Starting /dee2/code/volunteer_pipeline.sh SRR7170016 current disk space = 3050539429888 free memory = 1419437992 SRR7170016 SRAfilesize 6e169b223e36ed00cdbb8ee61e2f94d7 SRR7170016.sra SRR7170016.sra file validated SRR7170016 is paired end SRR7170016 is conventional basespace SRR7170016 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170016_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22525 34.0 34.0 34.0 33.0 34.0 2 33.56 34.0 34.0 34.0 33.0 34.0 3 33.63225 34.0 34.0 34.0 33.0 34.0 4 33.667 34.0 34.0 34.0 33.0 34.0 5 33.64875 34.0 34.0 34.0 33.0 34.0 6 37.39175 38.0 38.0 38.0 37.0 38.0 7 37.5455 38.0 38.0 38.0 38.0 38.0 8 37.6445 38.0 38.0 38.0 38.0 38.0 9 37.7155 38.0 38.0 38.0 38.0 38.0 10-14 37.679950000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.662400000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.65185 38.0 38.0 38.0 38.0 38.0 25-29 37.5416 38.0 38.0 38.0 38.0 38.0 30-34 37.57025 38.0 38.0 38.0 38.0 38.0 35-39 37.5205 38.0 38.0 38.0 38.0 38.0 40-44 37.37435000000001 38.0 38.0 38.0 37.6 38.0 45-49 37.29795 38.0 38.0 38.0 37.0 38.0 50-54 37.34225 38.0 38.0 38.0 37.0 38.0 55-59 37.296949999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.29365 38.0 38.0 38.0 37.0 38.0 65-69 37.2614 38.0 38.0 38.0 37.0 38.0 70-74 37.20895 38.0 38.0 38.0 36.8 38.0 75-79 37.015550000000005 38.0 38.0 38.0 36.2 38.0 80-84 36.91405 38.0 38.0 38.0 36.0 38.0 85-89 36.842949999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.693949999999994 38.0 38.0 38.0 35.8 38.0 95-99 36.52245 38.0 38.0 38.0 35.2 38.0 100-104 36.557550000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.45055 38.0 38.0 38.0 34.6 38.0 110-114 36.2498 38.0 38.0 38.0 34.0 38.0 115-119 36.111650000000004 38.0 38.0 38.0 34.0 38.0 120-124 35.98395 38.0 38.0 38.0 33.8 38.0 125-129 35.630849999999995 38.0 37.2 38.0 31.6 38.0 130-134 35.32385 38.0 36.6 38.0 30.4 38.0 135-139 35.084649999999996 38.0 36.0 38.0 29.8 38.0 140-144 34.8153 38.0 36.0 38.0 28.2 38.0 145-149 34.2474 38.0 35.2 38.0 26.6 38.0 150-151 31.0435 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 3.0 15 3.0 16 2.0 17 5.0 18 6.0 19 11.0 20 3.0 21 5.0 22 6.0 23 11.0 24 12.0 25 13.0 26 13.0 27 21.0 28 25.0 29 21.0 30 34.0 31 43.0 32 49.0 33 60.0 34 90.0 35 155.0 36 463.0 37 2940.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.51367781155015 13.576494427558258 12.082066869300911 34.82776089159068 2 22.475 15.325 32.1 30.099999999999998 3 19.5 19.85 26.775 33.875 4 21.825 25.775 24.15 28.249999999999996 5 21.224999999999998 30.475 24.4 23.9 6 21.525 33.175 25.174999999999997 20.125 7 16.075 29.95 36.75 17.224999999999998 8 17.925 29.675 29.75 22.650000000000002 9 16.6 28.050000000000004 31.974999999999998 23.375 10-14 18.9 31.19 27.18 22.73 15-19 18.605 30.81 27.415 23.169999999999998 20-24 18.595 30.775000000000002 27.08 23.549999999999997 25-29 19.13 30.885 27.07 22.915 30-34 19.275000000000002 30.509999999999998 27.310000000000002 22.905 35-39 19.11 29.770000000000003 27.389999999999997 23.73 40-44 19.405 30.555 26.935 23.105 45-49 19.265779733920176 29.763929178753628 27.603280984295285 23.367010103030907 50-54 19.115 29.970000000000002 27.12 23.794999999999998 55-59 19.34 29.615000000000002 26.97 24.075 60-64 19.1 30.055 27.005000000000003 23.84 65-69 18.86 30.36 27.04 23.74 70-74 19.869999999999997 30.044999999999998 26.615 23.47 75-79 19.455 29.64 26.76 24.145 80-84 19.650000000000002 29.895 26.745 23.71 85-89 19.85883059671606 29.540448538245894 26.636964357228678 23.96375650780937 90-94 20.31744437189211 29.619769953287456 26.400120548495654 23.66266512632478 95-99 19.789050728277246 29.316926167754897 27.388247112004017 23.505775991963837 100-104 20.297103986395236 29.10018506477267 26.87440604211474 23.72830490671735 105-109 20.145 28.965000000000003 27.150000000000002 23.74 110-114 20.19 29.104999999999997 26.955000000000002 23.75 115-119 20.146043813143944 28.593578073422027 27.18815644693408 24.07222166649995 120-124 19.955000000000002 28.645 27.215 24.185000000000002 125-129 20.71 28.34 26.595000000000002 24.355 130-134 21.05763934097852 28.519204767389457 26.856627773048224 23.566528118583804 135-139 20.451467268623023 28.954100827689995 26.109857035364936 24.484574868322046 140-144 20.909045402212545 28.057265855734094 26.785803674225363 24.247885067828 145-149 20.59191747208173 28.539235815514047 26.52611547899244 24.342731233411786 150-151 20.7625 28.5625 26.4625 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 1.0 19 1.5 20 2.0 21 1.0 22 1.5 23 2.5 24 3.0 25 3.5 26 3.5 27 5.5 28 12.0 29 20.0 30 22.5 31 32.5 32 54.5 33 70.0 34 79.5 35 97.0 36 116.5 37 133.0 38 153.5 39 174.5 40 194.0 41 217.5 42 233.0 43 253.0 44 268.0 45 255.0 46 231.5 47 214.5 48 206.5 49 192.0 50 163.0 51 122.0 52 94.5 53 83.0 54 71.0 55 51.0 56 34.0 57 30.0 58 25.0 59 18.5 60 16.0 61 11.5 62 5.5 63 3.0 64 2.5 65 1.5 66 1.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.12 90-94 0.455 95-99 0.44999999999999996 100-104 0.034999999999999996 105-109 0.0 110-114 0.0 115-119 0.03 120-124 0.0 125-129 0.0 130-134 0.155 135-139 0.325 140-144 0.11499999999999999 145-149 0.155 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49643221202854 96.625 2 1.4271151885830784 2.8000000000000003 3 0.05096839959225281 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAGCTATCTCGTATGC 17 0.42500000000000004 TruSeq Adapter, Index 3 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.2875 0.0 0.0 0.0 0.0 110-111 2.5374999999999996 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.275 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.8125 0.0 0.0 0.0 0.0 124-125 5.300000000000001 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.475 0.0 0.0 0.0 0.0 130-131 7.0125 0.0 0.0 0.0 0.0 132-133 7.5375 0.0 0.0 0.0 0.0 134-135 8.100000000000001 0.0 0.0 0.0 0.0 136-137 8.55 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAGAC 10 0.0063298983 148.6923 1 >>END_MODULE SRR7170016 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170016_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.374 33.0 33.0 34.0 32.0 34.0 2 32.44875 34.0 33.0 34.0 32.0 34.0 3 32.43025 34.0 33.0 34.0 32.0 34.0 4 32.279 34.0 33.0 34.0 32.0 34.0 5 32.2375 34.0 33.0 34.0 32.0 34.0 6 36.253 38.0 38.0 38.0 36.0 38.0 7 36.253 38.0 38.0 38.0 37.0 38.0 8 36.262 38.0 38.0 38.0 37.0 38.0 9 36.2335 38.0 38.0 38.0 37.0 38.0 10-14 36.145050000000005 38.0 38.0 38.0 36.6 38.0 15-19 36.006350000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.081450000000004 38.0 38.0 38.0 36.4 38.0 25-29 36.2042 38.0 38.0 38.0 37.0 38.0 30-34 36.18235 38.0 38.0 38.0 37.0 38.0 35-39 36.0109 38.0 38.0 38.0 36.2 38.0 40-44 35.920750000000005 38.0 38.0 38.0 36.4 38.0 45-49 35.8529 38.0 38.0 38.0 36.0 38.0 50-54 36.058949999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.03435 38.0 38.0 38.0 36.0 38.0 60-64 35.9653 38.0 38.0 38.0 36.0 38.0 65-69 35.97345 38.0 38.0 38.0 36.0 38.0 70-74 35.863550000000004 38.0 38.0 38.0 35.8 38.0 75-79 35.77695 38.0 38.0 38.0 35.6 38.0 80-84 35.7338 38.0 38.0 38.0 34.8 38.0 85-89 35.3462 38.0 38.0 38.0 33.6 38.0 90-94 35.0986 38.0 38.0 38.0 32.2 38.0 95-99 35.342999999999996 38.0 38.0 38.0 32.6 38.0 100-104 35.47085 38.0 38.0 38.0 34.0 38.0 105-109 35.37904999999999 38.0 38.0 38.0 33.6 38.0 110-114 35.27825 38.0 38.0 38.0 33.0 38.0 115-119 35.114399999999996 38.0 38.0 38.0 31.2 38.0 120-124 34.9713 38.0 38.0 38.0 31.0 38.0 125-129 34.5315 38.0 37.2 38.0 26.6 38.0 130-134 33.57445 38.0 36.0 38.0 16.0 38.0 135-139 32.7059 38.0 35.2 38.0 4.2 38.0 140-144 31.8856 38.0 34.0 38.0 2.0 38.0 145-149 31.5507 38.0 33.4 38.0 2.0 38.0 150-151 28.2075 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 121.0 3 6.0 4 3.0 5 4.0 6 0.0 7 3.0 8 3.0 9 0.0 10 4.0 11 3.0 12 1.0 13 6.0 14 6.0 15 3.0 16 6.0 17 18.0 18 7.0 19 5.0 20 9.0 21 8.0 22 11.0 23 13.0 24 12.0 25 6.0 26 19.0 27 20.0 28 22.0 29 37.0 30 36.0 31 52.0 32 87.0 33 84.0 34 98.0 35 140.0 36 372.0 37 2775.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.88692760296751 20.00511639805577 16.75620363264262 25.3517523663341 2 27.623888182973317 27.92884371029225 28.081321473951714 16.36594663278272 3 22.038216560509554 28.611464968152866 30.573248407643312 18.777070063694268 4 24.429633427326326 33.17098179953858 24.070751089464242 18.32863368367085 5 25.52699228791774 33.67609254498715 23.239074550128535 17.55784061696658 6 22.105263157894736 35.45571245186136 24.159178433889604 18.2798459563543 7 21.03235747303544 23.061119671289163 36.23523369286082 19.67128916281459 8 23.260590500641847 26.213093709884465 26.49550706033376 24.030808729139924 9 21.71238144065624 26.557293001794413 29.018200461420147 22.7121250961292 10-14 24.240395509321246 28.792872592440006 25.908950458337625 21.05778143990112 15-19 23.716191756735792 27.899881057040904 27.460309251693644 20.92361793452966 20-24 24.49084815674143 28.306264501160094 26.72338231502965 20.479505027068832 25-29 24.063045487216346 28.103501386179282 27.11263990142725 20.720813225177125 30-34 23.991169524591847 27.379607762603964 27.939213471608994 20.690009241195195 35-39 23.635331751109277 28.14467031266123 27.350118666804253 20.86987926942524 40-44 24.39567265386407 27.87928981831358 27.273668409337958 20.451369118484394 45-49 24.0774287045184 28.145541121059985 27.24496661663475 20.532063557786863 50-54 24.16431322207959 28.569961489088573 27.25032092426187 20.01540436456996 55-59 23.957263201150607 28.123073762071094 27.496404355866037 20.423258680912266 60-64 23.371608053138353 28.860511817105195 27.408475361721845 20.359404768034604 65-69 23.727594884700324 28.87370961943403 27.461352781059013 19.937342714806636 70-74 24.219309921163102 27.94102590355278 27.541722125524725 20.297942049759392 75-79 24.06261189830682 27.735434037546682 27.566627448974373 20.63532661517213 80-84 24.359631147540984 27.73053278688525 27.920081967213118 19.989754098360656 85-89 23.929536478902516 27.806069424236124 28.23217626273124 20.032217834130115 90-94 23.9663812904573 27.91814575067864 28.54458133221967 19.570891626644393 95-99 24.078169195165852 27.42607354075598 28.737464643867316 19.758292620210852 100-104 23.752628070355367 27.78319060560997 29.075432029126713 19.388749294907953 105-109 24.356405117928166 27.485740712193618 28.22054365140538 19.93731051847284 110-114 24.259868421052634 27.508223684210524 27.950246710526315 20.281661184210524 115-119 24.64658881376767 27.786314279860687 28.144847367342756 19.422249539028886 120-124 24.530228758169933 27.813521241830063 28.375204248366014 19.28104575163399 125-129 24.8851019881229 27.64265427317325 27.761425251742832 19.710818486961013 130-134 24.856900572397713 27.45919016323935 27.983888064447743 19.7000211999152 135-139 24.924552705324423 27.51131709420134 28.292735503341238 19.271394697133005 140-144 25.864045864045863 27.97160797160797 27.305487305487308 18.85885885885886 145-149 25.493421052631575 28.358446519524616 27.22304753820034 18.925084889643465 150-151 25.597092419522326 27.946521287642785 27.77777777777778 18.678608515057114 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 76.0 1 41.5 2 5.0 3 4.5 4 3.5 5 0.5 6 1.5 7 2.0 8 1.0 9 0.5 10 0.5 11 1.0 12 2.0 13 1.5 14 0.0 15 0.0 16 2.0 17 2.5 18 1.5 19 1.5 20 0.5 21 1.0 22 1.5 23 2.5 24 4.5 25 6.5 26 5.5 27 5.5 28 9.0 29 9.0 30 8.0 31 11.0 32 21.5 33 29.0 34 38.5 35 56.5 36 71.0 37 89.0 38 109.5 39 148.0 40 190.0 41 214.0 42 250.5 43 281.5 44 281.5 45 287.5 46 287.5 47 255.0 48 226.0 49 199.5 50 186.0 51 162.0 52 112.0 53 83.0 54 66.0 55 49.5 56 34.5 57 28.0 58 23.5 59 13.0 60 5.5 61 4.0 62 4.0 63 4.0 64 4.5 65 2.5 66 2.0 67 2.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.275 2 1.625 3 1.875 4 2.475 5 2.75 6 2.625 7 2.65 8 2.625 9 2.475 10-14 2.91 15-19 3.315 20-24 3.025 25-29 2.6100000000000003 30-34 2.6100000000000003 35-39 3.09 40-44 3.405 45-49 3.395 50-54 2.625 55-59 2.6599999999999997 60-64 2.895 65-69 2.645 70-74 2.33 75-79 2.255 80-84 2.4 85-89 3.7800000000000002 90-94 4.22 95-99 2.775 100-104 2.495 105-109 2.6950000000000003 110-114 2.7199999999999998 115-119 2.3800000000000003 120-124 2.08 125-129 3.175 130-134 5.66 135-139 7.22 140-144 8.425 145-149 5.76 150-151 3.6999999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5248447204969 95.175 2 1.3716356107660457 2.65 3 0.0 0.0 4 0.051759834368530024 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025879917184265012 0.35000000000000003 >50 0.025879917184265012 1.625 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 65 1.625 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.35 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.1 0.0 0.0 0.0 0.0 120-121 4.65 0.0 0.0 0.0 0.0 122-123 5.074999999999999 0.0 0.0 0.0 0.0 124-125 5.612500000000001 0.0 0.0 0.0 0.0 126-127 6.074999999999999 0.0 0.0 0.0 0.0 128-129 6.7375 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.675000000000001 0.0 0.0 0.0 0.0 134-135 8.225000000000001 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGGC 10 0.0068711266 144.61842 7 ACAGGCC 10 0.0068711266 144.61842 8 ATACAGG 10 0.0068711266 144.61842 6 >>END_MODULE Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 738000 spots for SRR7170016.sra Written 738000 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra Read 737994 spots for SRR7170016.sra Written 737994 spots for SRR7170016.sra SRR ids: ['SRR7170016.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6gyio_v3 SRR7170016.sra spots: 14759886 blocks: [[1, 737994], [737995, 1475988], [1475989, 2213982], [2213983, 2951976], [2951977, 3689970], [3689971, 4427964], [4427965, 5165958], [5165959, 5903952], [5903953, 6641946], [6641947, 7379940], [7379941, 8117934], [8117935, 8855928], [8855929, 9593922], [9593923, 10331916], [10331917, 11069910], [11069911, 11807904], [11807905, 12545898], [12545899, 13283892], [13283893, 14021886], [14021887, 14759886]] SRR7170016 file size 4979940 SRR7170016 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170016 SRR7170016_1.fastq SRR7170016_2.fastq Input file: SRR7170016_1.fastq Paired file: SRR7170016_2.fastq trimmed: SRR7170016-trimmed-pair1.fastq, SRR7170016-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:12:58 2025 >> started Wed Feb 12 10:13:14 2025 >> done (16.352s) 14759886 read pairs processed; of these: 38523 ( 0.26%) short read pairs filtered out after trimming by size control 109881 ( 0.74%) empty read pairs filtered out after trimming by size control 14611482 (98.99%) read pairs available; of these: 6821652 (46.69%) trimmed read pairs available after processing 7789830 (53.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 19 0.00% 21 13 0.00% 22 18 0.00% 23 14 0.00% 24 23 0.00% 25 20 0.00% 26 17 0.00% 27 28 0.00% 28 20 0.00% 29 16 0.00% 30 18 0.00% 31 32 0.00% 32 29 0.00% 33 28 0.00% 34 21 0.00% 35 32 0.00% 36 34 0.00% 37 40 0.00% 38 39 0.00% 39 47 0.00% 40 48 0.00% 41 56 0.00% 42 51 0.00% 43 60 0.00% 44 89 0.00% 45 102 0.00% 46 119 0.00% 47 137 0.00% 48 134 0.00% 49 145 0.00% 50 182 0.00% 51 195 0.00% 52 238 0.00% 53 243 0.00% 54 264 0.00% 55 253 0.00% 56 282 0.00% 57 330 0.00% 58 371 0.00% 59 382 0.00% 60 453 0.00% 61 500 0.00% 62 526 0.00% 63 701 0.00% 64 784 0.01% 65 873 0.01% 66 1100 0.01% 67 1489 0.01% 68 1650 0.01% 69 2857 0.02% 70 4559 0.03% 71 2995 0.02% 72 2433 0.02% 73 2439 0.02% 74 2498 0.02% 75 2812 0.02% 76 2940 0.02% 77 3107 0.02% 78 3436 0.02% 79 3774 0.03% 80 4369 0.03% 81 4790 0.03% 82 5435 0.04% 83 6071 0.04% 84 8673 0.06% 85 9967 0.07% 86 10458 0.07% 87 11264 0.08% 88 11958 0.08% 89 12531 0.09% 90 12870 0.09% 91 13243 0.09% 92 14345 0.10% 93 15044 0.10% 94 16034 0.11% 95 17184 0.12% 96 17984 0.12% 97 18721 0.13% 98 19457 0.13% 99 19656 0.13% 100 20715 0.14% 101 21762 0.15% 102 23046 0.16% 103 24254 0.17% 104 25753 0.18% 105 26986 0.18% 106 27834 0.19% 107 28615 0.20% 108 29368 0.20% 109 30359 0.21% 110 31090 0.21% 111 31967 0.22% 112 32921 0.23% 113 34872 0.24% 114 35925 0.25% 115 37719 0.26% 116 38445 0.26% 117 39805 0.27% 118 40074 0.27% 119 40332 0.28% 120 41382 0.28% 121 41977 0.29% 122 43818 0.30% 123 44922 0.31% 124 47498 0.33% 125 48560 0.33% 126 50763 0.35% 127 51870 0.35% 128 53058 0.36% 129 53840 0.37% 130 55292 0.38% 131 56532 0.39% 132 59192 0.41% 133 61338 0.42% 134 63475 0.43% 135 66306 0.45% 136 69452 0.48% 137 73565 0.50% 138 76387 0.52% 139 81157 0.56% 140 85946 0.59% 141 90757 0.62% 142 96611 0.66% 143 104305 0.71% 144 118110 0.81% 145 128656 0.88% 146 149509 1.02% 147 195009 1.33% 148 292885 2.00% 149 523294 3.58% 150 2978160 20.38% 151 7789830 53.31% 14611482 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=7.08 fanout-score-rank=15 prefix-density=0.30 prefix-fanout=5.0 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=59.36 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.7 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.62 fanout-score-rank=20 prefix-density=0.35 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.08 sequence-density-rank=34 fanout-score=45.77 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=9.2 sequence=TTCTTCATTGCCCTCCAACCCTAGCTCAGTCACCAGCTGCAGCCCCAGCACCACC SRR7170016 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:13:55 Started mapping on | Feb 12 10:13:55 Finished on | Feb 12 10:15:25 Mapping speed, Million of reads per hour | 584.46 Number of input reads | 14611482 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13786793 Uniquely mapped reads % | 94.36% Average mapped length | 290.79 Number of splices: Total | 11513819 Number of splices: Annotated (sjdb) | 11284399 Number of splices: GT/AG | 11340251 Number of splices: GC/AG | 136310 Number of splices: AT/AC | 9782 Number of splices: Non-canonical | 27476 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256157 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 35787 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 600061 600061 600061 N_multimapping 256157 256157 256157 N_noFeature 331360 13592981 417080 N_ambiguous 162142 739 53714 UnstrandedReadsAssigned:13293291 PositiveStrandReadsAssigned:193073 NegativeStrandReadsAssigned:13315999 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170016 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170016-trimmed-pair1.fastq SRR7170016-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,611,482 reads, 13,306,821 reads pseudoaligned [quant] estimated average fragment length: 217.734 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7170016.ke.tsv 34699 SRR7170016.se.tsv 87100 total ==> SRR7170016.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.27 312 11.0749 Potri.005G024800.1.v4.1 1035 818.266 32 2.50044 Potri.004G059700.1.v4.1 961 744.276 8 0.687255 Potri.007G009000.2.v4.1 1416 1199.27 0 0 Potri.003G141000.2.v4.1 2943 2726.27 249 5.83973 Potri.016G087400.1.v4.1 270 87.3784 1581.82 1157.48 Potri.015G069301.1.v4.1 564 349.166 0 0 Potri.010G195200.1.v4.1 1773 1556.27 30 1.23253 Potri.012G127500.1.v4.1 977 760.276 5164 434.287 ==> SRR7170016.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1096 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170016 completed mapping pipeline successfully