Starting /dee2/code/volunteer_pipeline.sh SRR7170011 current disk space = 3049587372032 free memory = 1436544420 SRR7170011 SRAfilesize dd466c41a2f82510de3504a3d9f2baf0 SRR7170011.sra SRR7170011.sra file validated SRR7170011 is paired end SRR7170011 is conventional basespace SRR7170011 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170011_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73425 34.0 33.0 34.0 33.0 34.0 2 33.41575 34.0 34.0 34.0 33.0 34.0 3 33.55 34.0 34.0 34.0 33.0 34.0 4 33.5845 34.0 34.0 34.0 33.0 34.0 5 33.44075 34.0 34.0 34.0 33.0 34.0 6 37.24925 38.0 38.0 38.0 36.0 38.0 7 37.5205 38.0 38.0 38.0 37.0 38.0 8 37.6565 38.0 38.0 38.0 38.0 38.0 9 37.6785 38.0 38.0 38.0 38.0 38.0 10-14 37.648199999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.63785 38.0 38.0 38.0 38.0 38.0 20-24 37.579950000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.481399999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.4882 38.0 38.0 38.0 38.0 38.0 35-39 37.3655 38.0 38.0 38.0 37.4 38.0 40-44 37.26745 38.0 38.0 38.0 37.0 38.0 45-49 37.09785 38.0 38.0 38.0 36.4 38.0 50-54 37.1068 38.0 38.0 38.0 36.6 38.0 55-59 37.0112 38.0 38.0 38.0 36.2 38.0 60-64 37.0032 38.0 38.0 38.0 36.0 38.0 65-69 36.973650000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.8758 38.0 38.0 38.0 36.0 38.0 75-79 36.59155 38.0 38.0 38.0 34.6 38.0 80-84 36.452099999999994 38.0 38.0 38.0 34.4 38.0 85-89 36.31295 38.0 38.0 38.0 34.0 38.0 90-94 36.10894999999999 38.0 38.0 38.0 34.0 38.0 95-99 35.890049999999995 38.0 38.0 38.0 33.6 38.0 100-104 35.785000000000004 38.0 37.6 38.0 32.0 38.0 105-109 35.64319999999999 38.0 37.2 38.0 30.6 38.0 110-114 35.50225 38.0 37.0 38.0 30.6 38.0 115-119 35.2955 38.0 36.8 38.0 29.4 38.0 120-124 35.4091 38.0 37.0 38.0 30.6 38.0 125-129 35.1385 38.0 36.2 38.0 29.4 38.0 130-134 34.5513 38.0 35.8 38.0 26.0 38.0 135-139 33.758849999999995 38.0 35.0 38.0 19.8 38.0 140-144 33.713 38.0 35.0 38.0 21.0 38.0 145-149 33.06855 38.0 34.2 38.0 17.0 38.0 150-151 29.057375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 2.0 13 2.0 14 3.0 15 2.0 16 4.0 17 5.0 18 7.0 19 9.0 20 11.0 21 5.0 22 10.0 23 23.0 24 22.0 25 21.0 26 21.0 27 27.0 28 33.0 29 39.0 30 35.0 31 52.0 32 75.0 33 98.0 34 131.0 35 237.0 36 527.0 37 2593.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.72916132341626 14.003590664272892 9.233136701718388 33.034111310592465 2 23.474999999999998 13.925 31.15 31.45 3 20.4 18.125 25.374999999999996 36.1 4 21.575 25.8 24.2 28.425 5 23.875 30.349999999999998 22.900000000000002 22.875 6 19.375 34.9 24.175 21.55 7 15.15 29.049999999999997 37.95 17.849999999999998 8 15.8 29.049999999999997 31.674999999999997 23.474999999999998 9 17.849999999999998 25.275 33.7 23.175 10-14 19.555 30.409999999999997 27.245 22.79 15-19 19.73 29.104999999999997 28.005000000000003 23.16 20-24 20.035 29.794999999999998 26.755000000000003 23.415 25-29 19.814999999999998 29.630000000000003 27.04 23.515 30-34 19.42 29.665000000000003 27.01 23.905 35-39 19.74 29.345 26.875 24.04 40-44 19.945 29.225 27.18 23.65 45-49 19.958971279895927 29.410587411187834 26.76873811668168 23.861703192234565 50-54 20.3 29.080000000000002 26.86 23.76 55-59 20.39 28.79 26.91 23.91 60-64 20.11 29.125 26.939999999999998 23.825 65-69 20.3 29.275000000000002 26.565 23.86 70-74 20.29 29.220000000000002 26.889999999999997 23.599999999999998 75-79 20.54 28.485 26.939999999999998 24.035 80-84 20.275000000000002 28.26 26.765 24.7 85-89 20.368608203535835 28.54209445585216 27.320078128912705 23.769219211699305 90-94 21.00458923798477 28.473447980230976 26.395683090423116 24.126279691361137 95-99 20.536750239620645 28.512334157292035 27.674923069162084 23.275992533925237 100-104 20.921382073109665 28.718077115673513 26.795192789183776 23.56534802203305 105-109 20.936046802340115 28.196409820491024 26.811340567028353 24.056202810140505 110-114 20.919999999999998 28.439999999999998 26.69 23.95 115-119 20.65603280164008 28.441422071103556 26.836341817090855 24.066203310165506 120-124 20.965 27.505000000000003 27.065 24.465 125-129 20.426127838351505 28.4185255576673 26.678003401020305 24.47734320296089 130-134 21.23654568210263 28.195244055068834 26.623279098873592 23.944931163954944 135-139 21.00392314656473 27.688361331857962 27.255809274720853 24.051906246856454 140-144 20.72798277674861 28.10794572673109 26.60091123016072 24.563160266359585 145-149 20.659087494365703 28.311714328642264 26.223268392848198 24.80592978414384 150-151 20.4125 27.5875 26.35 25.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 2.5 24 1.5 25 3.0 26 4.5 27 9.0 28 16.0 29 19.5 30 23.0 31 24.5 32 32.5 33 50.0 34 67.5 35 79.5 36 93.0 37 111.5 38 129.5 39 139.0 40 156.5 41 200.5 42 238.0 43 249.5 44 257.5 45 256.5 46 249.5 47 240.5 48 230.5 49 209.5 50 179.0 51 158.0 52 126.5 53 106.0 54 80.5 55 56.5 56 49.5 57 35.5 58 24.5 59 19.0 60 15.0 61 9.5 62 7.5 63 5.5 64 3.0 65 5.5 66 5.0 67 3.0 68 4.0 69 3.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.06999999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.165 90-94 0.855 95-99 0.885 100-104 0.15 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.03 130-134 0.125 135-139 0.59 140-144 0.135 145-149 0.165 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96123638206232 97.65 2 0.9374208259437548 1.8499999999999999 3 0.05067139599695972 0.15 4 0.02533569799847986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02533569799847986 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 10 0.25 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.85 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.5375 0.0 0.0 0.0 0.0 118-119 4.949999999999999 0.0 0.0 0.0 0.0 120-121 5.5125 0.0 0.0 0.0 0.0 122-123 5.9625 0.0 0.0 0.0 0.0 124-125 6.575 0.0 0.0 0.0 0.0 126-127 7.1375 0.0 0.0 0.0 0.0 128-129 7.75 0.0 0.0 0.0 0.0 130-131 8.4 0.0 0.0 0.0 0.0 132-133 9.0625 0.0 0.0 0.0 0.0 134-135 9.6875 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 10.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACTGG 10 0.006925002 144.3375 5 GGAACTG 10 0.006925002 144.3375 4 >>END_MODULE SRR7170011 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170011_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.55475 33.0 33.0 34.0 31.0 34.0 2 31.9565 34.0 33.0 34.0 31.0 34.0 3 31.9435 34.0 33.0 34.0 31.0 34.0 4 31.73775 34.0 33.0 34.0 32.0 34.0 5 31.6755 34.0 33.0 34.0 31.0 34.0 6 35.6075 38.0 38.0 38.0 34.0 38.0 7 35.897 38.0 38.0 38.0 35.0 38.0 8 35.908 38.0 38.0 38.0 35.0 38.0 9 35.88 38.0 38.0 38.0 35.0 38.0 10-14 35.78035 38.0 38.0 38.0 34.8 38.0 15-19 35.6171 38.0 38.0 38.0 34.4 38.0 20-24 35.716950000000004 38.0 38.0 38.0 34.4 38.0 25-29 35.88495 38.0 38.0 38.0 35.6 38.0 30-34 35.911350000000006 38.0 38.0 38.0 36.0 38.0 35-39 35.7832 38.0 38.0 38.0 35.2 38.0 40-44 35.6349 38.0 38.0 38.0 35.2 38.0 45-49 35.513799999999996 38.0 38.0 38.0 34.0 38.0 50-54 35.6802 38.0 38.0 38.0 34.4 38.0 55-59 35.70495 38.0 38.0 38.0 34.6 38.0 60-64 35.70485 38.0 38.0 38.0 34.4 38.0 65-69 35.6957 38.0 38.0 38.0 34.2 38.0 70-74 35.6305 38.0 38.0 38.0 34.4 38.0 75-79 35.54085 38.0 38.0 38.0 34.0 38.0 80-84 35.4862 38.0 38.0 38.0 33.6 38.0 85-89 35.0519 38.0 38.0 38.0 31.4 38.0 90-94 34.69160000000001 38.0 38.0 38.0 28.6 38.0 95-99 35.0316 38.0 38.0 38.0 29.0 38.0 100-104 35.196000000000005 38.0 38.0 38.0 32.6 38.0 105-109 35.0809 38.0 38.0 38.0 31.0 38.0 110-114 34.9466 38.0 38.0 38.0 29.8 38.0 115-119 34.69755 38.0 38.0 38.0 27.8 38.0 120-124 34.5359 38.0 37.2 38.0 26.6 38.0 125-129 34.10975 38.0 36.4 38.0 21.0 38.0 130-134 32.89495 38.0 35.4 38.0 11.0 38.0 135-139 32.124750000000006 38.0 34.8 38.0 2.0 38.0 140-144 31.29855 38.0 34.0 38.0 2.0 38.0 145-149 30.64855 38.0 32.2 38.0 2.0 38.0 150-151 26.99825 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 139.0 3 7.0 4 3.0 5 4.0 6 2.0 7 1.0 8 3.0 9 1.0 10 1.0 11 0.0 12 4.0 13 4.0 14 7.0 15 4.0 16 5.0 17 14.0 18 6.0 19 5.0 20 12.0 21 11.0 22 11.0 23 18.0 24 14.0 25 28.0 26 24.0 27 23.0 28 21.0 29 45.0 30 52.0 31 53.0 32 92.0 33 99.0 34 132.0 35 159.0 36 381.0 37 2615.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.8380355276907 22.387669801462906 13.061650992685475 24.71264367816092 2 26.749809111733263 28.709595316874527 26.597098498345634 17.943497073046576 3 20.49243395742498 30.571941523467554 30.341113105924595 18.594511413182868 4 25.077962577962577 33.65384615384615 22.375259875259875 18.89293139293139 5 26.793634229063397 35.977041481867985 19.671275763109836 17.55804852595878 6 22.952950350922798 36.54795944892123 22.848973225890305 17.65011697426566 7 21.834625322997418 21.963824289405682 36.35658914728682 19.844961240310077 8 22.35142118863049 26.149870801033593 26.589147286821706 24.90956072351421 9 22.42798353909465 26.414609053497944 28.266460905349795 22.890946502057613 10-14 24.460916442048518 28.79431888865851 25.15032137673647 21.5944432925565 15-19 24.13864890184241 28.33350681794525 26.668054543561986 20.85978973665036 20-24 24.21210864607091 27.949409081484553 26.99046236782086 20.848019904623676 25-29 24.359569094376578 28.730477810422144 26.59656718725839 20.31338590794289 30-34 24.023266587738714 28.367735625675607 26.864672877953367 20.744324908632315 35-39 24.753140671043788 27.78266039394096 26.60393940960554 20.86025952540971 40-44 24.113548923780805 28.127274617864202 26.468753249454092 21.290423208900904 45-49 24.24053266749896 27.720557636287975 26.841448189762794 21.19746150645027 50-54 23.94999225086532 28.620137417988325 26.522704964612288 20.90716536653407 55-59 23.948755036677344 27.952267796259946 27.151565244343423 20.94741192271929 60-64 23.83636739760033 27.973727761688043 27.332436905254447 20.857467935457176 65-69 24.435857805255022 27.89283874291602 27.202472952086552 20.468830499742403 70-74 24.255166401722988 27.844725911491718 27.219116968360595 20.680990718424695 75-79 23.991583701118753 27.476136713537926 27.6968079646926 20.835471620650722 80-84 23.882667214630636 27.771499023939178 28.084865920065756 20.26096784136443 85-89 24.32983226211005 27.648011705073937 27.38151225374928 20.640643779066732 90-94 24.64881359499132 27.49513337191561 27.1794601988741 20.676592834218972 95-99 24.670763827919227 27.526726230439497 27.154883024324743 20.64762691731653 100-104 24.04939542063288 27.460766658091075 28.160535117056856 20.329302804219193 105-109 25.06190672719769 27.388567891044158 27.269913330581925 20.279612051176226 110-114 25.14725638110985 27.937377286349076 26.95050118838483 19.964865144156246 115-119 25.109002308284172 27.94562708386766 26.68376506796615 20.261605539882023 120-124 25.014058585961862 28.761310771432953 26.40969275599407 19.814937886611116 125-129 24.95976742978768 28.2354773399782 26.859783003685823 19.944972226548305 130-134 25.338398159542024 28.56989995184848 26.162324113209568 19.929377775399924 135-139 25.336383940731054 27.40099144740426 26.970637903796916 20.291986708067768 140-144 25.770122557138126 27.812741525891578 26.741746715247878 19.675389201722425 145-149 26.753260637160576 27.950609364977552 26.19200342099636 19.104126576865514 150-151 26.195128305327604 28.34440536667969 26.32538752116712 19.135078806825582 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 78.0 1 47.5 2 10.0 3 2.5 4 2.5 5 2.0 6 2.0 7 2.0 8 2.5 9 2.0 10 0.5 11 1.0 12 1.0 13 0.5 14 1.0 15 2.0 16 2.0 17 3.0 18 3.0 19 1.5 20 2.0 21 1.5 22 1.5 23 3.0 24 2.0 25 3.0 26 4.0 27 4.0 28 6.5 29 6.5 30 7.0 31 10.5 32 13.0 33 16.5 34 26.5 35 48.5 36 61.0 37 73.5 38 106.0 39 139.0 40 172.5 41 219.5 42 253.0 43 261.5 44 274.0 45 263.5 46 274.0 47 285.0 48 248.0 49 217.5 50 186.5 51 152.0 52 126.5 53 102.5 54 70.0 55 54.0 56 46.0 57 27.0 58 19.5 59 21.0 60 17.5 61 12.0 62 8.0 63 6.0 64 3.5 65 0.5 66 2.5 67 4.0 68 2.5 69 2.5 70 1.5 71 0.0 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.3 2 1.775 3 2.5250000000000004 4 3.8 5 4.175 6 3.8249999999999997 7 3.25 8 3.25 9 2.8000000000000003 10-14 3.54 15-19 3.93 20-24 3.54 25-29 2.995 30-34 2.8649999999999998 35-39 3.2849999999999997 40-44 3.83 45-49 3.88 50-54 3.215 55-59 3.2099999999999995 60-64 3.32 65-69 2.9499999999999997 70-74 2.495 75-79 2.5700000000000003 80-84 2.67 85-89 4.315 90-94 4.965 95-99 3.1850000000000005 100-104 2.825 105-109 3.08 110-114 3.2300000000000004 115-119 2.5250000000000004 120-124 2.1950000000000003 125-129 3.685 130-134 6.544999999999999 135-139 8.215 140-144 9.43 145-149 6.460000000000001 150-151 4.0375000000000005 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.525 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96399896399896 95.525 2 0.8806008806008805 1.7000000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0259000259000259 0.125 6 0.0 0.0 7 0.0259000259000259 0.17500000000000002 8 0.0 0.0 9 0.0518000518000518 0.44999999999999996 >10 0.0259000259000259 0.25 >50 0.0259000259000259 1.775 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 71 1.775 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.45 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.35 0.0 0.0 0.0 0.0 122-123 5.762499999999999 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.95 0.0 0.0 0.0 0.0 128-129 7.5 0.0 0.0 0.0 0.0 130-131 8.1125 0.0 0.0 0.0 0.0 132-133 8.725 0.0 0.0 0.0 0.0 134-135 9.35 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802094 spots for SRR7170011.sra Written 802094 spots for SRR7170011.sra Read 802105 spots for SRR7170011.sra Written 802105 spots for SRR7170011.sra SRR ids: ['SRR7170011.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rmi4gad7 SRR7170011.sra spots: 16041891 blocks: [[1, 802094], [802095, 1604188], [1604189, 2406282], [2406283, 3208376], [3208377, 4010470], [4010471, 4812564], [4812565, 5614658], [5614659, 6416752], [6416753, 7218846], [7218847, 8020940], [8020941, 8823034], [8823035, 9625128], [9625129, 10427222], [10427223, 11229316], [11229317, 12031410], [12031411, 12833504], [12833505, 13635598], [13635599, 14437692], [14437693, 15239786], [15239787, 16041891]] SRR7170011 file size 5414370 SRR7170011 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170011 SRR7170011_1.fastq SRR7170011_2.fastq Input file: SRR7170011_1.fastq Paired file: SRR7170011_2.fastq trimmed: SRR7170011-trimmed-pair1.fastq, SRR7170011-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:42:28 2025 >> started Wed Feb 12 09:42:45 2025 >> done (16.466s) 16041891 read pairs processed; of these: 31506 ( 0.20%) short read pairs filtered out after trimming by size control 82345 ( 0.51%) empty read pairs filtered out after trimming by size control 15928040 (99.29%) read pairs available; of these: 7832904 (49.18%) trimmed read pairs available after processing 8095136 (50.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 4 0.00% 21 11 0.00% 22 13 0.00% 23 7 0.00% 24 9 0.00% 25 7 0.00% 26 11 0.00% 27 8 0.00% 28 18 0.00% 29 10 0.00% 30 21 0.00% 31 14 0.00% 32 20 0.00% 33 26 0.00% 34 21 0.00% 35 26 0.00% 36 31 0.00% 37 35 0.00% 38 37 0.00% 39 42 0.00% 40 53 0.00% 41 40 0.00% 42 59 0.00% 43 67 0.00% 44 79 0.00% 45 77 0.00% 46 97 0.00% 47 104 0.00% 48 144 0.00% 49 139 0.00% 50 184 0.00% 51 202 0.00% 52 253 0.00% 53 252 0.00% 54 286 0.00% 55 242 0.00% 56 327 0.00% 57 341 0.00% 58 389 0.00% 59 445 0.00% 60 518 0.00% 61 562 0.00% 62 664 0.00% 63 769 0.00% 64 860 0.01% 65 947 0.01% 66 1238 0.01% 67 1444 0.01% 68 1587 0.01% 69 2295 0.01% 70 4461 0.03% 71 3339 0.02% 72 2662 0.02% 73 2768 0.02% 74 2882 0.02% 75 3154 0.02% 76 3318 0.02% 77 3703 0.02% 78 4106 0.03% 79 4376 0.03% 80 4925 0.03% 81 5668 0.04% 82 6377 0.04% 83 7274 0.05% 84 9244 0.06% 85 10977 0.07% 86 11780 0.07% 87 12320 0.08% 88 13389 0.08% 89 13945 0.09% 90 14540 0.09% 91 15639 0.10% 92 16710 0.10% 93 18083 0.11% 94 19335 0.12% 95 20994 0.13% 96 21965 0.14% 97 22922 0.14% 98 23269 0.15% 99 24250 0.15% 100 25633 0.16% 101 26548 0.17% 102 28197 0.18% 103 29565 0.19% 104 30959 0.19% 105 33572 0.21% 106 34440 0.22% 107 35765 0.22% 108 36693 0.23% 109 37342 0.23% 110 38800 0.24% 111 39639 0.25% 112 41071 0.26% 113 43369 0.27% 114 44951 0.28% 115 46592 0.29% 116 48035 0.30% 117 49473 0.31% 118 50483 0.32% 119 50739 0.32% 120 51366 0.32% 121 52852 0.33% 122 54057 0.34% 123 56061 0.35% 124 58343 0.37% 125 59928 0.38% 126 62225 0.39% 127 64346 0.40% 128 65470 0.41% 129 67179 0.42% 130 68510 0.43% 131 69655 0.44% 132 73292 0.46% 133 75082 0.47% 134 78808 0.49% 135 81692 0.51% 136 85078 0.53% 137 89203 0.56% 138 94811 0.60% 139 99709 0.63% 140 104236 0.65% 141 109920 0.69% 142 116848 0.73% 143 125696 0.79% 144 136154 0.85% 145 152846 0.96% 146 179359 1.13% 147 226791 1.42% 148 308357 1.94% 149 569856 3.58% 150 3279887 20.59% 151 8095136 50.82% 15928040 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=41.65 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.7 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=19.34 fanout-score-rank=9 prefix-density=0.43 prefix-fanout=7.7 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=41 fanout-score=125.68 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=13.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAAGGAGAA SRR7170011 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:43:28 Started mapping on | Feb 12 09:43:28 Finished on | Feb 12 09:45:29 Mapping speed, Million of reads per hour | 473.89 Number of input reads | 15928040 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14725934 Uniquely mapped reads % | 92.45% Average mapped length | 290.00 Number of splices: Total | 12998068 Number of splices: Annotated (sjdb) | 12757419 Number of splices: GT/AG | 12803082 Number of splices: GC/AG | 154025 Number of splices: AT/AC | 11451 Number of splices: Non-canonical | 29510 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286559 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 72730 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.22% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 940086 940086 940086 N_multimapping 286559 286559 286559 N_noFeature 305144 14524250 398932 N_ambiguous 164805 1056 56375 UnstrandedReadsAssigned:14255985 PositiveStrandReadsAssigned:200628 NegativeStrandReadsAssigned:14270627 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170011 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170011-trimmed-pair1.fastq SRR7170011-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,928,040 reads, 14,264,374 reads pseudoaligned [quant] estimated average fragment length: 214.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7170011.ke.tsv 34699 SRR7170011.se.tsv 87100 total ==> SRR7170011.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.01 239 7.97925 Potri.005G024800.1.v4.1 1035 821.007 67 4.91508 Potri.004G059700.1.v4.1 961 747.012 7 0.564382 Potri.007G009000.2.v4.1 1416 1202.01 0 0 Potri.003G141000.2.v4.1 2943 2729.01 230.031 5.07674 Potri.016G087400.1.v4.1 270 91.1391 1532.03 1012.43 Potri.015G069301.1.v4.1 564 352.304 0 0 Potri.010G195200.1.v4.1 1773 1559.01 15 0.57949 Potri.012G127500.1.v4.1 977 763.012 6713 529.893 ==> SRR7170011.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 599 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 305 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170011 completed mapping pipeline successfully