Starting /dee2/code/volunteer_pipeline.sh SRR7170013 current disk space = 3049754497024 free memory = 1300500184 SRR7170013 SRAfilesize 8997de9d408ccbe54bf3ce379d3a4e28 SRR7170013.sra SRR7170013.sra file validated SRR7170013 is paired end SRR7170013 is conventional basespace SRR7170013 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170013_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1545 34.0 34.0 34.0 33.0 34.0 2 33.566 34.0 34.0 34.0 33.0 34.0 3 33.57175 34.0 34.0 34.0 33.0 34.0 4 33.646 34.0 34.0 34.0 33.0 34.0 5 33.61675 34.0 34.0 34.0 33.0 34.0 6 37.45525 38.0 38.0 38.0 37.0 38.0 7 37.651 38.0 38.0 38.0 38.0 38.0 8 37.707 38.0 38.0 38.0 38.0 38.0 9 37.728 38.0 38.0 38.0 38.0 38.0 10-14 37.6539 38.0 38.0 38.0 38.0 38.0 15-19 37.655550000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.61800000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.60795 38.0 38.0 38.0 38.0 38.0 30-34 37.6177 38.0 38.0 38.0 38.0 38.0 35-39 37.5644 38.0 38.0 38.0 38.0 38.0 40-44 37.439049999999995 38.0 38.0 38.0 37.6 38.0 45-49 37.216950000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.33335 38.0 38.0 38.0 37.0 38.0 55-59 37.29145 38.0 38.0 38.0 37.0 38.0 60-64 37.276300000000006 38.0 38.0 38.0 37.0 38.0 65-69 37.19115000000001 38.0 38.0 38.0 36.6 38.0 70-74 37.07915 38.0 38.0 38.0 36.0 38.0 75-79 37.057249999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.95505 38.0 38.0 38.0 36.0 38.0 85-89 36.7567 38.0 38.0 38.0 35.6 38.0 90-94 36.5834 38.0 38.0 38.0 35.4 38.0 95-99 36.43435 38.0 38.0 38.0 34.8 38.0 100-104 36.4786 38.0 38.0 38.0 34.4 38.0 105-109 36.4548 38.0 38.0 38.0 34.0 38.0 110-114 36.278600000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.098200000000006 38.0 37.8 38.0 33.4 38.0 120-124 36.0013 38.0 37.0 38.0 33.0 38.0 125-129 35.7207 38.0 36.6 38.0 31.4 38.0 130-134 35.29535 38.0 36.0 38.0 30.4 38.0 135-139 34.8755 38.0 35.8 38.0 28.0 38.0 140-144 34.710950000000004 38.0 35.6 38.0 28.0 38.0 145-149 34.01805 38.0 35.0 38.0 24.4 38.0 150-151 30.470375 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 1.0 17 3.0 18 4.0 19 5.0 20 3.0 21 6.0 22 5.0 23 9.0 24 11.0 25 13.0 26 15.0 27 23.0 28 29.0 29 21.0 30 43.0 31 39.0 32 55.0 33 70.0 34 105.0 35 211.0 36 532.0 37 2790.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.96249366447035 11.556006082108464 10.643689812468322 39.837810440952865 2 22.05 17.224999999999998 32.9 27.825 3 19.7 21.75 25.900000000000002 32.65 4 23.125 29.425 22.075 25.374999999999996 5 22.5 33.45 23.5 20.549999999999997 6 19.25 35.449999999999996 24.125 21.175 7 14.299999999999999 26.1 42.375 17.224999999999998 8 19.15 26.375 29.5 24.975 9 16.875 24.25 33.800000000000004 25.074999999999996 10-14 19.74 29.805 26.86 23.595 15-19 19.88 28.355000000000004 27.834999999999997 23.93 20-24 20.669999999999998 28.139999999999997 27.715 23.474999999999998 25-29 20.13 28.895 27.474999999999998 23.5 30-34 20.085 28.345 27.515 24.055 35-39 20.355 28.305000000000003 27.415 23.925 40-44 19.87593176246936 28.975936765220872 27.54014708089449 23.60798439141528 45-49 20.210843373493976 28.468875502008036 27.590361445783135 23.729919678714857 50-54 20.172017201720173 28.442844284428443 27.432743274327432 23.952395239523952 55-59 20.635 28.29 27.26 23.815 60-64 20.46 27.62 27.839999999999996 24.08 65-69 20.365 28.435 27.685 23.515 70-74 20.485 28.375 26.889999999999997 24.25 75-79 20.32 28.26 27.750000000000004 23.669999999999998 80-84 20.75 28.335 27.145000000000003 23.77 85-89 20.645031850328536 28.068415508852883 27.42639313838592 23.860159502432662 90-94 20.50274545362954 28.7239937534633 26.69890685607778 24.07435393682938 95-99 20.839633101501864 28.47495212176192 27.477068843866547 23.20834593286967 100-104 20.985611871459366 28.78127036647115 27.12187296335288 23.111244798716598 105-109 20.419999999999998 28.09 27.38 24.11 110-114 20.754622438242222 28.831988775868115 27.178433632309467 23.2349551535802 115-119 20.393058958843827 28.404260639095863 27.29409411411712 23.908586287943194 120-124 20.655 27.735 27.355 24.255 125-129 21.279999999999998 28.355000000000004 26.97 23.395 130-134 21.107821985851185 28.31267874165872 26.48637800411419 24.093121268375896 135-139 21.454453950679415 28.470055359838952 26.054353296426775 24.021137393054858 140-144 20.943434140460162 28.212599216316686 26.800964533306544 24.043002109916607 145-149 20.34985715001754 28.06876848278282 27.59761415467896 23.983760212520675 150-151 20.3 28.7 26.525 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 1.0 26 5.0 27 7.5 28 7.0 29 12.0 30 21.0 31 24.5 32 25.0 33 40.0 34 59.5 35 76.0 36 91.0 37 107.0 38 127.5 39 147.5 40 184.5 41 213.0 42 219.0 43 240.5 44 261.5 45 268.0 46 287.0 47 266.0 48 229.0 49 195.0 50 166.0 51 146.5 52 120.5 53 104.5 54 87.0 55 70.0 56 51.0 57 39.0 58 24.5 59 17.0 60 16.5 61 11.0 62 7.5 63 5.0 64 4.5 65 4.5 66 2.0 67 1.0 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.055 45-49 0.4 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.315 90-94 0.745 95-99 0.79 100-104 0.265 105-109 0.0 110-114 0.215 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.345 135-139 0.65 140-144 0.47000000000000003 145-149 0.245 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.7625000000000002 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 3.1500000000000004 0.0 0.0 0.0 0.0 118-119 3.4625000000000004 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.2625 0.0 0.0 0.0 0.0 128-129 5.775 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.35 0.0 0.0 0.0 0.0 136-137 7.9125 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGACAG 10 0.006864391 144.7625 9 CCGACTA 10 0.006864391 144.7625 4 >>END_MODULE SRR7170013 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170013_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.30625 33.0 33.0 34.0 32.0 34.0 2 32.446 34.0 33.0 34.0 32.0 34.0 3 32.499 34.0 33.0 34.0 32.0 34.0 4 32.2905 34.0 33.0 34.0 32.0 34.0 5 32.32975 34.0 33.0 34.0 32.0 34.0 6 36.432 38.0 38.0 38.0 36.0 38.0 7 36.429 38.0 38.0 38.0 36.0 38.0 8 36.491 38.0 38.0 38.0 37.0 38.0 9 36.5155 38.0 38.0 38.0 37.0 38.0 10-14 36.423649999999995 38.0 38.0 38.0 37.0 38.0 15-19 36.23715 38.0 38.0 38.0 36.0 38.0 20-24 36.371050000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.3894 38.0 38.0 38.0 37.0 38.0 30-34 36.41805 38.0 38.0 38.0 37.0 38.0 35-39 36.36835 38.0 38.0 38.0 36.6 38.0 40-44 36.249399999999994 38.0 38.0 38.0 36.4 38.0 45-49 36.16105 38.0 38.0 38.0 36.2 38.0 50-54 36.30375 38.0 38.0 38.0 36.2 38.0 55-59 36.33025 38.0 38.0 38.0 36.2 38.0 60-64 36.2763 38.0 38.0 38.0 36.0 38.0 65-69 36.24065 38.0 38.0 38.0 36.0 38.0 70-74 36.1708 38.0 38.0 38.0 35.8 38.0 75-79 36.12445 38.0 38.0 38.0 35.6 38.0 80-84 35.97375000000001 38.0 38.0 38.0 35.0 38.0 85-89 35.685199999999995 38.0 38.0 38.0 34.0 38.0 90-94 35.387800000000006 38.0 38.0 38.0 33.2 38.0 95-99 35.68555 38.0 38.0 38.0 33.8 38.0 100-104 35.62515 38.0 38.0 38.0 33.4 38.0 105-109 35.5356 38.0 38.0 38.0 33.0 38.0 110-114 35.31875 38.0 38.0 38.0 31.8 38.0 115-119 35.1738 38.0 38.0 38.0 30.6 38.0 120-124 34.831849999999996 38.0 37.4 38.0 28.0 38.0 125-129 34.4623 38.0 36.8 38.0 25.4 38.0 130-134 33.68145 38.0 36.0 38.0 17.8 38.0 135-139 32.77085 38.0 34.6 38.0 9.0 38.0 140-144 31.952700000000004 38.0 33.0 38.0 2.0 38.0 145-149 31.487299999999998 38.0 33.2 38.0 2.0 38.0 150-151 27.57475 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 87.0 3 14.0 4 2.0 5 3.0 6 0.0 7 0.0 8 1.0 9 1.0 10 3.0 11 4.0 12 2.0 13 2.0 14 4.0 15 2.0 16 4.0 17 6.0 18 8.0 19 14.0 20 5.0 21 6.0 22 8.0 23 13.0 24 17.0 25 14.0 26 22.0 27 33.0 28 21.0 29 41.0 30 42.0 31 46.0 32 76.0 33 120.0 34 138.0 35 181.0 36 415.0 37 2645.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.93601835330105 19.52587305633444 14.9885291868468 28.549579403517715 2 26.191683569979716 27.865111561866122 30.17241379310345 15.770791075050711 3 20.834393284151613 29.509030780971763 30.602900025438817 19.053675909437803 4 23.804653541293785 34.08335464075684 22.730759396573767 19.381232421375607 5 23.39226236228542 36.97156033820138 22.444273635664874 17.191903663848322 6 21.403061224489797 36.147959183673464 23.72448979591837 18.724489795918366 7 20.10204081632653 20.739795918367346 38.29081632653061 20.867346938775512 8 22.20805711371749 25.216726160122388 27.15451300356961 25.420703722590517 9 21.672616012238656 24.910759816420196 28.811830698623154 24.604793472718 10-14 23.516191643681683 28.910001021554805 26.47870058228624 21.09510675247727 15-19 23.85250525667983 27.23216575208985 28.00656443920201 20.90876455202831 20-24 22.93156281920327 28.733401430030643 27.012257405515832 21.322778345250256 25-29 23.63757086674498 27.682721283007304 27.789979059196078 20.88972879105164 30-34 23.495453152140595 27.6693573107183 27.337284152447122 21.497905384693983 35-39 23.441893757349558 27.982003169896213 27.179303645380642 21.39679942737359 40-44 22.890268301441544 27.91258400451444 27.892063817780745 21.30508387626327 45-49 23.118003491835267 26.887131560028756 28.31467597822738 21.680188969908595 50-54 23.351550130241584 28.081107308851323 27.626538638336996 20.9408039225701 55-59 22.928049839146198 28.095797375274472 27.876219169687992 21.099933615891334 60-64 23.1794505157798 27.535491778163617 28.327035032172404 20.95802267388418 65-69 23.50300928287259 27.909823523411198 28.006732632867486 20.58043456084872 70-74 23.62785492649677 27.564982959458774 27.575156416908285 21.232005697136174 75-79 23.161484044989567 27.975978421293707 27.517939844266888 21.344597689449845 80-84 23.4186900632524 28.009589879616403 27.494388900224443 21.07733115690675 85-89 24.261635998144428 27.812999329931447 27.514045667749087 20.411319004175045 90-94 23.54676743102645 27.59459599358145 27.755059785703196 21.10357678968891 95-99 24.01063503425708 27.819817977298296 27.53349013191533 20.636056856529297 100-104 23.45710496786698 27.889421605630933 27.879220646740794 20.774252779761298 105-109 23.772041911576792 27.65652951699463 27.96319959110657 20.608228980322004 110-114 24.328335295020725 27.490916534465992 27.526738652064893 20.65400951844839 115-119 24.4401367137683 27.429475080344844 27.4192725603224 20.711115645564455 120-124 24.478689858610515 28.023598820058996 27.031838063269248 20.465873258061233 125-129 25.146409123600122 27.607109832528508 26.91873009349635 20.327750950375012 130-134 25.2526310278025 27.31556626001361 27.17943347819258 20.252369233991306 135-139 24.939919893190922 28.16555407209613 27.038718291054742 19.85580774365821 140-144 24.87532523850824 28.436686903729402 26.279271465741544 20.408716392020814 145-149 25.70095906923117 28.090770923955766 27.36229757350244 18.845972433310624 150-151 25.466237942122188 28.270096463022508 26.82958199356913 19.434083601286172 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 61.0 1 34.5 2 4.0 3 0.0 4 0.0 5 0.5 6 2.0 7 1.5 8 1.5 9 1.5 10 0.0 11 1.5 12 2.5 13 1.5 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 0.5 25 0.0 26 0.5 27 3.0 28 5.0 29 6.0 30 9.0 31 12.0 32 16.5 33 31.5 34 50.0 35 58.5 36 70.5 37 90.5 38 121.0 39 159.0 40 188.5 41 219.0 42 256.5 43 272.0 44 277.0 45 291.0 46 284.0 47 263.0 48 242.0 49 207.5 50 167.0 51 133.0 52 104.5 53 88.5 54 69.0 55 47.0 56 40.0 57 35.5 58 25.5 59 19.0 60 14.5 61 9.0 62 6.5 63 3.0 64 2.0 65 2.5 66 1.5 67 2.0 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.925 2 1.4000000000000001 3 1.725 4 2.225 5 2.4250000000000003 6 2.0 7 2.0 8 1.95 9 1.95 10-14 2.11 15-19 2.505 20-24 2.1 25-29 2.105 30-34 2.13 35-39 2.205 40-44 2.535 45-49 2.63 50-54 2.105 55-59 2.085 60-64 2.09 65-69 1.97 70-74 1.7049999999999998 75-79 1.755 80-84 1.9800000000000002 85-89 2.995 90-94 3.405 95-99 2.21 100-104 1.97 105-109 2.175 110-114 2.2950000000000004 115-119 1.9849999999999999 120-124 1.69 125-129 2.67 130-134 4.505 135-139 6.375 140-144 7.76 145-149 4.595 150-151 2.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.38697318007664 97.275 2 0.5108556832694764 1.0 3 0.02554278416347382 0.075 4 0.0 0.0 5 0.05108556832694764 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554278416347382 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 56 1.4000000000000001 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.1375 0.0 0.0 0.0 0.0 124-125 4.675000000000001 0.0 0.0 0.0 0.0 126-127 5.05 0.0 0.0 0.0 0.0 128-129 5.512499999999999 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 7.025 0.0 0.0 0.0 0.0 136-137 7.5625 0.0 0.0 0.0 0.0 138-139 8.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra Read 645696 spots for SRR7170013.sra Written 645696 spots for SRR7170013.sra Read 645683 spots for SRR7170013.sra Written 645683 spots for SRR7170013.sra SRR ids: ['SRR7170013.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_twjr3viy SRR7170013.sra spots: 12913673 blocks: [[1, 645683], [645684, 1291366], [1291367, 1937049], [1937050, 2582732], [2582733, 3228415], [3228416, 3874098], [3874099, 4519781], [4519782, 5165464], [5165465, 5811147], [5811148, 6456830], [6456831, 7102513], [7102514, 7748196], [7748197, 8393879], [8393880, 9039562], [9039563, 9685245], [9685246, 10330928], [10330929, 10976611], [10976612, 11622294], [11622295, 12267977], [12267978, 12913673]] SRR7170013 file size 4354319 SRR7170013 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170013 SRR7170013_1.fastq SRR7170013_2.fastq Input file: SRR7170013_1.fastq Paired file: SRR7170013_2.fastq trimmed: SRR7170013-trimmed-pair1.fastq, SRR7170013-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:48:46 2025 >> started Wed Feb 12 09:49:01 2025 >> done (14.962s) 12913673 read pairs processed; of these: 14224 ( 0.11%) short read pairs filtered out after trimming by size control 24307 ( 0.19%) empty read pairs filtered out after trimming by size control 12875142 (99.70%) read pairs available; of these: 6062070 (47.08%) trimmed read pairs available after processing 6813072 (52.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 0 0.00% 22 2 0.00% 23 6 0.00% 24 3 0.00% 25 3 0.00% 26 5 0.00% 27 5 0.00% 28 11 0.00% 29 1 0.00% 30 4 0.00% 31 9 0.00% 32 3 0.00% 33 8 0.00% 34 11 0.00% 35 11 0.00% 36 25 0.00% 37 9 0.00% 38 12 0.00% 39 23 0.00% 40 25 0.00% 41 32 0.00% 42 32 0.00% 43 37 0.00% 44 29 0.00% 45 49 0.00% 46 34 0.00% 47 53 0.00% 48 48 0.00% 49 77 0.00% 50 78 0.00% 51 105 0.00% 52 122 0.00% 53 102 0.00% 54 122 0.00% 55 142 0.00% 56 156 0.00% 57 193 0.00% 58 232 0.00% 59 238 0.00% 60 264 0.00% 61 327 0.00% 62 343 0.00% 63 422 0.00% 64 476 0.00% 65 527 0.00% 66 565 0.00% 67 623 0.00% 68 749 0.01% 69 860 0.01% 70 1042 0.01% 71 1204 0.01% 72 1334 0.01% 73 1477 0.01% 74 1609 0.01% 75 1755 0.01% 76 1997 0.02% 77 2193 0.02% 78 2325 0.02% 79 2572 0.02% 80 2884 0.02% 81 3389 0.03% 82 3856 0.03% 83 4366 0.03% 84 5343 0.04% 85 6046 0.05% 86 6446 0.05% 87 6863 0.05% 88 7409 0.06% 89 7512 0.06% 90 8122 0.06% 91 8866 0.07% 92 9510 0.07% 93 10555 0.08% 94 11053 0.09% 95 12020 0.09% 96 12230 0.09% 97 12550 0.10% 98 13200 0.10% 99 13611 0.11% 100 14525 0.11% 101 15203 0.12% 102 16275 0.13% 103 17561 0.14% 104 18442 0.14% 105 19577 0.15% 106 19988 0.16% 107 20547 0.16% 108 20652 0.16% 109 21349 0.17% 110 21760 0.17% 111 22951 0.18% 112 23947 0.19% 113 25569 0.20% 114 26782 0.21% 115 27534 0.21% 116 28898 0.22% 117 29327 0.23% 118 29352 0.23% 119 29853 0.23% 120 30328 0.24% 121 31697 0.25% 122 32684 0.25% 123 34408 0.27% 124 36208 0.28% 125 37064 0.29% 126 38515 0.30% 127 39793 0.31% 128 40223 0.31% 129 41473 0.32% 130 42425 0.33% 131 43906 0.34% 132 45892 0.36% 133 48229 0.37% 134 50526 0.39% 135 53236 0.41% 136 56838 0.44% 137 59705 0.46% 138 63616 0.49% 139 68100 0.53% 140 71625 0.56% 141 78237 0.61% 142 84312 0.65% 143 91460 0.71% 144 102989 0.80% 145 118750 0.92% 146 144193 1.12% 147 181981 1.41% 148 267742 2.08% 149 514050 3.99% 150 2871210 22.30% 151 6813072 52.92% 12875142 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=295.62 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=30.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=3.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=283.18 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=29.0 sequence=AAGAAGAAGAAA SRR7170013 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:49:47 Started mapping on | Feb 12 09:49:47 Finished on | Feb 12 09:51:15 Mapping speed, Million of reads per hour | 526.71 Number of input reads | 12875142 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12140134 Uniquely mapped reads % | 94.29% Average mapped length | 292.38 Number of splices: Total | 11711320 Number of splices: Annotated (sjdb) | 11508576 Number of splices: GT/AG | 11535085 Number of splices: GC/AG | 141401 Number of splices: AT/AC | 9394 Number of splices: Non-canonical | 25440 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250193 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 41458 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 497623 497623 497623 N_multimapping 250193 250193 250193 N_noFeature 260523 12014382 318515 N_ambiguous 115859 613 47675 UnstrandedReadsAssigned:11763752 PositiveStrandReadsAssigned:125139 NegativeStrandReadsAssigned:11773944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170013 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170013-trimmed-pair1.fastq SRR7170013-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,875,142 reads, 11,719,095 reads pseudoaligned [quant] estimated average fragment length: 234.129 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR7170013.ke.tsv 34699 SRR7170013.se.tsv 87100 total ==> SRR7170013.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.87 242 11.4426 Potri.005G024800.1.v4.1 1035 801.871 37 3.89416 Potri.004G059700.1.v4.1 961 727.917 16 1.85505 Potri.007G009000.2.v4.1 1416 1182.87 0 0 Potri.003G141000.2.v4.1 2943 2709.87 231.175 7.19961 Potri.016G087400.1.v4.1 270 86.3302 946.533 925.316 Potri.015G069301.1.v4.1 564 336.092 0 0 Potri.010G195200.1.v4.1 1773 1539.87 9 0.493259 Potri.012G127500.1.v4.1 977 743.883 4847 549.902 ==> SRR7170013.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 416 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170013 completed mapping pipeline successfully