26.0 27 26.0 28 35.0 29 45.0 30 49.0 31 90.0 32 88.0 33 153.0 34 146.0 35 213.0 36 489.0 37 2363.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.83419689119171 24.067357512953368 12.227979274611398 24.870466321243523 2 27.392405063291143 26.531645569620256 28.88607594936709 17.189873417721518 3 19.679226069246436 29.022403258655803 31.74643584521385 19.551934826883908 4 22.187822497420022 33.46233230134159 25.593395252837976 18.756449948400412 5 24.23851316468766 35.46721734641198 23.102736189984512 17.191533298915846 6 21.483180428134556 36.213047910295614 23.343527013251784 18.960244648318042 7 21.539638032118276 21.106296201886313 38.006627580932964 19.34743818506245 8 23.575788402848424 24.262461851475077 26.2970498474059 25.864699898270597 9 21.186656480774126 26.203208556149733 29.488158899923604 23.121976063152534 10-14 24.413193556635132 27.859882383022246 26.84223983635899 20.884684223983633 15-19 23.598744145349734 27.911884296669925 27.778063719182665 20.711307838797673 20-24 23.672090881179 27.985876573533925 27.23876778221267 21.103264763074403 25-29 24.38949783329085 27.759367830741777 27.152689268417028 20.698445067550345 30-34 23.394589076059212 28.172537008677896 27.621235324144973 20.811638591117916 35-39 23.47429858693426 28.240835551914806 27.477984845381936 20.806881015768994 40-44 23.80193336075689 27.740641711229948 27.41155902920609 21.045865898807076 45-49 23.538184623296477 27.8272049370018 27.98662895345847 20.64798148624325 50-54 23.814143477150882 27.648710748021443 27.633392902731686 20.903752872095993 55-59 24.326121426014012 27.72236714234566 27.533118510562122 20.418392921078205 60-64 23.010840662712212 27.73061975864185 28.809572509715686 20.44896706893025 65-69 23.799059689288633 27.621627146361405 27.958912510220767 20.620400654129188 70-74 23.950091296409006 27.814972611077298 28.093933860823693 20.141002231689995 75-79 23.396915584415584 28.084415584415584 27.97280844155844 20.54586038961039 80-84 23.92334743387187 27.786555221446406 27.847714183782678 20.442383160899034 85-89 24.429176567827255 27.105072838103112 28.54633743155285 19.91941316251679 90-94 24.04306220095694 27.46515498231745 27.43915123777824 21.052631578947366 95-99 23.957853818219014 27.952534397217534 27.732596798117743 20.357014986445705 100-104 24.508652815355557 27.862575935473995 27.112154780744298 20.516616468426157 105-109 24.05684490338411 27.7170023514978 27.931704324711177 20.294448420406912 110-114 24.09922607759725 27.681820511506327 27.907334324227357 20.311619086669058 115-119 24.97325930830744 26.990271481688993 27.621861152141804 20.414608057861763 120-124 24.908814589665653 27.67983789260385 27.365754812563324 20.045592705167174 125-129 25.14112696294776 28.286975264292312 26.93728830955558 19.634609463204352 130-134 25.16493376260094 27.930543093893494 26.774687285586108 20.12983585791946 135-139 25.6979318537718 27.668880609104164 27.096495491117228 19.536692046006802 140-144 26.0468183316848 27.546983184965377 26.590834157599737 19.81536432575008 145-149 27.091570457061522 28.093204702409192 26.11629500764405 18.698929832885234 150-151 27.257525083612038 27.72060715204528 26.305634165165937 18.716233599176743 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 50.0 1 26.0 2 1.5 3 2.0 4 4.0 5 4.5 6 4.0 7 3.5 8 2.0 9 0.5 10 1.5 11 1.5 12 0.5 13 2.0 14 2.0 15 0.5 16 0.5 17 1.0 18 1.0 19 1.5 20 3.0 21 2.5 22 2.0 23 2.0 24 1.0 25 1.5 26 1.0 27 4.0 28 8.0 29 7.5 30 10.0 31 18.5 32 28.0 33 36.5 34 48.0 35 61.0 36 75.5 37 98.5 38 123.0 39 158.0 40 192.0 41 218.5 42 250.5 43 267.0 44 278.5 45 267.5 46 250.5 47 266.5 48 244.0 49 186.0 50 159.5 51 143.0 52 113.0 53 89.5 54 70.0 55 52.5 56 41.5 57 29.0 58 25.0 59 21.0 60 11.5 61 12.5 62 11.0 63 4.0 64 5.0 65 4.5 66 2.5 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 2.0 73 2.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.5000000000000004 2 1.25 3 1.7999999999999998 4 3.1 5 3.15 6 1.9 7 1.925 8 1.7000000000000002 9 1.825 10-14 2.225 15-19 2.855 20-24 2.29 25-29 1.925 30-34 2.0500000000000003 35-39 2.34 40-44 2.76 45-49 2.775 50-54 2.075 55-59 2.245 60-64 2.22 65-69 2.16 70-74 1.4200000000000002 75-79 1.44 80-84 1.8950000000000002 85-89 3.2099999999999995 90-94 3.8600000000000003 95-99 2.245 100-104 2.0549999999999997 105-109 2.19 110-114 2.445 115-119 1.8350000000000002 120-124 1.3 125-129 2.5700000000000003 130-134 5.265000000000001 135-139 7.405 140-144 9.01 145-149 5.155 150-151 2.825 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64358452138494 97.85000000000001 2 0.2545824847250509 0.5 3 0.02545824847250509 0.075 4 0.0 0.0 5 0.02545824847250509 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02545824847250509 0.2 9 0.0 0.0 >10 0.02545824847250509 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 50 1.25 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.7375 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.3625 0.0 0.0 0.0 0.0 116-117 4.8875 0.0 0.0 0.0 0.0 118-119 5.3875 0.0 0.0 0.0 0.0 120-121 5.9875 0.0 0.0 0.0 0.0 122-123 6.5875 0.0 0.0 0.0 0.0 124-125 7.1625 0.0 0.0 0.0 0.0 126-127 7.8125 0.0 0.0 0.0 0.0 128-129 8.4 0.0 0.0 0.0 0.0 130-131 8.925 0.0 0.0 0.0 0.0 132-133 9.55 0.0 0.0 0.0 0.0 134-135 10.3 0.0 0.0 0.0 0.0 136-137 11.075 0.0 0.0 0.0 0.0 138-139 12.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra Read 894485 spots for SRR7170008.sra Written 894485 spots for SRR7170008.sra Read 894472 spots for SRR7170008.sra Written 894472 spots for SRR7170008.sra SRR ids: ['SRR7170008.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h1d0df2g SRR7170008.sra spots: 17889453 blocks: [[1, 894472], [894473, 1788944], [1788945, 2683416], [2683417, 3577888], [3577889, 4472360], [4472361, 5366832], [5366833, 6261304], [6261305, 7155776], [7155777, 8050248], [8050249, 8944720], [8944721, 9839192], [9839193, 10733664], [10733665, 11628136], [11628137, 12522608], [12522609, 13417080], [13417081, 14311552], [14311553, 15206024], [15206025, 16100496], [16100497, 16994968], [16994969, 17889453]] SRR7170008 file size 6040448 SRR7170008 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170008 SRR7170008_1.fastq SRR7170008_2.fastq Input file: SRR7170008_1.fastq Paired file: SRR7170008_2.fastq trimmed: SRR7170008-trimmed-pair1.fastq, SRR7170008-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:10:01 2025 >> started Wed Feb 12 10:10:21 2025 >> done (19.511s) 17889453 read pairs processed; of these: 32080 ( 0.18%) short read pairs filtered out after trimming by size control 44174 ( 0.25%) empty read pairs filtered out after trimming by size control 17813199 (99.57%) read pairs available; of these: 9178695 (51.53%) trimmed read pairs available after processing 8634504 (48.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 6 0.00% 21 9 0.00% 22 11 0.00% 23 10 0.00% 24 4 0.00% 25 14 0.00% 26 10 0.00% 27 12 0.00% 28 14 0.00% 29 18 0.00% 30 14 0.00% 31 22 0.00% 32 22 0.00% 33 13 0.00% 34 18 0.00% 35 24 0.00% 36 32 0.00% 37 38 0.00% 38 58 0.00% 39 43 0.00% 40 59 0.00% 41 68 0.00% 42 84 0.00% 43 76 0.00% 44 64 0.00% 45 76 0.00% 46 89 0.00% 47 112 0.00% 48 113 0.00% 49 161 0.00% 50 178 0.00% 51 205 0.00% 52 235 0.00% 53 230 0.00% 54 239 0.00% 55 268 0.00% 56 316 0.00% 57 348 0.00% 58 380 0.00% 59 507 0.00% 60 528 0.00% 61 608 0.00% 62 697 0.00% 63 865 0.00% 64 954 0.01% 65 1034 0.01% 66 1131 0.01% 67 1264 0.01% 68 1502 0.01% 69 1752 0.01% 70 2334 0.01% 71 2581 0.01% 72 2703 0.02% 73 2886 0.02% 74 3276 0.02% 75 3625 0.02% 76 3826 0.02% 77 4051 0.02% 78 4608 0.03% 79 5262 0.03% 80 5888 0.03% 81 6809 0.04% 82 7780 0.04% 83 8935 0.05% 84 11219 0.06% 85 12552 0.07% 86 12999 0.07% 87 13688 0.08% 88 14420 0.08% 89 14933 0.08% 90 16096 0.09% 91 17721 0.10% 92 19507 0.11% 93 21632 0.12% 94 23352 0.13% 95 24173 0.14% 96 25353 0.14% 97 26344 0.15% 98 27073 0.15% 99 27159 0.15% 100 29460 0.17% 101 31246 0.18% 102 33811 0.19% 103 35777 0.20% 104 38494 0.22% 105 40680 0.23% 106 41329 0.23% 107 42071 0.24% 108 42476 0.24% 109 43281 0.24% 110 44248 0.25% 111 46906 0.26% 112 48902 0.27% 113 52436 0.29% 114 55123 0.31% 115 58181 0.33% 116 59313 0.33% 117 60257 0.34% 118 60262 0.34% 119 60790 0.34% 120 62005 0.35% 121 63192 0.35% 122 65543 0.37% 123 69717 0.39% 124 72483 0.41% 125 75577 0.42% 126 77489 0.44% 127 79240 0.44% 128 79999 0.45% 129 81325 0.46% 130 82939 0.47% 131 84455 0.47% 132 88602 0.50% 133 92630 0.52% 134 96920 0.54% 135 101073 0.57% 136 105731 0.59% 137 110376 0.62% 138 116355 0.65% 139 121136 0.68% 140 126185 0.71% 141 134027 0.75% 142 142548 0.80% 143 153899 0.86% 144 169499 0.95% 145 190000 1.07% 146 222842 1.25% 147 286300 1.61% 148 383538 2.15% 149 707224 3.97% 150 3623474 20.34% 151 8634504 48.47% 17813199 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=37 prefix-density=0.15 prefix-fanout=3.0 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=389.46 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=29.8 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.16 fanout-score-rank=29 prefix-density=0.22 prefix-fanout=3.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=10 fanout-score=292.83 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=27.9 sequence=AAGAAGAAGAAG SRR7170008 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:11:05 Started mapping on | Feb 12 10:11:05 Finished on | Feb 12 10:13:33 Mapping speed, Million of reads per hour | 433.29 Number of input reads | 17813199 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16456172 Uniquely mapped reads % | 92.38% Average mapped length | 288.91 Number of splices: Total | 14823543 Number of splices: Annotated (sjdb) | 14491725 Number of splices: GT/AG | 14568077 Number of splices: GC/AG | 202297 Number of splices: AT/AC | 14219 Number of splices: Non-canonical | 38950 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379065 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 44988 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.17% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1002275 1002275 1002275 N_multimapping 379065 379065 379065 N_noFeature 526653 16254746 634615 N_ambiguous 162255 1115 68298 UnstrandedReadsAssigned:15767264 PositiveStrandReadsAssigned:200311 NegativeStrandReadsAssigned:15753259 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7170008 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170008-trimmed-pair1.fastq SRR7170008-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,813,199 reads, 15,728,308 reads pseudoaligned [quant] estimated average fragment length: 213.793 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR7170008.ke.tsv 34699 SRR7170008.se.tsv 87100 total ==> SRR7170008.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.21 471 15.4601 Potri.005G024800.1.v4.1 1035 822.207 148 10.6659 Potri.004G059700.1.v4.1 961 748.231 26 2.059 Potri.007G009000.2.v4.1 1416 1203.21 0 0 Potri.003G141000.2.v4.1 2943 2730.21 303 6.57606 Potri.016G087400.1.v4.1 270 94.3792 1998 1254.4 Potri.015G069301.1.v4.1 564 354.462 0 0 Potri.010G195200.1.v4.1 1773 1560.21 109.754 4.16826 Potri.012G127500.1.v4.1 977 764.217 17063 1322.99 ==> SRR7170008.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1243 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 466 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 793 Potri.001G452600.v4.1 29 SRR7170008 completed mapping pipeline successfully