Starting /dee2/code/volunteer_pipeline.sh SRR7170014 current disk space = 3049901404160 free memory = 1422989424 SRR7170014 SRAfilesize 34382566d55146848d6ff025ce6f037a SRR7170014.sra SRR7170014.sra file validated SRR7170014 is paired end SRR7170014 is conventional basespace SRR7170014 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170014_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24 34.0 34.0 34.0 33.0 34.0 2 33.557 34.0 34.0 34.0 33.0 34.0 3 33.59025 34.0 34.0 34.0 33.0 34.0 4 33.6475 34.0 34.0 34.0 33.0 34.0 5 33.6195 34.0 34.0 34.0 33.0 34.0 6 37.43225 38.0 38.0 38.0 37.0 38.0 7 37.63675 38.0 38.0 38.0 38.0 38.0 8 37.624 38.0 38.0 38.0 38.0 38.0 9 37.702 38.0 38.0 38.0 38.0 38.0 10-14 37.64855 38.0 38.0 38.0 38.0 38.0 15-19 37.66615 38.0 38.0 38.0 38.0 38.0 20-24 37.65265000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.664100000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.616049999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.5638 38.0 38.0 38.0 38.0 38.0 40-44 37.3909 38.0 38.0 38.0 37.2 38.0 45-49 37.25275 38.0 38.0 38.0 37.0 38.0 50-54 37.298449999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.31145 38.0 38.0 38.0 37.0 38.0 60-64 37.245450000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2045 38.0 38.0 38.0 36.6 38.0 70-74 37.1226 38.0 38.0 38.0 36.0 38.0 75-79 37.0587 38.0 38.0 38.0 36.0 38.0 80-84 37.0108 38.0 38.0 38.0 36.0 38.0 85-89 36.8601 38.0 38.0 38.0 35.8 38.0 90-94 36.652499999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.552949999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.619949999999996 38.0 38.0 38.0 34.8 38.0 105-109 36.506 38.0 38.0 38.0 34.0 38.0 110-114 36.33095 38.0 38.0 38.0 34.0 38.0 115-119 36.163050000000005 38.0 37.6 38.0 33.4 38.0 120-124 36.0105 38.0 37.2 38.0 33.0 38.0 125-129 35.6919 38.0 36.4 38.0 31.8 38.0 130-134 35.278949999999995 38.0 36.0 38.0 30.0 38.0 135-139 34.80405 38.0 35.6 38.0 27.6 38.0 140-144 34.59195 38.0 35.2 38.0 27.6 38.0 145-149 34.020050000000005 38.0 35.0 38.0 25.2 38.0 150-151 30.406 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 2.0 14 1.0 15 3.0 16 0.0 17 1.0 18 3.0 19 4.0 20 5.0 21 4.0 22 6.0 23 3.0 24 12.0 25 18.0 26 20.0 27 23.0 28 23.0 29 18.0 30 31.0 31 44.0 32 40.0 33 82.0 34 127.0 35 210.0 36 620.0 37 2698.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.189873417721515 12.759493670886076 9.670886075949367 36.379746835443036 2 21.125 16.35 33.625 28.9 3 19.0 21.975 27.1 31.924999999999997 4 22.625 29.9 22.825 24.65 5 22.35 32.074999999999996 24.05 21.525 6 19.6 35.75 24.875 19.775000000000002 7 14.7 26.224999999999998 40.849999999999994 18.224999999999998 8 18.675 24.2 31.525 25.6 9 18.125 24.925 33.074999999999996 23.875 10-14 20.349999999999998 28.904999999999998 27.13 23.615 15-19 19.56 28.67 28.215 23.555 20-24 19.845 28.65 27.07 24.435000000000002 25-29 20.27 28.96 27.26 23.51 30-34 19.89 28.904999999999998 27.485 23.72 35-39 19.85 28.725 27.54 23.885 40-44 20.226067820346103 29.05371611483445 27.42822846854056 23.291987596278886 45-49 20.70486789993483 28.460420113300245 27.282298089938333 23.55241389682659 50-54 20.07 28.205000000000002 27.495000000000005 24.23 55-59 20.555 28.389999999999997 27.005000000000003 24.05 60-64 20.424999999999997 28.33 27.51 23.735 65-69 20.41 28.88 26.900000000000002 23.810000000000002 70-74 20.09 28.549999999999997 27.165 24.195 75-79 21.175 27.87 27.6 23.355 80-84 20.119999999999997 28.29 27.595 23.995 85-89 20.560232511525356 28.026658649027862 27.630787733012628 23.782321106434154 90-94 20.595633363517457 28.111480028171847 27.74927055035718 23.543616057953518 95-99 20.181177654755913 28.278812279818823 27.15148465022647 24.388525415198792 100-104 20.55274620737996 28.0578781354829 27.35693185800831 24.032443799128824 105-109 21.015 28.17 27.075 23.74 110-114 21.08029635562675 28.02863436123348 27.05246295554666 23.838606327593112 115-119 21.005 28.585 26.790000000000003 23.62 120-124 20.915 27.805000000000003 27.084999999999997 24.195 125-129 20.95 27.675 27.375 24.0 130-134 20.64144324730644 27.602104735655224 27.83763467802556 23.91881733901278 135-139 20.935836931418816 28.280951902801487 26.99568229741942 23.787528868360276 140-144 21.03996389710675 27.844356415784986 26.836483979341125 24.279195707767137 145-149 21.16068299033599 28.100746081818638 26.54348805768364 24.195082870161734 150-151 20.7625 28.249999999999996 27.075 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.5 25 1.0 26 3.0 27 6.0 28 9.0 29 17.0 30 21.5 31 19.5 32 23.5 33 34.0 34 46.5 35 64.0 36 82.0 37 101.5 38 118.0 39 155.5 40 200.0 41 220.0 42 234.5 43 265.5 44 270.5 45 272.5 46 274.5 47 253.5 48 240.5 49 214.5 50 177.5 51 148.0 52 124.0 53 95.0 54 77.0 55 54.0 56 35.0 57 28.0 58 22.5 59 23.0 60 18.5 61 9.0 62 6.5 63 6.5 64 5.5 65 4.0 66 3.5 67 2.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.03 45-49 0.265 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.22 90-94 0.61 95-99 0.65 100-104 0.135 105-109 0.0 110-114 0.12 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.22499999999999998 135-139 0.41000000000000003 140-144 0.28500000000000003 145-149 0.145 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.2874999999999996 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.1125 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 6.074999999999999 0.0 0.0 0.0 0.0 134-135 6.675 0.0 0.0 0.0 0.0 136-137 7.512499999999999 0.0 0.0 0.0 0.0 138-139 8.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170014 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170014_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.179 33.0 33.0 34.0 32.0 34.0 2 32.315 34.0 33.0 34.0 32.0 34.0 3 32.36575 34.0 33.0 34.0 32.0 34.0 4 32.02625 34.0 33.0 34.0 32.0 34.0 5 32.004 34.0 33.0 34.0 32.0 34.0 6 36.2115 38.0 38.0 38.0 36.0 38.0 7 36.11575 38.0 38.0 38.0 36.0 38.0 8 36.26675 38.0 38.0 38.0 36.0 38.0 9 36.2925 38.0 38.0 38.0 36.0 38.0 10-14 36.16545 38.0 38.0 38.0 36.0 38.0 15-19 35.906150000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.04065 38.0 38.0 38.0 36.0 38.0 25-29 36.100199999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.14405 38.0 38.0 38.0 36.6 38.0 35-39 36.031099999999995 38.0 38.0 38.0 36.0 38.0 40-44 35.888999999999996 38.0 38.0 38.0 36.0 38.0 45-49 35.852 38.0 38.0 38.0 35.8 38.0 50-54 36.03294999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.0407 38.0 38.0 38.0 36.0 38.0 60-64 36.0087 38.0 38.0 38.0 35.8 38.0 65-69 35.9383 38.0 38.0 38.0 35.6 38.0 70-74 35.945049999999995 38.0 38.0 38.0 35.8 38.0 75-79 35.87284999999999 38.0 38.0 38.0 35.2 38.0 80-84 35.78415 38.0 38.0 38.0 34.4 38.0 85-89 35.44195 38.0 38.0 38.0 34.0 38.0 90-94 35.13399999999999 38.0 38.0 38.0 31.4 38.0 95-99 35.40495 38.0 38.0 38.0 32.6 38.0 100-104 35.4551 38.0 38.0 38.0 33.0 38.0 105-109 35.3347 38.0 38.0 38.0 32.6 38.0 110-114 35.1498 38.0 38.0 38.0 30.6 38.0 115-119 35.03585 38.0 38.0 38.0 30.2 38.0 120-124 34.76049999999999 38.0 37.4 38.0 27.4 38.0 125-129 34.3707 38.0 36.8 38.0 25.2 38.0 130-134 33.45105 38.0 36.0 38.0 14.4 38.0 135-139 32.567750000000004 38.0 35.0 38.0 6.4 38.0 140-144 31.704 38.0 33.0 38.0 2.0 38.0 145-149 31.2363 38.0 33.2 38.0 2.0 38.0 150-151 27.478125 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 115.0 3 14.0 4 7.0 5 1.0 6 2.0 7 1.0 8 3.0 9 1.0 10 0.0 11 0.0 12 2.0 13 3.0 14 1.0 15 2.0 16 4.0 17 5.0 18 4.0 19 9.0 20 4.0 21 10.0 22 15.0 23 8.0 24 19.0 25 11.0 26 26.0 27 33.0 28 31.0 29 27.0 30 48.0 31 56.0 32 89.0 33 107.0 34 122.0 35 167.0 36 423.0 37 2630.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.33333333333333 20.53846153846154 13.846153846153847 26.282051282051285 2 28.680203045685282 26.370558375634516 27.96954314720812 16.97969543147208 3 21.005615109749872 28.38182746299132 30.857580398162327 19.754977029096477 4 25.3099173553719 34.27169421487603 20.91942148760331 19.49896694214876 5 24.7737264028963 35.73829842254978 21.04990949056116 18.43806568399276 6 20.205391527599488 37.81771501925545 23.56867779204108 18.40821566110398 7 21.309370988446727 21.28369704749679 37.35558408215661 20.051347881899872 8 21.575166752180603 26.013340174448434 26.680348896870186 25.73114417650077 9 21.586242299794662 25.077002053388092 28.670431211498975 24.666324435318277 10-14 23.12680115273775 28.797859201317415 26.60559901193907 21.469740634005763 15-19 23.41703339373544 28.035205798602124 27.978255242039868 20.569505565622574 20-24 22.355546400247192 27.984344422700584 28.061592337006903 21.598516840045317 25-29 23.523358715785143 28.11792549907388 27.006585717225768 21.35213006791521 30-34 23.181841577024038 28.436872716043027 27.361161150856965 21.02012455607597 35-39 23.491179201485608 28.396781182296504 27.318683586093055 20.793356030124833 40-44 23.91529460494978 28.388733561147355 26.933830382106244 20.762141451796623 45-49 23.613484542488735 27.968515353943346 27.818341877686294 20.599658225881623 50-54 23.58539094650206 27.942386831275723 27.242798353909464 21.229423868312757 55-59 23.813934341875065 27.523927138005554 27.637130801687764 21.025007718431617 60-64 23.15610685058418 27.875855679654126 27.819239281486436 21.148798188275258 65-69 23.48410946244288 27.283462545566568 27.760948811418594 21.471479180571958 70-74 23.242027800490597 27.376328699918233 28.137775960752247 21.24386753883892 75-79 23.628648842083738 27.498594141403814 27.98936659679975 20.883390419712693 80-84 23.38196013971646 27.522087528251486 28.04602424491473 21.04992808711732 85-89 23.46848488002915 27.595898610315935 28.246499765783582 20.689116743871335 90-94 23.91167852658016 27.370238593553786 27.788823775638345 20.92925910422771 95-99 24.02513779426158 27.934888991912636 27.615515376294237 20.424457837531552 100-104 24.317388626565386 27.19154177786902 27.781769657154587 20.709299938411004 105-109 24.427126341866227 28.0088769611891 27.03344343517754 20.530553261767135 110-114 24.1788886593679 27.096674240859326 28.22763891757901 20.49679818219376 115-119 24.002260003081823 28.147311109969696 26.981354974574966 20.86907391237352 120-124 24.419376244193764 26.971568577407997 28.048593742024398 20.560461436373846 125-129 24.70076169749728 28.405616871340484 27.213845276957354 19.67977615420488 130-134 25.173565106788914 27.447135513275743 27.12915363824262 20.250145741692723 135-139 25.148729042725797 27.193077339102217 27.36614386154678 20.292049756625204 140-144 25.170404573438876 28.452066842568165 26.64357959542656 19.733948988566404 145-149 26.21168734754481 28.35401421147524 25.994272987591472 19.440025453388483 150-151 25.58411214953271 28.54361370716511 26.85617860851506 19.016095534787123 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 69.0 1 40.5 2 8.5 3 4.5 4 2.0 5 1.5 6 2.5 7 2.0 8 2.0 9 3.0 10 2.0 11 0.5 12 1.0 13 1.5 14 1.0 15 1.0 16 2.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 1.0 24 1.0 25 1.0 26 3.0 27 5.0 28 4.0 29 4.0 30 5.0 31 11.0 32 17.0 33 23.0 34 39.5 35 54.0 36 70.5 37 98.0 38 124.5 39 149.5 40 187.5 41 228.5 42 260.0 43 279.0 44 279.5 45 274.5 46 271.5 47 256.5 48 240.5 49 220.5 50 174.5 51 145.5 52 118.5 53 84.5 54 65.0 55 45.0 56 30.0 57 23.0 58 19.0 59 14.5 60 13.0 61 13.5 62 9.0 63 3.0 64 3.0 65 3.5 66 4.5 67 2.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.5 2 1.5 3 2.0500000000000003 4 3.2 5 3.325 6 2.625 7 2.625 8 2.55 9 2.6 10-14 2.8400000000000003 15-19 3.4250000000000003 20-24 2.91 25-29 2.82 30-34 2.855 35-39 3.0700000000000003 40-44 3.4299999999999997 45-49 3.4450000000000003 50-54 2.8000000000000003 55-59 2.83 60-64 2.855 65-69 2.6149999999999998 70-74 2.16 75-79 2.1950000000000003 80-84 2.6599999999999997 85-89 3.9350000000000005 90-94 4.44 95-99 2.935 100-104 2.58 105-109 3.1199999999999997 110-114 3.18 115-119 2.6550000000000002 120-124 2.045 125-129 3.505 130-134 5.655 135-139 7.55 140-144 9.04 145-149 5.71 150-151 3.6999999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.48809828512925 97.175 2 0.3583312004095214 0.7000000000000001 3 0.05119017148707448 0.15 4 0.0 0.0 5 0.02559508574353724 0.125 6 0.02559508574353724 0.15 7 0.0 0.0 8 0.02559508574353724 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.02559508574353724 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 60 1.5 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.237500000000001 0.0 0.0 0.0 0.0 132-133 5.762499999999999 0.0 0.0 0.0 0.0 134-135 6.325 0.0 0.0 0.0 0.0 136-137 7.05 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACCCC 10 0.0070683053 143.3291 3 >>END_MODULE Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712452 spots for SRR7170014.sra Written 712452 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra Read 712442 spots for SRR7170014.sra Written 712442 spots for SRR7170014.sra SRR ids: ['SRR7170014.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2wmgl32r SRR7170014.sra spots: 14248850 blocks: [[1, 712442], [712443, 1424884], [1424885, 2137326], [2137327, 2849768], [2849769, 3562210], [3562211, 4274652], [4274653, 4987094], [4987095, 5699536], [5699537, 6411978], [6411979, 7124420], [7124421, 7836862], [7836863, 8549304], [8549305, 9261746], [9261747, 9974188], [9974189, 10686630], [10686631, 11399072], [11399073, 12111514], [12111515, 12823956], [12823957, 13536398], [13536399, 14248850]] SRR7170014 file size 4806767 SRR7170014 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170014 SRR7170014_1.fastq SRR7170014_2.fastq Input file: SRR7170014_1.fastq Paired file: SRR7170014_2.fastq trimmed: SRR7170014-trimmed-pair1.fastq, SRR7170014-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:06:59 2025 >> started Wed Feb 12 10:07:14 2025 >> done (15.140s) 14248850 read pairs processed; of these: 18561 ( 0.13%) short read pairs filtered out after trimming by size control 30093 ( 0.21%) empty read pairs filtered out after trimming by size control 14200196 (99.66%) read pairs available; of these: 6834074 (48.13%) trimmed read pairs available after processing 7366122 (51.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 7 0.00% 21 7 0.00% 22 4 0.00% 23 8 0.00% 24 39 0.00% 25 4 0.00% 26 8 0.00% 27 14 0.00% 28 7 0.00% 29 11 0.00% 30 11 0.00% 31 16 0.00% 32 12 0.00% 33 15 0.00% 34 18 0.00% 35 16 0.00% 36 13 0.00% 37 14 0.00% 38 19 0.00% 39 22 0.00% 40 30 0.00% 41 26 0.00% 42 44 0.00% 43 26 0.00% 44 45 0.00% 45 41 0.00% 46 30 0.00% 47 51 0.00% 48 61 0.00% 49 64 0.00% 50 81 0.00% 51 94 0.00% 52 110 0.00% 53 137 0.00% 54 134 0.00% 55 154 0.00% 56 138 0.00% 57 177 0.00% 58 215 0.00% 59 231 0.00% 60 266 0.00% 61 320 0.00% 62 379 0.00% 63 436 0.00% 64 428 0.00% 65 446 0.00% 66 498 0.00% 67 605 0.00% 68 754 0.01% 69 962 0.01% 70 1074 0.01% 71 1120 0.01% 72 1257 0.01% 73 1376 0.01% 74 1519 0.01% 75 1681 0.01% 76 1724 0.01% 77 1999 0.01% 78 2090 0.01% 79 2401 0.02% 80 2630 0.02% 81 3164 0.02% 82 3667 0.03% 83 4238 0.03% 84 5368 0.04% 85 6294 0.04% 86 6438 0.05% 87 6598 0.05% 88 7109 0.05% 89 7402 0.05% 90 8194 0.06% 91 8997 0.06% 92 9712 0.07% 93 10778 0.08% 94 11761 0.08% 95 12505 0.09% 96 13067 0.09% 97 13601 0.10% 98 13535 0.10% 99 14258 0.10% 100 15223 0.11% 101 16198 0.11% 102 17512 0.12% 103 19051 0.13% 104 20190 0.14% 105 21084 0.15% 106 21749 0.15% 107 22206 0.16% 108 22664 0.16% 109 23472 0.17% 110 23970 0.17% 111 25154 0.18% 112 26942 0.19% 113 28363 0.20% 114 30044 0.21% 115 31638 0.22% 116 32613 0.23% 117 33085 0.23% 118 33104 0.23% 119 33672 0.24% 120 34473 0.24% 121 35519 0.25% 122 37973 0.27% 123 39613 0.28% 124 41772 0.29% 125 43505 0.31% 126 45228 0.32% 127 46184 0.33% 128 46950 0.33% 129 48314 0.34% 130 49068 0.35% 131 51136 0.36% 132 53572 0.38% 133 56436 0.40% 134 59386 0.42% 135 63145 0.44% 136 66578 0.47% 137 70304 0.50% 138 75324 0.53% 139 80523 0.57% 140 83147 0.59% 141 91045 0.64% 142 98475 0.69% 143 107696 0.76% 144 121711 0.86% 145 140316 0.99% 146 169428 1.19% 147 213052 1.50% 148 310841 2.19% 149 588696 4.15% 150 3173909 22.35% 151 7366122 51.87% 14200196 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=12.27 fanout-score-rank=11 prefix-density=0.30 prefix-fanout=6.6 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=249.35 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=41 prefix-density=0.29 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=272.44 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=27.0 sequence=GAAGAAGAAGAAA SRR7170014 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:07:55 Started mapping on | Feb 12 10:07:55 Finished on | Feb 12 10:09:09 Mapping speed, Million of reads per hour | 690.82 Number of input reads | 14200196 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13514441 Uniquely mapped reads % | 95.17% Average mapped length | 292.36 Number of splices: Total | 12943466 Number of splices: Annotated (sjdb) | 12722983 Number of splices: GT/AG | 12744126 Number of splices: GC/AG | 157791 Number of splices: AT/AC | 10113 Number of splices: Non-canonical | 31436 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254077 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 41157 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448132 448132 448132 N_multimapping 254077 254077 254077 N_noFeature 269420 13361643 342108 N_ambiguous 133838 663 53317 UnstrandedReadsAssigned:13111183 PositiveStrandReadsAssigned:152135 NegativeStrandReadsAssigned:13119016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170014 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170014-trimmed-pair1.fastq SRR7170014-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,200,196 reads, 13,045,360 reads pseudoaligned [quant] estimated average fragment length: 233.151 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 SRR7170014.ke.tsv 34699 SRR7170014.se.tsv 87100 total ==> SRR7170014.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.85 231 10.1131 Potri.005G024800.1.v4.1 1035 802.849 28 2.72671 Potri.004G059700.1.v4.1 961 728.935 12 1.28709 Potri.007G009000.2.v4.1 1416 1183.85 0 0 Potri.003G141000.2.v4.1 2943 2710.85 241.032 6.95159 Potri.016G087400.1.v4.1 270 86.9338 1552.59 1396.32 Potri.015G069301.1.v4.1 564 338.015 0 0 Potri.010G195200.1.v4.1 1773 1540.85 15 0.761108 Potri.012G127500.1.v4.1 977 744.895 4449 466.963 ==> SRR7170014.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 892 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170014 completed mapping pipeline successfully