Starting /dee2/code/volunteer_pipeline.sh SRR7170010 current disk space = 3049599168512 free memory = 1297117972 SRR7170010 SRAfilesize 1e182e47fec88573412e5bd46e2f6789 SRR7170010.sra SRR7170010.sra file validated SRR7170010 is paired end SRR7170010 is conventional basespace SRR7170010 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170010_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.085 34.0 34.0 34.0 33.0 34.0 2 33.561 34.0 34.0 34.0 33.0 34.0 3 33.587 34.0 34.0 34.0 33.0 34.0 4 33.61875 34.0 34.0 34.0 33.0 34.0 5 33.598 34.0 34.0 34.0 33.0 34.0 6 37.423 38.0 38.0 38.0 37.0 38.0 7 37.58875 38.0 38.0 38.0 38.0 38.0 8 37.643 38.0 38.0 38.0 38.0 38.0 9 37.63725 38.0 38.0 38.0 38.0 38.0 10-14 37.662349999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.6629 38.0 38.0 38.0 38.0 38.0 20-24 37.66205 38.0 38.0 38.0 38.0 38.0 25-29 37.61715 38.0 38.0 38.0 38.0 38.0 30-34 37.627500000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.552200000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.38925 38.0 38.0 38.0 37.2 38.0 45-49 37.21515 38.0 38.0 38.0 37.0 38.0 50-54 37.3115 38.0 38.0 38.0 37.0 38.0 55-59 37.28095 38.0 38.0 38.0 37.0 38.0 60-64 37.267100000000006 38.0 38.0 38.0 37.0 38.0 65-69 37.20725 38.0 38.0 38.0 36.6 38.0 70-74 37.11925 38.0 38.0 38.0 36.0 38.0 75-79 37.046749999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.998 38.0 38.0 38.0 36.0 38.0 85-89 36.73285 38.0 38.0 38.0 35.4 38.0 90-94 36.57005 38.0 38.0 38.0 35.2 38.0 95-99 36.387699999999995 38.0 38.0 38.0 34.6 38.0 100-104 36.522549999999995 38.0 38.0 38.0 34.2 38.0 105-109 36.491200000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.280649999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.075599999999994 38.0 37.4 38.0 33.2 38.0 120-124 35.95465 38.0 37.0 38.0 33.0 38.0 125-129 35.5652 38.0 36.4 38.0 31.4 38.0 130-134 35.19275 38.0 36.0 38.0 30.0 38.0 135-139 34.65545 38.0 35.2 38.0 27.4 38.0 140-144 34.57254999999999 38.0 35.4 38.0 27.6 38.0 145-149 33.75125 38.0 35.0 38.0 21.4 38.0 150-151 30.339750000000002 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 2.0 12 1.0 13 2.0 14 2.0 15 5.0 16 3.0 17 2.0 18 2.0 19 3.0 20 2.0 21 7.0 22 7.0 23 5.0 24 8.0 25 16.0 26 12.0 27 21.0 28 27.0 29 24.0 30 39.0 31 42.0 32 62.0 33 79.0 34 108.0 35 228.0 36 577.0 37 2712.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.44853875476493 12.376111817026683 10.241423125794155 35.933926302414235 2 23.625 14.7 33.650000000000006 28.025 3 19.275000000000002 20.625 25.45 34.65 4 22.650000000000002 28.375 23.75 25.224999999999998 5 21.9 32.775 24.25 21.075 6 20.625 34.325 24.75 20.3 7 13.625000000000002 27.200000000000003 41.225 17.95 8 19.35 26.075 29.5 25.074999999999996 9 17.974999999999998 24.775 33.525 23.724999999999998 10-14 20.31 29.465000000000003 26.915 23.31 15-19 20.055 28.105000000000004 28.07 23.77 20-24 19.73 28.535 28.165000000000003 23.57 25-29 19.994999999999997 28.625 27.575 23.805 30-34 20.04 28.415000000000003 27.46 24.085 35-39 19.68 28.28 27.26 24.779999999999998 40-44 20.263105242096838 28.511404561824733 27.300920368147256 23.924569827931172 45-49 20.141466840573894 27.992374836961975 27.596067021169862 24.270091301294272 50-54 20.14 28.634999999999998 27.245 23.98 55-59 20.395 28.32 27.315 23.97 60-64 20.555 27.98 27.525 23.94 65-69 20.855 28.63 27.04 23.474999999999998 70-74 20.27 28.000000000000004 27.955000000000002 23.775 75-79 20.23 28.98 26.695 24.095 80-84 20.02 27.98 27.800000000000004 24.2 85-89 20.207591636163063 28.25051396479968 27.458256029684602 24.083638369352656 90-94 20.38800705467372 28.455530360292265 26.85815066767448 24.298311917359534 95-99 20.369249394673123 27.502017756255043 27.653349475383376 24.47538337368846 100-104 20.379740493963226 28.37533189719954 27.553729773057462 23.69119783577977 105-109 20.865000000000002 27.625 27.615000000000002 23.895 110-114 20.479815686667337 28.162876890714216 26.94580787338475 24.4114995492337 115-119 20.75207520752075 28.71287128712871 27.057705770577055 23.477347734773478 120-124 20.685000000000002 28.87 26.365 24.08 125-129 20.724999999999998 28.34 26.795 24.14 130-134 21.357665697382934 27.589491627393965 27.238544068986265 23.81429860623684 135-139 21.229809288985056 27.65561314346098 27.197705429477182 23.916872138076787 140-144 20.993726474278546 28.05520702634881 27.473023839397744 23.478042659974907 145-149 21.215309087265805 28.233643923454565 26.685702835387236 23.865344153892394 150-151 20.2625 29.425 26.4125 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 0.0 24 1.5 25 4.0 26 4.5 27 7.5 28 10.0 29 11.0 30 14.5 31 23.5 32 27.5 33 27.5 34 44.5 35 60.0 36 77.0 37 103.5 38 133.5 39 156.0 40 183.5 41 219.5 42 238.5 43 249.0 44 270.5 45 285.5 46 270.0 47 251.0 48 225.0 49 203.5 50 185.0 51 150.0 52 123.5 53 100.5 54 85.5 55 70.0 56 42.0 57 30.5 58 25.0 59 17.5 60 16.0 61 13.0 62 7.5 63 7.0 64 6.0 65 2.5 66 2.5 67 1.0 68 1.0 69 3.0 70 2.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.04 45-49 0.33 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.28500000000000003 90-94 0.775 95-99 0.88 100-104 0.19499999999999998 105-109 0.0 110-114 0.16999999999999998 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.27 135-139 0.635 140-144 0.375 145-149 0.19 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.225 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170010 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170010_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.25725 33.0 33.0 34.0 32.0 34.0 2 32.37775 34.0 33.0 34.0 32.0 34.0 3 32.3995 34.0 33.0 34.0 32.0 34.0 4 32.17025 34.0 33.0 34.0 32.0 34.0 5 32.1745 34.0 33.0 34.0 32.0 34.0 6 36.38875 38.0 38.0 38.0 36.0 38.0 7 36.3755 38.0 38.0 38.0 36.0 38.0 8 36.41725 38.0 38.0 38.0 36.0 38.0 9 36.4205 38.0 38.0 38.0 37.0 38.0 10-14 36.340999999999994 38.0 38.0 38.0 36.8 38.0 15-19 36.16925 38.0 38.0 38.0 36.2 38.0 20-24 36.2839 38.0 38.0 38.0 36.6 38.0 25-29 36.318 38.0 38.0 38.0 37.0 38.0 30-34 36.32765 38.0 38.0 38.0 37.0 38.0 35-39 36.289049999999996 38.0 38.0 38.0 36.6 38.0 40-44 36.1746 38.0 38.0 38.0 36.2 38.0 45-49 36.0867 38.0 38.0 38.0 36.0 38.0 50-54 36.2433 38.0 38.0 38.0 36.0 38.0 55-59 36.24645 38.0 38.0 38.0 36.0 38.0 60-64 36.201800000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.165549999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.10825 38.0 38.0 38.0 35.6 38.0 75-79 36.03099999999999 38.0 38.0 38.0 35.0 38.0 80-84 35.915800000000004 38.0 38.0 38.0 34.6 38.0 85-89 35.662099999999995 38.0 38.0 38.0 34.0 38.0 90-94 35.382549999999995 38.0 38.0 38.0 33.0 38.0 95-99 35.62755 38.0 38.0 38.0 33.4 38.0 100-104 35.5422 38.0 38.0 38.0 33.0 38.0 105-109 35.408 38.0 38.0 38.0 33.0 38.0 110-114 35.269400000000005 38.0 38.0 38.0 31.6 38.0 115-119 35.0835 38.0 38.0 38.0 31.0 38.0 120-124 34.84215 38.0 37.6 38.0 27.8 38.0 125-129 34.472699999999996 38.0 36.6 38.0 25.6 38.0 130-134 33.7704 38.0 36.0 38.0 17.6 38.0 135-139 32.8798 38.0 35.0 38.0 11.2 38.0 140-144 32.08175 38.0 33.0 38.0 2.0 38.0 145-149 31.57605 38.0 33.2 38.0 2.0 38.0 150-151 27.749375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 97.0 3 13.0 4 1.0 5 1.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 1.0 13 2.0 14 3.0 15 5.0 16 9.0 17 4.0 18 10.0 19 4.0 20 6.0 21 8.0 22 11.0 23 14.0 24 12.0 25 17.0 26 23.0 27 35.0 28 24.0 29 33.0 30 38.0 31 68.0 32 79.0 33 107.0 34 143.0 35 167.0 36 397.0 37 2662.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.132634807053414 22.719141323792485 13.851265014055711 26.29695885509839 2 26.949453898907798 26.61925323850648 29.87045974091948 16.560833121666242 3 20.799389002036662 28.5132382892057 31.008146639511203 19.679226069246436 4 23.001799023387303 34.69545104086353 23.515805705474172 18.786944230274994 5 24.11311053984576 36.29820051413882 22.005141388174806 17.583547557840618 6 20.96650473024802 37.89312196369215 23.21656865251854 17.923804653541296 7 20.8130912810023 22.654052671950907 36.89593454359499 19.636921503451802 8 21.978021978021978 25.274725274725274 26.73140812675696 26.01584462049578 9 20.8130912810023 24.904116594221428 28.841728458194837 25.44106366658144 10-14 23.766080672441188 28.665880785198095 26.082722566757216 21.485315975603505 15-19 23.037323037323038 27.788931788931787 27.63963963963964 21.534105534105535 20-24 23.165666820489157 27.770086653335387 27.18043377941855 21.88381274675691 25-29 22.938976277091765 27.893631193318647 27.493979607521645 21.673412922067943 30-34 23.216116465039985 28.42423621078532 27.296493746155427 21.063153578019275 35-39 22.978592330201757 28.025052620771085 27.619487653370296 21.376867395656863 40-44 24.048808114091543 27.82783298151676 26.931987849456828 21.19137105493487 45-49 23.132790769547746 28.041619449881527 27.24837745956526 21.577212321005458 50-54 23.348536872853995 28.00696971249936 27.69948239635115 20.945011018295496 55-59 23.279175849520783 28.10209625339552 27.497309210189126 21.12141868689457 60-64 23.262607626076264 27.593275932759326 28.14678146781468 20.997334973349734 65-69 22.941928882067025 27.654131491430036 28.222051675620364 21.181887950882576 70-74 23.63673427785139 27.387626133931303 27.71888696361227 21.256752624605035 75-79 23.96268732796411 26.888571719849118 28.07625649913345 21.07248445305332 80-84 24.059765644987976 27.77465077009671 27.28342629074349 20.882157294171826 85-89 23.602709270461713 26.95310480326767 28.35427330541337 21.089912620857245 90-94 24.0729199127454 27.42806689519061 27.303417471694193 21.19559572036979 95-99 23.60997127615921 27.92880590890439 27.826220763233483 20.635002051702912 100-104 24.40421397156592 28.342027206709623 27.043060243428457 20.210698578296 105-109 24.521033437772868 27.443628332220456 27.2022189121167 20.833119317889977 110-114 24.35265104808878 27.666461159062884 27.594533497739416 20.38635429510892 115-119 24.627820125850512 28.23962756433212 26.919731928173118 20.212820381644242 120-124 24.94015788133435 27.858416093710208 26.824548001018588 20.376878023936847 125-129 24.226034100860247 28.34183279245866 26.46680059753773 20.96533250914336 130-134 24.535648513549067 28.018942383583266 26.887661141804784 20.557747961062876 135-139 24.32417964777046 28.173010010170763 27.05422621915315 20.448584122905626 140-144 25.45119505717847 28.144815999132838 26.909110617310716 19.49487832637797 145-149 25.394404711821622 28.19204880100968 26.777450567942786 19.636095919225916 150-151 25.164537359659313 28.777906826687317 25.964640598786943 20.092915214866434 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 68.0 1 36.0 2 3.5 3 3.0 4 2.5 5 1.5 6 2.0 7 2.0 8 1.5 9 1.5 10 1.5 11 1.0 12 0.5 13 1.5 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 1.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 3.0 27 6.0 28 6.0 29 3.5 30 5.5 31 11.0 32 16.0 33 25.0 34 37.5 35 52.5 36 61.5 37 84.5 38 128.5 39 153.0 40 191.5 41 222.0 42 248.5 43 259.0 44 269.5 45 300.0 46 291.5 47 259.0 48 235.0 49 208.5 50 168.0 51 151.0 52 126.0 53 91.5 54 74.5 55 54.0 56 40.5 57 34.0 58 22.5 59 13.5 60 10.0 61 9.0 62 5.0 63 5.5 64 4.0 65 2.0 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.175 2 1.575 3 1.7999999999999998 4 2.725 5 2.75 6 2.225 7 2.225 8 2.175 9 2.225 10-14 2.445 15-19 2.875 20-24 2.485 25-29 2.415 30-34 2.46 35-39 2.605 40-44 2.8850000000000002 45-49 2.93 50-54 2.435 55-59 2.445 60-64 2.44 65-69 2.275 70-74 1.8900000000000001 75-79 1.91 80-84 2.2849999999999997 85-89 3.295 90-94 3.73 95-99 2.52 100-104 2.23 105-109 2.6550000000000002 110-114 2.68 115-119 2.265 120-124 1.825 125-129 2.935 130-134 4.9750000000000005 135-139 6.595 140-144 7.745 145-149 4.92 150-151 3.1375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.43748401943236 97.225 2 0.4091025313219126 0.8 3 0.10227563283047815 0.3 4 0.025568908207619537 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025568908207619537 1.575 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 63 1.575 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.1375 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGCC 10 0.0068531362 144.79486 2 >>END_MODULE Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra Read 620863 spots for SRR7170010.sra Written 620863 spots for SRR7170010.sra SRR ids: ['SRR7170010.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dc19a407 SRR7170010.sra spots: 12417260 blocks: [[1, 620863], [620864, 1241726], [1241727, 1862589], [1862590, 2483452], [2483453, 3104315], [3104316, 3725178], [3725179, 4346041], [4346042, 4966904], [4966905, 5587767], [5587768, 6208630], [6208631, 6829493], [6829494, 7450356], [7450357, 8071219], [8071220, 8692082], [8692083, 9312945], [9312946, 9933808], [9933809, 10554671], [10554672, 11175534], [11175535, 11796397], [11796398, 12417260]] SRR7170010 file size 4186101 SRR7170010 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170010 SRR7170010_1.fastq SRR7170010_2.fastq Input file: SRR7170010_1.fastq Paired file: SRR7170010_2.fastq trimmed: SRR7170010-trimmed-pair1.fastq, SRR7170010-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:23:19 2025 >> started Wed Feb 12 09:23:34 2025 >> done (14.024s) 12417260 read pairs processed; of these: 16384 ( 0.13%) short read pairs filtered out after trimming by size control 28237 ( 0.23%) empty read pairs filtered out after trimming by size control 12372639 (99.64%) read pairs available; of these: 5627927 (45.49%) trimmed read pairs available after processing 6744712 (54.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 8 0.00% 22 1 0.00% 23 6 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 5 0.00% 29 3 0.00% 30 6 0.00% 31 5 0.00% 32 11 0.00% 33 12 0.00% 34 12 0.00% 35 23 0.00% 36 20 0.00% 37 9 0.00% 38 21 0.00% 39 22 0.00% 40 18 0.00% 41 25 0.00% 42 20 0.00% 43 33 0.00% 44 34 0.00% 45 37 0.00% 46 38 0.00% 47 29 0.00% 48 52 0.00% 49 54 0.00% 50 50 0.00% 51 62 0.00% 52 90 0.00% 53 86 0.00% 54 75 0.00% 55 84 0.00% 56 93 0.00% 57 103 0.00% 58 148 0.00% 59 134 0.00% 60 165 0.00% 61 229 0.00% 62 248 0.00% 63 231 0.00% 64 279 0.00% 65 324 0.00% 66 362 0.00% 67 378 0.00% 68 411 0.00% 69 584 0.00% 70 708 0.01% 71 734 0.01% 72 785 0.01% 73 882 0.01% 74 952 0.01% 75 1127 0.01% 76 1133 0.01% 77 1228 0.01% 78 1341 0.01% 79 1548 0.01% 80 1749 0.01% 81 2001 0.02% 82 2411 0.02% 83 2689 0.02% 84 3499 0.03% 85 4207 0.03% 86 4323 0.03% 87 4611 0.04% 88 4982 0.04% 89 5188 0.04% 90 5518 0.04% 91 6035 0.05% 92 6459 0.05% 93 7092 0.06% 94 7389 0.06% 95 8069 0.07% 96 8273 0.07% 97 8773 0.07% 98 9356 0.08% 99 9658 0.08% 100 10039 0.08% 101 10686 0.09% 102 11413 0.09% 103 12216 0.10% 104 13107 0.11% 105 13854 0.11% 106 14441 0.12% 107 14986 0.12% 108 15318 0.12% 109 15815 0.13% 110 16048 0.13% 111 16921 0.14% 112 18058 0.15% 113 18756 0.15% 114 19885 0.16% 115 21232 0.17% 116 21533 0.17% 117 22415 0.18% 118 22826 0.18% 119 23161 0.19% 120 23980 0.19% 121 24653 0.20% 122 25553 0.21% 123 27125 0.22% 124 28535 0.23% 125 30075 0.24% 126 30934 0.25% 127 31933 0.26% 128 32500 0.26% 129 33787 0.27% 130 35240 0.28% 131 36726 0.30% 132 38400 0.31% 133 40238 0.33% 134 42844 0.35% 135 45541 0.37% 136 48547 0.39% 137 51868 0.42% 138 56133 0.45% 139 60682 0.49% 140 64957 0.53% 141 70469 0.57% 142 76773 0.62% 143 84807 0.69% 144 95919 0.78% 145 110978 0.90% 146 136499 1.10% 147 174980 1.41% 148 261632 2.11% 149 507542 4.10% 150 2837986 22.94% 151 6744712 54.51% 12372639 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=44 prefix-density=0.15 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=268.26 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=29.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=22 prefix-density=0.41 prefix-fanout=3.1 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=248.08 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=26.9 sequence=GAAGAAGAAGAAA SRR7170010 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:24:16 Started mapping on | Feb 12 09:24:16 Finished on | Feb 12 09:25:22 Mapping speed, Million of reads per hour | 674.87 Number of input reads | 12372639 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11780647 Uniquely mapped reads % | 95.22% Average mapped length | 294.04 Number of splices: Total | 11629333 Number of splices: Annotated (sjdb) | 11440034 Number of splices: GT/AG | 11456186 Number of splices: GC/AG | 139630 Number of splices: AT/AC | 9190 Number of splices: Non-canonical | 24327 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226758 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 25575 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 379284 379284 379284 N_multimapping 226758 226758 226758 N_noFeature 220135 11652036 282639 N_ambiguous 112608 669 46063 UnstrandedReadsAssigned:11447904 PositiveStrandReadsAssigned:127942 NegativeStrandReadsAssigned:11451945 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170010 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170010-trimmed-pair1.fastq SRR7170010-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,372,639 reads, 11,377,400 reads pseudoaligned [quant] estimated average fragment length: 245.859 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7170010.ke.tsv 34699 SRR7170010.se.tsv 87100 total ==> SRR7170010.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.14 268 13.4697 Potri.005G024800.1.v4.1 1035 790.141 25 2.81969 Potri.004G059700.1.v4.1 961 716.184 7 0.871042 Potri.007G009000.2.v4.1 1416 1171.14 0 0 Potri.003G141000.2.v4.1 2943 2698.14 232.153 7.66787 Potri.016G087400.1.v4.1 270 80.8291 934 1029.78 Potri.015G069301.1.v4.1 564 325.53 0 0 Potri.010G195200.1.v4.1 1773 1528.14 8 0.466543 Potri.012G127500.1.v4.1 977 732.175 4355 530.077 ==> SRR7170010.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 530 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170010 completed mapping pipeline successfully