Starting /dee2/code/volunteer_pipeline.sh SRR7170012 current disk space = 3051191988224 free memory = 1581264644 SRR7170012 SRAfilesize ca9ef336c8f29aa1f94dfff4d849bfdc SRR7170012.sra SRR7170012.sra file validated SRR7170012 is paired end SRR7170012 is conventional basespace SRR7170012 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170012_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24125 34.0 34.0 34.0 33.0 34.0 2 33.55325 34.0 34.0 34.0 33.0 34.0 3 33.60625 34.0 34.0 34.0 33.0 34.0 4 33.64525 34.0 34.0 34.0 33.0 34.0 5 33.63425 34.0 34.0 34.0 33.0 34.0 6 37.34575 38.0 38.0 38.0 36.0 38.0 7 37.61525 38.0 38.0 38.0 38.0 38.0 8 37.63825 38.0 38.0 38.0 38.0 38.0 9 37.6325 38.0 38.0 38.0 38.0 38.0 10-14 37.63705 38.0 38.0 38.0 38.0 38.0 15-19 37.6119 38.0 38.0 38.0 38.0 38.0 20-24 37.55 38.0 38.0 38.0 38.0 38.0 25-29 37.499849999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5319 38.0 38.0 38.0 38.0 38.0 35-39 37.4766 38.0 38.0 38.0 37.8 38.0 40-44 37.38325 38.0 38.0 38.0 37.0 38.0 45-49 37.311099999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.25885 38.0 38.0 38.0 37.0 38.0 55-59 37.212399999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.1638 38.0 38.0 38.0 36.6 38.0 65-69 37.13680000000001 38.0 38.0 38.0 36.6 38.0 70-74 37.094 38.0 38.0 38.0 36.6 38.0 75-79 36.8919 38.0 38.0 38.0 36.0 38.0 80-84 36.84009999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.74165 38.0 38.0 38.0 35.8 38.0 90-94 36.46685 38.0 38.0 38.0 35.0 38.0 95-99 36.3231 38.0 38.0 38.0 34.4 38.0 100-104 36.386 38.0 38.0 38.0 34.2 38.0 105-109 36.2502 38.0 38.0 38.0 34.0 38.0 110-114 36.0428 38.0 38.0 38.0 33.8 38.0 115-119 35.803399999999996 38.0 37.4 38.0 33.2 38.0 120-124 35.62115 38.0 37.0 38.0 32.2 38.0 125-129 35.3467 38.0 36.6 38.0 31.0 38.0 130-134 35.1117 38.0 36.0 38.0 29.8 38.0 135-139 34.67094999999999 38.0 35.8 38.0 27.8 38.0 140-144 34.5055 38.0 35.4 38.0 27.4 38.0 145-149 33.8759 38.0 35.0 38.0 23.0 38.0 150-151 30.707250000000002 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 0.0 12 1.0 13 2.0 14 2.0 15 3.0 16 5.0 17 2.0 18 7.0 19 15.0 20 2.0 21 12.0 22 5.0 23 12.0 24 8.0 25 14.0 26 14.0 27 19.0 28 28.0 29 20.0 30 29.0 31 47.0 32 55.0 33 71.0 34 123.0 35 190.0 36 517.0 37 2791.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.05056890012642 14.614412136536032 12.212389380530974 33.122629582806574 2 22.900000000000002 16.150000000000002 30.45 30.5 3 20.075000000000003 20.4 26.85 32.675 4 22.575 26.700000000000003 22.15 28.575 5 21.825 30.325000000000003 25.2 22.650000000000002 6 20.25 34.35 25.45 19.950000000000003 7 14.899999999999999 29.225 38.475 17.4 8 17.25 28.725 30.525000000000002 23.5 9 15.8 28.275 33.45 22.475 10-14 19.195 31.814999999999998 27.215 21.775 15-19 18.765 30.630000000000003 27.800000000000004 22.805 20-24 19.095000000000002 31.745 26.939999999999998 22.220000000000002 25-29 18.895 30.42 27.544999999999998 23.14 30-34 19.075 30.14 27.474999999999998 23.31 35-39 19.220000000000002 30.445 27.065 23.27 40-44 18.77 30.5 27.365000000000002 23.365 45-49 19.328697914061326 29.81341603721675 27.73247961582712 23.125406432894803 50-54 19.215 29.830000000000002 27.55 23.405 55-59 19.13 30.285 27.11 23.474999999999998 60-64 19.564999999999998 29.959999999999997 26.515 23.96 65-69 19.35 29.755 27.325 23.57 70-74 19.48 30.055 27.43 23.035 75-79 19.61 29.93 27.11 23.35 80-84 20.015 29.25 27.615000000000002 23.119999999999997 85-89 19.88187005706277 29.622584843327658 26.599259185103612 23.896285914505956 90-94 19.779943729903536 29.612138263665592 26.994573954983924 23.613344051446948 95-99 19.77895001255966 29.23386083898518 27.1539814117056 23.83320773674956 100-104 20.036010803240973 29.9889966990097 26.78303491047314 23.191957587276182 105-109 20.207020702070206 29.74797479747975 26.512651265126514 23.532353235323534 110-114 20.169999999999998 29.525000000000002 26.979999999999997 23.325000000000003 115-119 20.62515628907227 29.117279319829958 26.901725431357836 23.355838959739934 120-124 20.79 28.58 26.650000000000002 23.98 125-129 20.169999999999998 29.154999999999998 26.834999999999997 23.84 130-134 20.61886641297817 29.030642900060084 26.67734828760264 23.673142399359104 135-139 20.091301294271094 29.025785090799637 27.169659877596068 23.7132537373332 140-144 20.3113268932379 28.595024776014817 26.943290454977724 24.150357875769558 145-149 20.758213141025642 29.111578525641026 26.337139423076923 23.79306891025641 150-151 20.075000000000003 28.65 27.1625 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 0.0 19 0.0 20 0.5 21 2.5 22 4.0 23 3.0 24 3.5 25 6.0 26 7.0 27 7.5 28 14.0 29 23.5 30 34.5 31 46.0 32 55.5 33 65.5 34 81.5 35 102.5 36 126.5 37 132.0 38 147.0 39 169.0 40 194.0 41 231.0 42 252.5 43 256.0 44 258.0 45 248.5 46 232.0 47 224.5 48 193.0 49 167.0 50 150.5 51 127.5 52 96.0 53 81.5 54 68.5 55 39.0 56 33.0 57 27.0 58 20.5 59 18.0 60 10.5 61 9.5 62 7.0 63 3.0 64 3.0 65 3.0 66 1.0 67 1.0 68 0.5 69 1.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.045 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.11 90-94 0.48 95-99 0.475 100-104 0.03 105-109 0.01 110-114 0.0 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.13999999999999999 135-139 0.33 140-144 0.105 145-149 0.16 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41997961264016 96.55 2 1.529051987767584 3.0 3 0.025484199796126403 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCCTAATCTCGTATGC 15 0.375 TruSeq Adapter, Index 18 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 1.9500000000000002 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.237500000000001 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 5.0625 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.4375 0.0 0.0 0.0 0.0 138-139 6.824999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170012 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170012_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2935 33.0 33.0 34.0 32.0 34.0 2 32.3905 34.0 33.0 34.0 32.0 34.0 3 32.38125 34.0 33.0 34.0 32.0 34.0 4 32.272 34.0 33.0 34.0 32.0 34.0 5 32.09875 34.0 33.0 34.0 32.0 34.0 6 36.188 38.0 38.0 38.0 36.0 38.0 7 36.14375 38.0 38.0 38.0 37.0 38.0 8 36.09325 38.0 38.0 38.0 36.0 38.0 9 36.10175 38.0 38.0 38.0 36.0 38.0 10-14 36.02975 38.0 38.0 38.0 36.2 38.0 15-19 35.948949999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.0165 38.0 38.0 38.0 36.2 38.0 25-29 36.080850000000005 38.0 38.0 38.0 36.2 38.0 30-34 36.091300000000004 38.0 38.0 38.0 36.6 38.0 35-39 35.99245 38.0 38.0 38.0 36.2 38.0 40-44 35.925749999999994 38.0 38.0 38.0 36.2 38.0 45-49 35.802499999999995 38.0 38.0 38.0 36.0 38.0 50-54 35.99865 38.0 38.0 38.0 36.0 38.0 55-59 36.0134 38.0 38.0 38.0 36.0 38.0 60-64 35.91355 38.0 38.0 38.0 35.8 38.0 65-69 35.8716 38.0 38.0 38.0 36.0 38.0 70-74 35.779450000000004 38.0 38.0 38.0 35.4 38.0 75-79 35.6905 38.0 38.0 38.0 34.8 38.0 80-84 35.666 38.0 38.0 38.0 34.6 38.0 85-89 35.2787 38.0 38.0 38.0 33.6 38.0 90-94 34.978449999999995 38.0 38.0 38.0 31.0 38.0 95-99 35.28295 38.0 38.0 38.0 32.0 38.0 100-104 35.368300000000005 38.0 38.0 38.0 33.2 38.0 105-109 35.270050000000005 38.0 38.0 38.0 33.0 38.0 110-114 35.1606 38.0 38.0 38.0 32.0 38.0 115-119 35.01355 38.0 38.0 38.0 31.0 38.0 120-124 34.87395 38.0 38.0 38.0 29.8 38.0 125-129 34.48455 38.0 37.4 38.0 25.8 38.0 130-134 33.49625 38.0 36.2 38.0 14.2 38.0 135-139 32.500350000000005 38.0 35.4 38.0 4.2 38.0 140-144 31.63605 38.0 33.8 38.0 2.0 38.0 145-149 31.443100000000005 38.0 33.4 38.0 2.0 38.0 150-151 27.992125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 129.0 3 1.0 4 4.0 5 4.0 6 4.0 7 2.0 8 0.0 9 0.0 10 6.0 11 4.0 12 6.0 13 2.0 14 3.0 15 4.0 16 4.0 17 14.0 18 8.0 19 13.0 20 7.0 21 7.0 22 7.0 23 8.0 24 14.0 25 13.0 26 23.0 27 32.0 28 20.0 29 27.0 30 33.0 31 48.0 32 75.0 33 120.0 34 113.0 35 143.0 36 366.0 37 2736.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5124009204807 21.40117616977755 16.84991050882127 25.23651240092048 2 26.582278481012654 28.12658227848101 28.607594936708864 16.68354430379747 3 22.603610475464023 29.6465802186626 28.400711924739387 19.349097381133994 4 24.103483606557376 33.40163934426229 23.668032786885245 18.82684426229508 5 25.649601234885516 34.7054283509133 22.768201697967587 16.8767687162336 6 21.491002570694086 36.32390745501286 24.215938303341904 17.969151670951156 7 20.349884229482893 22.922562387445332 37.612554669410855 19.11499871366092 8 24.67866323907455 24.524421593830333 27.04370179948586 23.753213367609256 9 22.3303457106274 26.402048655569782 27.96414852752881 23.30345710627401 10-14 24.378058202420807 28.04532577903683 26.185938707185162 21.390677311357198 15-19 24.64748721656939 27.31263880997882 27.22999845049326 20.809875522958524 20-24 22.78585421177441 28.703990102072378 27.368800907310032 21.14135477884318 25-29 23.678668652729982 28.239765781498793 27.62340130463814 20.45816426113308 30-34 24.05609492988134 28.484101299635277 27.33343607130015 20.126367699183234 35-39 23.780550685779104 27.761163246364855 28.008662472929775 20.449623594926265 40-44 24.091778202676863 27.80218076585189 27.869360756550048 20.23668027492119 45-49 23.4631094565948 27.919962773382967 28.013029315960914 20.60389845406132 50-54 23.458692971639948 28.45766543362104 27.825729551993422 20.25791204274558 55-59 23.993625006426406 27.695234178191352 28.163076448511642 20.148064366870596 60-64 23.705497449636766 28.187954041939307 28.224019784635995 19.882528723787935 65-69 23.85283387287395 27.634756692872926 27.86598838703047 20.646421047222653 70-74 24.25436128306134 28.004297334629353 28.03499258198189 19.706348800327415 75-79 23.19558665781274 28.22189303774838 28.043111814884814 20.539408489554067 80-84 23.461656598750896 27.802805365004605 28.442715265690595 20.292822770553904 85-89 23.5327724109276 28.16557598421107 28.066895190609742 20.234756414251585 90-94 23.727486296006266 27.8569564082485 28.274601931610544 20.14095536413469 95-99 24.068458652413014 27.58904250398314 28.539857120830547 19.802641722773295 100-104 23.77876877338664 27.618022451176383 28.36126915782459 20.241939617612385 105-109 23.879292617725685 27.549866337651657 28.60888340530537 19.961957639317294 110-114 24.064831489580655 27.51222022125032 28.5207100591716 19.902238229997426 115-119 24.20783209623752 27.048886613770158 29.014589198873814 19.728692091118504 120-124 23.782351742408803 27.751171795394335 28.01609944976564 20.45037701243122 125-129 24.58855698292318 27.751122117319298 28.241242325749365 19.419078574008154 130-134 24.234720898209936 28.503336510962825 27.687744942273063 19.57419764855418 135-139 24.667603502324074 27.769970813966054 28.148308290995566 19.4141173927143 140-144 24.938312222405003 28.11317650929429 27.652574436584963 19.295936831715743 145-149 25.35966449009927 27.73796252057122 27.806975633062592 19.095397356266922 150-151 24.23181641384675 27.46013224426293 28.80850512122391 19.49954622066641 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 63.0 1 40.5 2 11.5 3 4.0 4 2.0 5 2.0 6 2.5 7 2.0 8 1.0 9 0.0 10 0.0 11 0.5 12 2.0 13 2.0 14 2.0 15 2.0 16 0.5 17 0.5 18 2.5 19 3.0 20 4.5 21 5.5 22 2.5 23 2.5 24 3.5 25 3.0 26 3.5 27 5.0 28 9.0 29 8.5 30 9.0 31 17.0 32 20.5 33 24.5 34 37.5 35 49.0 36 69.5 37 96.5 38 106.5 39 128.0 40 188.5 41 223.0 42 248.5 43 279.0 44 295.0 45 309.0 46 304.5 47 287.0 48 250.0 49 207.5 50 162.0 51 136.0 52 116.0 53 85.0 54 57.0 55 42.0 56 29.0 57 16.0 58 10.5 59 7.5 60 9.5 61 6.5 62 5.0 63 4.0 64 1.5 65 0.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.225 2 1.25 3 1.675 4 2.4 5 2.825 6 2.75 7 2.825 8 2.75 9 2.375 10-14 2.9250000000000003 15-19 3.195 20-24 3.01 25-29 2.6550000000000002 30-34 2.665 35-39 3.0300000000000002 40-44 3.245 45-49 3.295 50-54 2.68 55-59 2.7449999999999997 60-64 2.955 65-69 2.6950000000000003 70-74 2.265 75-79 2.1149999999999998 80-84 2.33 85-89 3.73 90-94 4.2250000000000005 95-99 2.715 100-104 2.455 105-109 2.74 110-114 2.825 115-119 2.325 120-124 1.8599999999999999 125-129 3.085 130-134 5.59 135-139 7.489999999999999 140-144 8.815000000000001 145-149 5.815 150-151 3.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.1038961038961 94.425 2 1.7402597402597402 3.35 3 0.025974025974025976 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025974025974025976 0.15 7 0.0 0.0 8 0.05194805194805195 0.4 9 0.0 0.0 >10 0.05194805194805195 1.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 50 1.25 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.862500000000001 0.0 0.0 0.0 0.0 132-133 5.237500000000001 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714894 spots for SRR7170012.sra Written 714894 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra Read 714891 spots for SRR7170012.sra Written 714891 spots for SRR7170012.sra SRR ids: ['SRR7170012.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dy8roxci SRR7170012.sra spots: 14297823 blocks: [[1, 714891], [714892, 1429782], [1429783, 2144673], [2144674, 2859564], [2859565, 3574455], [3574456, 4289346], [4289347, 5004237], [5004238, 5719128], [5719129, 6434019], [6434020, 7148910], [7148911, 7863801], [7863802, 8578692], [8578693, 9293583], [9293584, 10008474], [10008475, 10723365], [10723366, 11438256], [11438257, 12153147], [12153148, 12868038], [12868039, 13582929], [13582930, 14297823]] SRR7170012 file size 4823362 SRR7170012 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170012 SRR7170012_1.fastq SRR7170012_2.fastq Input file: SRR7170012_1.fastq Paired file: SRR7170012_2.fastq trimmed: SRR7170012-trimmed-pair1.fastq, SRR7170012-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:19:03 2025 >> started Wed Feb 12 11:19:18 2025 >> done (14.555s) 14297823 read pairs processed; of these: 37831 ( 0.26%) short read pairs filtered out after trimming by size control 97127 ( 0.68%) empty read pairs filtered out after trimming by size control 14162865 (99.06%) read pairs available; of these: 6426014 (45.37%) trimmed read pairs available after processing 7736851 (54.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 16 0.00% 20 16 0.00% 21 16 0.00% 22 11 0.00% 23 11 0.00% 24 26 0.00% 25 12 0.00% 26 14 0.00% 27 20 0.00% 28 26 0.00% 29 22 0.00% 30 15 0.00% 31 33 0.00% 32 22 0.00% 33 16 0.00% 34 24 0.00% 35 29 0.00% 36 30 0.00% 37 32 0.00% 38 40 0.00% 39 37 0.00% 40 47 0.00% 41 30 0.00% 42 41 0.00% 43 51 0.00% 44 73 0.00% 45 64 0.00% 46 96 0.00% 47 88 0.00% 48 101 0.00% 49 111 0.00% 50 99 0.00% 51 142 0.00% 52 161 0.00% 53 157 0.00% 54 162 0.00% 55 155 0.00% 56 195 0.00% 57 259 0.00% 58 238 0.00% 59 218 0.00% 60 259 0.00% 61 260 0.00% 62 369 0.00% 63 374 0.00% 64 494 0.00% 65 616 0.00% 66 807 0.01% 67 1061 0.01% 68 1917 0.01% 69 3583 0.03% 70 4796 0.03% 71 3032 0.02% 72 2028 0.01% 73 1591 0.01% 74 1487 0.01% 75 1570 0.01% 76 1537 0.01% 77 1716 0.01% 78 1774 0.01% 79 2027 0.01% 80 2199 0.02% 81 2590 0.02% 82 2884 0.02% 83 3337 0.02% 84 5281 0.04% 85 6474 0.05% 86 7000 0.05% 87 7534 0.05% 88 7772 0.05% 89 8078 0.06% 90 8441 0.06% 91 8464 0.06% 92 9335 0.07% 93 9552 0.07% 94 10405 0.07% 95 11164 0.08% 96 11796 0.08% 97 12499 0.09% 98 12839 0.09% 99 13221 0.09% 100 13892 0.10% 101 15047 0.11% 102 15874 0.11% 103 16902 0.12% 104 17906 0.13% 105 18843 0.13% 106 20114 0.14% 107 20784 0.15% 108 21585 0.15% 109 22272 0.16% 110 22799 0.16% 111 24082 0.17% 112 24835 0.18% 113 26454 0.19% 114 27805 0.20% 115 28871 0.20% 116 29729 0.21% 117 30854 0.22% 118 31588 0.22% 119 32155 0.23% 120 33075 0.23% 121 33792 0.24% 122 35126 0.25% 123 37292 0.26% 124 38393 0.27% 125 39849 0.28% 126 41541 0.29% 127 43537 0.31% 128 44481 0.31% 129 45787 0.32% 130 47487 0.34% 131 49417 0.35% 132 50553 0.36% 133 52934 0.37% 134 55513 0.39% 135 58423 0.41% 136 61239 0.43% 137 65491 0.46% 138 69377 0.49% 139 74831 0.53% 140 78686 0.56% 141 84742 0.60% 142 90367 0.64% 143 98926 0.70% 144 112493 0.79% 145 124804 0.88% 146 146708 1.04% 147 194457 1.37% 148 295277 2.08% 149 539073 3.81% 150 3024827 21.36% 151 7736851 54.63% 14162865 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=126.60 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.9 sequence=AAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=16.07 fanout-score-rank=10 prefix-density=0.45 prefix-fanout=7.1 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCACGGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=125.42 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170012 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:20:00 Started mapping on | Feb 12 11:20:01 Finished on | Feb 12 11:21:25 Mapping speed, Million of reads per hour | 606.98 Number of input reads | 14162865 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13406738 Uniquely mapped reads % | 94.66% Average mapped length | 292.80 Number of splices: Total | 10756194 Number of splices: Annotated (sjdb) | 10528966 Number of splices: GT/AG | 10591151 Number of splices: GC/AG | 124044 Number of splices: AT/AC | 9245 Number of splices: Non-canonical | 31754 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255695 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 36636 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 534823 534823 534823 N_multimapping 255695 255695 255695 N_noFeature 319391 13209275 388272 N_ambiguous 184805 827 55747 UnstrandedReadsAssigned:12902542 PositiveStrandReadsAssigned:196636 NegativeStrandReadsAssigned:12962719 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170012 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170012-trimmed-pair1.fastq SRR7170012-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,162,865 reads, 12,963,834 reads pseudoaligned [quant] estimated average fragment length: 226.843 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 SRR7170012.ke.tsv 34699 SRR7170012.se.tsv 87100 total ==> SRR7170012.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.16 222 8.03766 Potri.005G024800.1.v4.1 1035 809.157 29 2.32551 Potri.004G059700.1.v4.1 961 735.163 13 1.14739 Potri.007G009000.2.v4.1 1416 1190.16 0 0 Potri.003G141000.2.v4.1 2943 2717.16 209 4.99096 Potri.016G087400.1.v4.1 270 82.2285 1824 1439.31 Potri.015G069301.1.v4.1 564 340.218 0 0 Potri.010G195200.1.v4.1 1773 1547.16 11 0.461329 Potri.012G127500.1.v4.1 977 751.163 3906 337.404 ==> SRR7170012.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1223 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170012 completed mapping pipeline successfully