Starting /dee2/code/volunteer_pipeline.sh SRR7170009 current disk space = 3051201179648 free memory = 1580178188 SRR7170009 SRAfilesize 0c9046f0ec05887ee0da2449159c7129 SRR7170009.sra SRR7170009.sra file validated SRR7170009 is paired end SRR7170009 is conventional basespace SRR7170009 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170009_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1915 34.0 34.0 34.0 33.0 34.0 2 33.55875 34.0 34.0 34.0 33.0 34.0 3 33.556 34.0 34.0 34.0 33.0 34.0 4 33.638 34.0 34.0 34.0 33.0 34.0 5 33.6085 34.0 34.0 34.0 33.0 34.0 6 37.41625 38.0 38.0 38.0 37.0 38.0 7 37.657 38.0 38.0 38.0 38.0 38.0 8 37.6555 38.0 38.0 38.0 38.0 38.0 9 37.68875 38.0 38.0 38.0 38.0 38.0 10-14 37.66845 38.0 38.0 38.0 38.0 38.0 15-19 37.64325 38.0 38.0 38.0 38.0 38.0 20-24 37.61895 38.0 38.0 38.0 38.0 38.0 25-29 37.58765 38.0 38.0 38.0 38.0 38.0 30-34 37.5673 38.0 38.0 38.0 38.0 38.0 35-39 37.5038 38.0 38.0 38.0 38.0 38.0 40-44 37.427400000000006 38.0 38.0 38.0 37.4 38.0 45-49 37.26985 38.0 38.0 38.0 37.0 38.0 50-54 37.3415 38.0 38.0 38.0 37.0 38.0 55-59 37.27525 38.0 38.0 38.0 37.0 38.0 60-64 37.2635 38.0 38.0 38.0 37.0 38.0 65-69 37.20905 38.0 38.0 38.0 37.0 38.0 70-74 37.1165 38.0 38.0 38.0 36.0 38.0 75-79 37.088550000000005 38.0 38.0 38.0 36.2 38.0 80-84 37.02160000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.8204 38.0 38.0 38.0 35.8 38.0 90-94 36.624399999999994 38.0 38.0 38.0 35.4 38.0 95-99 36.42765000000001 38.0 38.0 38.0 34.4 38.0 100-104 36.5432 38.0 38.0 38.0 34.6 38.0 105-109 36.47005 38.0 38.0 38.0 34.0 38.0 110-114 36.37125 38.0 38.0 38.0 34.0 38.0 115-119 36.14625 38.0 37.8 38.0 33.6 38.0 120-124 35.95385 38.0 37.6 38.0 33.0 38.0 125-129 35.601299999999995 38.0 36.6 38.0 31.6 38.0 130-134 35.31585 38.0 36.0 38.0 30.2 38.0 135-139 34.853049999999996 38.0 35.8 38.0 27.8 38.0 140-144 34.69405 38.0 35.8 38.0 27.6 38.0 145-149 34.06725 38.0 35.0 38.0 24.8 38.0 150-151 30.452125000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 2.0 19 8.0 20 3.0 21 5.0 22 19.0 23 6.0 24 9.0 25 13.0 26 17.0 27 13.0 28 24.0 29 23.0 30 44.0 31 39.0 32 50.0 33 87.0 34 110.0 35 216.0 36 531.0 37 2775.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.236128705345834 12.009120851279453 8.208766151507474 35.54598429186724 2 21.875 14.299999999999999 34.075 29.75 3 19.325 18.675 26.875 35.125 4 23.400000000000002 26.950000000000003 22.25 27.400000000000002 5 22.025 33.875 23.3 20.8 6 20.125 34.35 24.675 20.849999999999998 7 14.799999999999999 27.825 39.65 17.724999999999998 8 17.599999999999998 25.85 31.5 25.05 9 17.0 24.9 33.925 24.175 10-14 19.96 30.125 26.66 23.255 15-19 20.44 28.815 27.279999999999998 23.465 20-24 19.84 29.205 26.965 23.990000000000002 25-29 20.5 29.104999999999997 26.900000000000002 23.494999999999997 30-34 20.09 28.15 27.694999999999997 24.065 35-39 20.7 28.310000000000002 27.07 23.919999999999998 40-44 20.459091818363675 28.52070414082817 27.525505101020205 23.49469893978796 45-49 20.765876397173074 28.184050924765675 27.08636158588542 23.963711092175828 50-54 19.890994549727488 28.656432821641083 27.816390819540977 23.636181809090452 55-59 20.145 28.904999999999998 26.790000000000003 24.16 60-64 20.474999999999998 28.895 27.095000000000002 23.535 65-69 20.395 28.775000000000002 27.200000000000003 23.630000000000003 70-74 21.09 28.470000000000002 27.169999999999998 23.27 75-79 20.69 28.675 27.305 23.330000000000002 80-84 20.549999999999997 29.315 26.715 23.419999999999998 85-89 20.33176305502656 28.68597774882229 27.312819484815076 23.669439711336075 90-94 20.595046314941605 28.700161095449054 26.913008457511072 23.791784132098268 95-99 20.547048156357043 28.440459399556723 27.705017126737857 23.307475317348377 100-104 20.631979568330912 28.714507486604234 27.3523962141319 23.301116730932947 105-109 21.565 28.76 26.325 23.35 110-114 20.68154523618895 28.29263410728583 27.23678943154524 23.789031224979983 115-119 20.587058705870586 28.497849784978495 26.882688268826882 24.032403240324033 120-124 20.605 28.98 26.365 24.05 125-129 20.935000000000002 28.749999999999996 26.76 23.555 130-134 20.543140595250026 29.562080368774424 26.340314660787655 23.554464375187894 135-139 20.88044625358058 28.393386602341824 26.322930800542743 24.40323634353485 140-144 20.75102777499248 27.664694675624187 27.484207359871654 24.100070189511683 145-149 21.043408601612175 28.16802683622891 27.031492514895106 23.757072047263804 150-151 21.3125 27.787499999999998 26.4625 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.0 26 2.0 27 6.0 28 11.0 29 11.5 30 13.5 31 25.0 32 38.5 33 47.5 34 54.5 35 60.0 36 79.5 37 103.0 38 127.0 39 162.0 40 179.0 41 195.5 42 225.0 43 253.5 44 270.5 45 268.0 46 275.0 47 270.5 48 232.0 49 194.5 50 180.5 51 165.0 52 135.0 53 106.0 54 80.0 55 56.0 56 38.0 57 30.5 58 25.0 59 19.5 60 14.5 61 7.5 62 6.0 63 7.0 64 4.0 65 4.5 66 3.0 67 0.5 68 2.0 69 3.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.02 45-49 0.245 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.22999999999999998 90-94 0.6799999999999999 95-99 0.74 100-104 0.155 105-109 0.0 110-114 0.08 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.21 135-139 0.505 140-144 0.27 145-149 0.135 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 1.95 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6500000000000004 0.0 0.0 0.0 0.0 112-113 2.975 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.5875000000000004 0.0 0.0 0.0 0.0 118-119 3.9250000000000003 0.0 0.0 0.0 0.0 120-121 4.300000000000001 0.0 0.0 0.0 0.0 122-123 4.6125 0.0 0.0 0.0 0.0 124-125 4.987500000000001 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.05 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.8375 0.0 0.0 0.0 0.0 138-139 8.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170009 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170009_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.123 33.0 33.0 34.0 32.0 34.0 2 32.318 34.0 33.0 34.0 32.0 34.0 3 32.33175 34.0 33.0 34.0 32.0 34.0 4 32.04875 34.0 33.0 34.0 32.0 34.0 5 32.0455 34.0 33.0 34.0 32.0 34.0 6 36.20575 38.0 38.0 38.0 36.0 38.0 7 36.16225 38.0 38.0 38.0 36.0 38.0 8 36.2495 38.0 38.0 38.0 36.0 38.0 9 36.258 38.0 38.0 38.0 37.0 38.0 10-14 36.204 38.0 38.0 38.0 36.6 38.0 15-19 36.04385 38.0 38.0 38.0 36.0 38.0 20-24 36.13205 38.0 38.0 38.0 36.2 38.0 25-29 36.161199999999994 38.0 38.0 38.0 36.2 38.0 30-34 36.18845 38.0 38.0 38.0 37.0 38.0 35-39 36.11445 38.0 38.0 38.0 36.2 38.0 40-44 35.98055 38.0 38.0 38.0 36.0 38.0 45-49 35.9059 38.0 38.0 38.0 36.0 38.0 50-54 36.044050000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.056 38.0 38.0 38.0 36.0 38.0 60-64 36.02374999999999 38.0 38.0 38.0 36.0 38.0 65-69 35.95725 38.0 38.0 38.0 35.4 38.0 70-74 35.88415 38.0 38.0 38.0 35.0 38.0 75-79 35.85925 38.0 38.0 38.0 34.8 38.0 80-84 35.7279 38.0 38.0 38.0 34.0 38.0 85-89 35.4031 38.0 38.0 38.0 33.2 38.0 90-94 35.0034 38.0 38.0 38.0 29.8 38.0 95-99 35.43925 38.0 38.0 38.0 32.8 38.0 100-104 35.38680000000001 38.0 38.0 38.0 32.2 38.0 105-109 35.265150000000006 38.0 38.0 38.0 31.6 38.0 110-114 35.138400000000004 38.0 38.0 38.0 31.0 38.0 115-119 34.99455 38.0 38.0 38.0 29.6 38.0 120-124 34.664100000000005 38.0 37.4 38.0 26.8 38.0 125-129 34.2776 38.0 36.6 38.0 24.4 38.0 130-134 33.273849999999996 38.0 35.8 38.0 14.0 38.0 135-139 32.57815 38.0 34.8 38.0 6.4 38.0 140-144 31.907550000000004 38.0 33.0 38.0 2.0 38.0 145-149 31.386900000000004 38.0 33.2 38.0 2.0 38.0 150-151 27.582500000000003 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 115.0 3 9.0 4 4.0 5 2.0 6 1.0 7 1.0 8 0.0 9 2.0 10 1.0 11 0.0 12 6.0 13 8.0 14 1.0 15 2.0 16 6.0 17 9.0 18 1.0 19 11.0 20 4.0 21 16.0 22 5.0 23 13.0 24 17.0 25 18.0 26 14.0 27 24.0 28 45.0 29 37.0 30 50.0 31 68.0 32 72.0 33 103.0 34 125.0 35 157.0 36 369.0 37 2684.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.23638232271326 21.685508735868446 12.795477903391571 25.28263103802672 2 27.397608750953957 26.278300686848134 29.636224879165606 16.687865683032307 3 19.63738508682329 26.940755873340144 33.40143003064352 20.020429009193055 4 24.50296927446424 33.23005422153369 24.167312161115415 18.09966434288665 5 25.148617213750324 34.866890669423626 21.375032308089946 18.609459808736105 6 19.95371560812548 37.567498071483676 23.52789920287992 18.950887117510927 7 19.95371560812548 21.49652867060941 39.54744150167138 19.00231421959373 8 22.333590336674376 25.49473143150861 27.370855821125673 24.80082241069134 9 21.568123393316196 23.727506426735218 30.102827763496144 24.601542416452443 10-14 22.91924186238154 28.244746600741657 26.972599917593737 21.863411619283067 15-19 23.45455486006932 27.230872691531737 27.830945114065493 21.483627334333455 20-24 22.46264811952602 28.330757341576508 27.779495105615666 21.427099433281814 25-29 23.440959884649054 27.91080900149338 27.524589319738404 21.12364179411916 30-34 22.898640296662546 28.054182117840952 27.78636176349403 21.26081582200247 35-39 23.343995047461824 27.718737102765168 27.61040033016921 21.3268675196038 40-44 23.30418585398665 27.960883737776165 27.81083458374295 20.92409582449423 45-49 23.282067215576614 27.388535031847134 28.424214178447514 20.905183574128735 50-54 23.06900102986612 28.110195674562306 28.08444902162719 20.73635427394439 55-59 23.69695096827359 27.971775854964974 27.27647301194891 21.054800164812526 60-64 23.38277709105892 27.873918417799754 28.38380716934487 20.359497321796457 65-69 23.673385438091323 27.565816536404768 28.22398190045249 20.53681612505142 70-74 23.789086450030656 27.207234825260578 28.41814837522992 20.585530349478848 75-79 23.393158459886486 27.325254384619317 28.49107736360382 20.790509791890372 80-84 23.62431279864358 27.971021939063867 27.703848327595953 20.700816934696604 85-89 23.960231117588883 27.692467856956952 28.09848524282963 20.248815782624536 90-94 23.746204585907236 27.614909433567163 28.06512407077793 20.57376190974767 95-99 23.649484536082475 27.65979381443299 27.91237113402062 20.778350515463917 100-104 24.30737599588795 27.417116422513494 27.62271909534824 20.65278848625032 105-109 24.563938486943957 27.505418515842706 27.603467850139335 20.327175147074 110-114 23.95580566885229 27.7608549744437 28.049976766998814 20.233362589705198 115-119 24.644306333145 27.50012840926601 27.561764856952074 20.29380040063691 120-124 24.18300653594771 27.736928104575163 27.450980392156865 20.62908496732026 125-129 24.752526561285308 27.91915003887017 26.789323658979008 20.53899974086551 130-134 25.14221915040672 27.656972725822744 27.17316178425222 20.027646339518316 135-139 24.858115777525537 27.630938868169284 27.128263337116916 20.382682017188262 140-144 24.496276828734125 27.562417871222078 27.786903197547087 20.154402102496714 145-149 25.236024185849153 27.82963827304551 27.087090272621197 19.847247268484143 150-151 25.70687418936446 27.28923476005188 27.250324254215304 19.753566796368354 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 78.0 1 41.5 2 4.5 3 3.0 4 2.5 5 4.0 6 5.5 7 3.5 8 3.0 9 3.0 10 1.0 11 1.0 12 0.5 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 2.0 24 4.0 25 4.5 26 4.5 27 5.0 28 8.0 29 7.5 30 9.5 31 15.5 32 23.0 33 36.5 34 47.0 35 56.0 36 72.5 37 92.0 38 120.5 39 154.5 40 192.0 41 226.5 42 252.0 43 264.5 44 266.0 45 276.0 46 280.0 47 250.5 48 216.5 49 209.5 50 180.0 51 131.5 52 109.0 53 98.0 54 75.5 55 53.5 56 37.0 57 28.0 58 26.5 59 16.0 60 5.5 61 4.0 62 5.5 63 4.5 64 2.0 65 1.5 66 2.5 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.7 2 1.725 3 2.1 4 3.175 5 3.2750000000000004 6 2.775 7 2.775 8 2.725 9 2.75 10-14 2.92 15-19 3.345 20-24 2.9499999999999997 25-29 2.905 30-34 2.92 35-39 3.08 40-44 3.3649999999999998 45-49 3.4450000000000003 50-54 2.9000000000000004 55-59 2.92 60-64 2.92 65-69 2.76 70-74 2.1399999999999997 75-79 2.215 80-84 2.685 85-89 3.945 90-94 4.49 95-99 3.0 100-104 2.725 105-109 3.11 110-114 3.1550000000000002 115-119 2.6550000000000002 120-124 2.08 125-129 3.5249999999999995 130-134 5.955 135-139 7.495 140-144 8.68 145-149 5.7299999999999995 150-151 3.6249999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.12528942629277 96.325 2 0.6431695394906097 1.25 3 0.15436068947774634 0.44999999999999996 4 0.0 0.0 5 0.05145356315924878 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02572678157962439 1.725 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 69 1.725 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.35 0.0 0.0 0.0 0.0 118-119 3.6500000000000004 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.637499999999999 0.0 0.0 0.0 0.0 126-127 5.2125 0.0 0.0 0.0 0.0 128-129 5.6375 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.275 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTTA 10 0.007210551 142.4 3 GCTTATT 10 0.007210551 142.4 2 >>END_MODULE Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682061 spots for SRR7170009.sra Written 682061 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra Read 682056 spots for SRR7170009.sra Written 682056 spots for SRR7170009.sra SRR ids: ['SRR7170009.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n4ez3la8 SRR7170009.sra spots: 13641125 blocks: [[1, 682056], [682057, 1364112], [1364113, 2046168], [2046169, 2728224], [2728225, 3410280], [3410281, 4092336], [4092337, 4774392], [4774393, 5456448], [5456449, 6138504], [6138505, 6820560], [6820561, 7502616], [7502617, 8184672], [8184673, 8866728], [8866729, 9548784], [9548785, 10230840], [10230841, 10912896], [10912897, 11594952], [11594953, 12277008], [12277009, 12959064], [12959065, 13641125]] SRR7170009 file size 4600829 SRR7170009 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170009 SRR7170009_1.fastq SRR7170009_2.fastq Input file: SRR7170009_1.fastq Paired file: SRR7170009_2.fastq trimmed: SRR7170009-trimmed-pair1.fastq, SRR7170009-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:54:18 2025 >> started Wed Feb 12 10:54:33 2025 >> done (14.845s) 13641125 read pairs processed; of these: 20015 ( 0.15%) short read pairs filtered out after trimming by size control 30184 ( 0.22%) empty read pairs filtered out after trimming by size control 13590926 (99.63%) read pairs available; of these: 6397536 (47.07%) trimmed read pairs available after processing 7193390 (52.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 7 0.00% 24 9 0.00% 25 6 0.00% 26 6 0.00% 27 6 0.00% 28 0 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 5 0.00% 33 9 0.00% 34 12 0.00% 35 7 0.00% 36 15 0.00% 37 11 0.00% 38 21 0.00% 39 10 0.00% 40 21 0.00% 41 22 0.00% 42 40 0.00% 43 38 0.00% 44 45 0.00% 45 39 0.00% 46 32 0.00% 47 58 0.00% 48 63 0.00% 49 60 0.00% 50 79 0.00% 51 104 0.00% 52 104 0.00% 53 95 0.00% 54 120 0.00% 55 125 0.00% 56 153 0.00% 57 150 0.00% 58 214 0.00% 59 261 0.00% 60 258 0.00% 61 287 0.00% 62 369 0.00% 63 394 0.00% 64 431 0.00% 65 470 0.00% 66 568 0.00% 67 601 0.00% 68 694 0.01% 69 790 0.01% 70 997 0.01% 71 1110 0.01% 72 1278 0.01% 73 1470 0.01% 74 1547 0.01% 75 1706 0.01% 76 1842 0.01% 77 2058 0.02% 78 2344 0.02% 79 2561 0.02% 80 2864 0.02% 81 3265 0.02% 82 3637 0.03% 83 4181 0.03% 84 5391 0.04% 85 6239 0.05% 86 6925 0.05% 87 7055 0.05% 88 7628 0.06% 89 7715 0.06% 90 8270 0.06% 91 8930 0.07% 92 9503 0.07% 93 10644 0.08% 94 11259 0.08% 95 12010 0.09% 96 12575 0.09% 97 13009 0.10% 98 13681 0.10% 99 14158 0.10% 100 15025 0.11% 101 15988 0.12% 102 16898 0.12% 103 17961 0.13% 104 18571 0.14% 105 19867 0.15% 106 20519 0.15% 107 21205 0.16% 108 21524 0.16% 109 22072 0.16% 110 23170 0.17% 111 23648 0.17% 112 24940 0.18% 113 25918 0.19% 114 27314 0.20% 115 28700 0.21% 116 29148 0.21% 117 29846 0.22% 118 31065 0.23% 119 31298 0.23% 120 31941 0.24% 121 33046 0.24% 122 34479 0.25% 123 35841 0.26% 124 37125 0.27% 125 39019 0.29% 126 40632 0.30% 127 41531 0.31% 128 42707 0.31% 129 43934 0.32% 130 45321 0.33% 131 46783 0.34% 132 48706 0.36% 133 51102 0.38% 134 53925 0.40% 135 56318 0.41% 136 59313 0.44% 137 63078 0.46% 138 68269 0.50% 139 73030 0.54% 140 76717 0.56% 141 83250 0.61% 142 90549 0.67% 143 98206 0.72% 144 109998 0.81% 145 125873 0.93% 146 152242 1.12% 147 192868 1.42% 148 283953 2.09% 149 543709 4.00% 150 3036696 22.34% 151 7193390 52.93% 13590926 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=36 prefix-density=0.26 prefix-fanout=2.2 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGCTACT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=238.31 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.7 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTATTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=49.06 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=12.0 sequence=TCAAGGAAGCTTTCAG SRR7170009 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:55:24 Started mapping on | Feb 12 10:55:24 Finished on | Feb 12 10:56:41 Mapping speed, Million of reads per hour | 635.42 Number of input reads | 13590926 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12786009 Uniquely mapped reads % | 94.08% Average mapped length | 292.48 Number of splices: Total | 11641216 Number of splices: Annotated (sjdb) | 11447593 Number of splices: GT/AG | 11480771 Number of splices: GC/AG | 127786 Number of splices: AT/AC | 9370 Number of splices: Non-canonical | 23289 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236405 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 89261 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 586326 586326 586326 N_multimapping 236405 236405 236405 N_noFeature 285869 12616139 363049 N_ambiguous 144159 1139 50542 UnstrandedReadsAssigned:12355981 PositiveStrandReadsAssigned:168731 NegativeStrandReadsAssigned:12372418 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170009 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170009-trimmed-pair1.fastq SRR7170009-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,590,926 reads, 12,350,945 reads pseudoaligned [quant] estimated average fragment length: 231.493 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR7170009.ke.tsv 34699 SRR7170009.se.tsv 87100 total ==> SRR7170009.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.51 177.439 8.41965 Potri.005G024800.1.v4.1 1035 804.507 17 1.7923 Potri.004G059700.1.v4.1 961 730.555 2 0.232203 Potri.007G009000.2.v4.1 1416 1185.51 0 0 Potri.003G141000.2.v4.1 2943 2712.51 219.03 6.84897 Potri.016G087400.1.v4.1 270 85.5837 999.184 990.253 Potri.015G069301.1.v4.1 564 338.387 0 0 Potri.010G195200.1.v4.1 1773 1542.51 11 0.604863 Potri.012G127500.1.v4.1 977 746.531 2537 288.246 ==> SRR7170009.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1524 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170009 completed mapping pipeline successfully