Starting /dee2/code/volunteer_pipeline.sh SRR7170017 current disk space = 3051336093696 free memory = 1576547728 SRR7170017 SRAfilesize 15ba794cc2774857059add83a8549786 SRR7170017.sra SRR7170017.sra file validated SRR7170017 is paired end SRR7170017 is conventional basespace SRR7170017 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170017_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.942 34.0 33.0 34.0 33.0 34.0 2 33.4075 34.0 34.0 34.0 33.0 34.0 3 33.45925 34.0 34.0 34.0 33.0 34.0 4 33.51975 34.0 34.0 34.0 33.0 34.0 5 33.50875 34.0 34.0 34.0 33.0 34.0 6 37.31675 38.0 38.0 38.0 36.0 38.0 7 37.512 38.0 38.0 38.0 37.0 38.0 8 37.58075 38.0 38.0 38.0 38.0 38.0 9 37.59225 38.0 38.0 38.0 38.0 38.0 10-14 37.6166 38.0 38.0 38.0 38.0 38.0 15-19 37.56855 38.0 38.0 38.0 38.0 38.0 20-24 37.5409 38.0 38.0 38.0 38.0 38.0 25-29 37.564949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.525400000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.449400000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.28235 38.0 38.0 38.0 37.0 38.0 45-49 37.222449999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.16435 38.0 38.0 38.0 36.0 38.0 55-59 37.086 38.0 38.0 38.0 36.0 38.0 60-64 37.02635 38.0 38.0 38.0 36.0 38.0 65-69 36.94035 38.0 38.0 38.0 35.8 38.0 70-74 36.872550000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.73965 38.0 38.0 38.0 34.8 38.0 80-84 36.6463 38.0 38.0 38.0 35.0 38.0 85-89 36.50195000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.41485 38.0 38.0 38.0 34.0 38.0 95-99 36.1713 38.0 38.0 38.0 33.8 38.0 100-104 36.09815 38.0 37.2 38.0 33.4 38.0 105-109 35.977999999999994 38.0 37.0 38.0 32.6 38.0 110-114 35.82195 38.0 37.0 38.0 32.2 38.0 115-119 35.55185 38.0 36.6 38.0 31.4 38.0 120-124 35.31595 38.0 36.0 38.0 30.0 38.0 125-129 34.9975 38.0 36.0 38.0 28.0 38.0 130-134 34.49765 38.0 35.0 38.0 25.6 38.0 135-139 34.168949999999995 38.0 35.0 38.0 23.8 38.0 140-144 33.89015 38.0 35.0 38.0 22.2 38.0 145-149 33.014100000000006 38.0 33.4 38.0 16.6 38.0 150-151 28.937375 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 0.0 13 0.0 14 8.0 15 4.0 16 2.0 17 0.0 18 4.0 19 8.0 20 5.0 21 8.0 22 6.0 23 4.0 24 10.0 25 20.0 26 16.0 27 32.0 28 21.0 29 39.0 30 45.0 31 64.0 32 53.0 33 110.0 34 163.0 35 264.0 36 731.0 37 2379.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.28299008390542 12.255275870836511 10.043224002034071 38.418510043224 2 21.625 15.15 33.925 29.299999999999997 3 19.3 19.125 27.275 34.300000000000004 4 23.599999999999998 28.375 22.95 25.074999999999996 5 24.125 30.575000000000003 23.200000000000003 22.1 6 20.075000000000003 34.825 25.074999999999996 20.025000000000002 7 14.875 27.3 40.699999999999996 17.125 8 18.9 24.45 30.175 26.474999999999998 9 16.725 24.55 34.375 24.349999999999998 10-14 20.080000000000002 29.505 27.0 23.415 15-19 20.34 28.060000000000002 27.97 23.630000000000003 20-24 20.119999999999997 28.985 27.33 23.565 25-29 20.345 28.765 27.275 23.615 30-34 20.305 28.615000000000002 27.3 23.78 35-39 20.685000000000002 28.125 27.26 23.93 40-44 20.23 28.599999999999998 27.685 23.485 45-49 20.880000000000003 28.175 27.255000000000003 23.69 50-54 20.555 28.305000000000003 27.529999999999998 23.61 55-59 20.865000000000002 28.01 27.150000000000002 23.974999999999998 60-64 20.064999999999998 29.080000000000002 26.884999999999998 23.97 65-69 19.96 28.410000000000004 27.48 24.15 70-74 19.88 28.715000000000003 27.405 24.0 75-79 20.150000000000002 28.525 27.405 23.919999999999998 80-84 20.68 27.894999999999996 27.425 24.0 85-89 21.09210921092109 27.85778577857786 27.28772877287729 23.762376237623762 90-94 20.329477742726954 28.381152671373496 27.214460968404186 24.074908617495367 95-99 20.88429917786244 27.91257268899138 27.63685582514538 23.5662723080008 100-104 21.065 28.17 27.245 23.52 105-109 20.89 28.375 27.355 23.380000000000003 110-114 20.89 28.470000000000002 26.584999999999997 24.055 115-119 20.925 28.410000000000004 26.595000000000002 24.07 120-124 21.08 28.23 26.575 24.115000000000002 125-129 21.205 27.76 26.6 24.435000000000002 130-134 21.37 28.360000000000003 25.974999999999998 24.295 135-139 21.528229234385158 27.504125618842828 27.074061109166376 23.893584037605642 140-144 21.154999999999998 27.794999999999998 26.52 24.529999999999998 145-149 21.375 28.54 25.775 24.310000000000002 150-151 20.75 27.9375 26.687499999999996 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 1.0 21 1.0 22 0.0 23 1.0 24 2.0 25 4.5 26 5.0 27 5.5 28 7.5 29 8.0 30 12.0 31 21.5 32 23.5 33 26.5 34 45.5 35 71.0 36 91.0 37 98.5 38 120.5 39 151.0 40 173.5 41 207.0 42 231.5 43 247.5 44 272.5 45 274.5 46 278.0 47 277.5 48 243.5 49 206.5 50 166.0 51 147.0 52 131.0 53 100.0 54 84.5 55 76.0 56 56.0 57 35.5 58 28.5 59 18.5 60 9.5 61 7.0 62 8.5 63 8.5 64 3.5 65 2.0 66 2.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.145 95-99 0.26 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5793450881612091 1.15 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.9749999999999999 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.4000000000000004 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.5375 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 4.862500000000001 0.0 0.0 0.0 0.0 128-129 5.237500000000001 0.0 0.0 0.0 0.0 130-131 5.7125 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.65 0.0 0.0 0.0 0.0 136-137 7.3125 0.0 0.0 0.0 0.0 138-139 8.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCAGA 10 0.006832588 144.9875 145 >>END_MODULE SRR7170017 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170017_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10125 33.0 33.0 34.0 32.0 34.0 2 32.35575 34.0 33.0 34.0 32.0 34.0 3 32.3025 34.0 33.0 34.0 32.0 34.0 4 32.055 34.0 33.0 34.0 32.0 34.0 5 31.9045 34.0 33.0 34.0 31.0 34.0 6 36.2415 38.0 38.0 38.0 34.0 38.0 7 36.421 38.0 38.0 38.0 36.0 38.0 8 36.372 38.0 38.0 38.0 36.0 38.0 9 36.36775 38.0 38.0 38.0 36.0 38.0 10-14 36.325199999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.21040000000001 38.0 38.0 38.0 36.0 38.0 20-24 36.273250000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.28295 38.0 38.0 38.0 36.0 38.0 30-34 36.2755 38.0 38.0 38.0 36.0 38.0 35-39 36.15795000000001 38.0 38.0 38.0 35.8 38.0 40-44 36.0055 38.0 38.0 38.0 35.2 38.0 45-49 35.8918 38.0 38.0 38.0 34.4 38.0 50-54 36.0364 38.0 38.0 38.0 35.0 38.0 55-59 36.00545 38.0 38.0 38.0 34.6 38.0 60-64 36.036 38.0 38.0 38.0 34.8 38.0 65-69 35.89485 38.0 38.0 38.0 34.2 38.0 70-74 35.8048 38.0 38.0 38.0 34.2 38.0 75-79 35.73775 38.0 38.0 38.0 33.6 38.0 80-84 35.669999999999995 38.0 38.0 38.0 33.4 38.0 85-89 35.286899999999996 38.0 38.0 38.0 32.0 38.0 90-94 34.84415 38.0 38.0 38.0 28.6 38.0 95-99 35.21055 38.0 38.0 38.0 29.8 38.0 100-104 35.155950000000004 38.0 37.6 38.0 30.0 38.0 105-109 35.01605 38.0 37.2 38.0 29.2 38.0 110-114 34.9051 38.0 37.0 38.0 28.6 38.0 115-119 34.58630000000001 38.0 36.6 38.0 26.8 38.0 120-124 34.248149999999995 38.0 36.0 38.0 24.0 38.0 125-129 33.7911 38.0 35.4 38.0 19.4 38.0 130-134 32.706950000000006 38.0 33.8 38.0 13.4 38.0 135-139 31.4089 38.0 32.2 38.0 4.2 38.0 140-144 30.5776 38.0 31.4 38.0 2.0 38.0 145-149 29.816699999999997 38.0 29.8 38.0 2.0 38.0 150-151 24.89125 33.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 82.0 3 14.0 4 4.0 5 2.0 6 2.0 7 6.0 8 0.0 9 2.0 10 2.0 11 1.0 12 2.0 13 5.0 14 4.0 15 7.0 16 9.0 17 9.0 18 13.0 19 4.0 20 13.0 21 10.0 22 8.0 23 13.0 24 14.0 25 36.0 26 33.0 27 42.0 28 52.0 29 40.0 30 56.0 31 60.0 32 99.0 33 146.0 34 161.0 35 213.0 36 536.0 37 2300.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.81708876950626 20.184190330007677 15.86083397288309 29.137886927602967 2 26.002029426686963 27.143581938102486 29.04616945712836 17.80821917808219 3 20.997709340799187 29.040468312547723 30.185797912954946 19.77602443369814 4 23.49165596919127 33.65853658536586 22.541720154043645 20.30808729139923 5 23.474903474903474 34.33719433719434 23.732303732303734 18.455598455598455 6 22.366412213740457 35.31806615776081 24.045801526717558 18.26972010178117 7 21.339761481857398 21.111393047449887 36.741943669119514 20.806901801573204 8 22.278609489977164 25.907130170007616 26.693732555189037 25.120527784826187 9 21.74574980969297 25.14590205531591 29.73864501395585 23.369703121035272 10-14 23.60431947840261 29.278728606356967 25.565403422982886 21.551548492257538 15-19 23.710180498031395 27.882599580712785 27.309914608580048 21.09730531267577 20-24 23.282851460914795 28.0046912447096 27.21431849472235 21.498138799653255 25-29 24.031362965225803 27.73789521918436 27.254213125604604 20.976528689985237 30-34 23.676298221474802 27.967181368801917 27.666513784844316 20.69000662487897 35-39 23.125191307009487 28.083868992959903 27.359453117028878 21.431486583001735 40-44 23.82172131147541 27.033811475409834 27.330942622950822 21.813524590163937 45-49 23.904464148429092 27.46143201271078 27.487058582338168 21.147045256521963 50-54 23.243738546120955 27.53512522907758 28.16636122989208 21.054774994909387 55-59 23.751019575856443 28.114804241435564 27.4673735725938 20.666802610114193 60-64 24.098352293016376 27.597816660715196 27.67943682089476 20.624394225373667 65-69 23.69346861775353 27.446081680518024 28.05282210778565 20.807627593942794 70-74 24.144235652615542 27.770441848654137 27.45556119857796 20.62976130015236 75-79 23.873096446700508 27.39593908629442 27.604060913705585 21.126903553299492 80-84 24.498931732627938 27.327296774849934 27.205209075185678 20.968562417336454 85-89 23.580246913580247 27.685185185185183 27.391975308641975 21.342592592592595 90-94 23.992531507701884 27.664540220942897 27.711218297806127 20.63170997354909 95-99 24.125267775170865 27.22635927777211 27.144751606651024 21.503621340406 100-104 23.637934539540556 28.00874161414922 27.60723724334214 20.746086602968084 105-109 23.78427974309308 27.836680599449487 27.30655520440412 21.07248445305332 110-114 23.996937212863706 27.549770290964776 27.626339969372125 20.82695252679939 115-119 24.593671982473122 27.6761603912977 27.08513782034952 20.645029805879656 120-124 24.871937921590508 27.646193640006082 26.834711162955827 20.647157275447583 125-129 25.060166931230476 27.999385529212965 26.606585078601054 20.3338624609555 130-134 25.124652285729283 28.090064556762716 26.23208943473469 20.553193722773315 135-139 25.77341583102197 27.314913590783018 27.12822701088116 19.783443567313846 140-144 25.52362396492937 27.428695134491534 26.80088758997673 20.24679331060237 145-149 25.747656209081864 27.915990153459386 26.36044623684073 19.975907400618027 150-151 26.174926367012418 27.788449225252915 26.456652580356 19.579971827378664 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 58.0 1 29.5 2 0.5 3 0.0 4 0.5 5 1.0 6 1.5 7 1.5 8 1.5 9 1.0 10 0.5 11 1.5 12 3.0 13 2.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 2.0 24 1.0 25 1.0 26 3.5 27 3.5 28 2.0 29 3.5 30 6.5 31 9.5 32 17.0 33 25.5 34 37.0 35 49.5 36 63.0 37 83.5 38 118.0 39 155.5 40 190.0 41 217.0 42 230.5 43 250.5 44 264.0 45 275.0 46 290.0 47 290.5 48 263.0 49 218.0 50 184.5 51 150.0 52 119.5 53 103.0 54 79.5 55 57.5 56 43.5 57 29.0 58 21.0 59 17.0 60 11.5 61 8.5 62 7.5 63 5.0 64 3.0 65 4.0 66 3.0 67 1.5 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.275 2 1.4500000000000002 3 1.775 4 2.625 5 2.875 6 1.7500000000000002 7 1.4749999999999999 8 1.4749999999999999 9 1.4749999999999999 10-14 1.8399999999999999 15-19 2.215 20-24 1.9449999999999998 25-29 1.7950000000000002 30-34 1.8849999999999998 35-39 1.9900000000000002 40-44 2.4 45-49 2.445 50-54 1.78 55-59 1.92 60-64 1.9849999999999999 65-69 1.9349999999999998 70-74 1.55 75-79 1.5 80-84 1.71 85-89 2.8000000000000003 90-94 3.595 95-99 1.97 100-104 1.6199999999999999 105-109 1.91 110-114 2.0500000000000003 115-119 1.865 120-124 1.415 125-129 2.355 130-134 4.735 135-139 6.260000000000001 140-144 7.614999999999999 145-149 4.535 150-151 2.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4128159305591 97.35000000000001 2 0.5105948429920858 1.0 3 0.025529742149604292 0.075 4 0.0 0.0 5 0.025529742149604292 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025529742149604292 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 58 1.4500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0125 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.0625 0.025 0.0 0.0 0.0 82-83 0.1125 0.025 0.0 0.0 0.0 84-85 0.15 0.025 0.0 0.0 0.0 86-87 0.175 0.025 0.0 0.0 0.0 88-89 0.2375 0.025 0.0 0.0 0.0 90-91 0.3375 0.025 0.0 0.0 0.0 92-93 0.5 0.025 0.0 0.0 0.0 94-95 0.6 0.025 0.0 0.0 0.0 96-97 0.7124999999999999 0.025 0.0 0.0 0.0 98-99 0.7875 0.025 0.0 0.0 0.0 100-101 0.925 0.025 0.0 0.0 0.0 102-103 1.0375 0.025 0.0 0.0 0.0 104-105 1.2875 0.025 0.0 0.0 0.0 106-107 1.5125 0.025 0.0 0.0 0.0 108-109 1.7625 0.025 0.0 0.0 0.0 110-111 2.025 0.025 0.0 0.0 0.0 112-113 2.2375 0.025 0.0 0.0 0.0 114-115 2.4749999999999996 0.025 0.0 0.0 0.0 116-117 2.775 0.025 0.0 0.0 0.0 118-119 3.075 0.025 0.0 0.0 0.0 120-121 3.55 0.025 0.0 0.0 0.0 122-123 4.15 0.025 0.0 0.0 0.0 124-125 4.5625 0.025 0.0 0.0 0.0 126-127 4.85 0.025 0.0 0.0 0.0 128-129 5.237500000000001 0.025 0.0 0.0 0.0 130-131 5.7125 0.025 0.0 0.0 0.0 132-133 6.1875 0.025 0.0 0.0 0.0 134-135 6.65 0.025 0.0 0.0 0.0 136-137 7.175000000000001 0.025 0.0 0.0 0.0 138-139 7.7625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATGT 10 0.0069447127 144.17722 7 CCCCCCC 20 0.005803182 29.130436 90-94 >>END_MODULE Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677142 spots for SRR7170017.sra Written 677142 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra Read 677125 spots for SRR7170017.sra Written 677125 spots for SRR7170017.sra SRR ids: ['SRR7170017.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vqvcrkib SRR7170017.sra spots: 13542517 blocks: [[1, 677125], [677126, 1354250], [1354251, 2031375], [2031376, 2708500], [2708501, 3385625], [3385626, 4062750], [4062751, 4739875], [4739876, 5417000], [5417001, 6094125], [6094126, 6771250], [6771251, 7448375], [7448376, 8125500], [8125501, 8802625], [8802626, 9479750], [9479751, 10156875], [10156876, 10834000], [10834001, 11511125], [11511126, 12188250], [12188251, 12865375], [12865376, 13542517]] SRR7170017 file size 4567414 SRR7170017 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170017 SRR7170017_1.fastq SRR7170017_2.fastq Input file: SRR7170017_1.fastq Paired file: SRR7170017_2.fastq trimmed: SRR7170017-trimmed-pair1.fastq, SRR7170017-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:26:42 2025 >> started Wed Feb 12 11:26:56 2025 >> done (14.509s) 13542517 read pairs processed; of these: 23054 ( 0.17%) short read pairs filtered out after trimming by size control 68826 ( 0.51%) empty read pairs filtered out after trimming by size control 13450637 (99.32%) read pairs available; of these: 6688411 (49.73%) trimmed read pairs available after processing 6762226 (50.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 0 0.00% 21 4 0.00% 22 5 0.00% 23 8 0.00% 24 7 0.00% 25 3 0.00% 26 7 0.00% 27 4 0.00% 28 6 0.00% 29 9 0.00% 30 5 0.00% 31 10 0.00% 32 14 0.00% 33 8 0.00% 34 16 0.00% 35 15 0.00% 36 19 0.00% 37 26 0.00% 38 17 0.00% 39 27 0.00% 40 32 0.00% 41 20 0.00% 42 16 0.00% 43 31 0.00% 44 42 0.00% 45 40 0.00% 46 45 0.00% 47 68 0.00% 48 56 0.00% 49 75 0.00% 50 93 0.00% 51 95 0.00% 52 127 0.00% 53 124 0.00% 54 130 0.00% 55 131 0.00% 56 163 0.00% 57 164 0.00% 58 193 0.00% 59 226 0.00% 60 265 0.00% 61 277 0.00% 62 335 0.00% 63 381 0.00% 64 439 0.00% 65 466 0.00% 66 546 0.00% 67 643 0.00% 68 755 0.01% 69 861 0.01% 70 1013 0.01% 71 1048 0.01% 72 1173 0.01% 73 1288 0.01% 74 1399 0.01% 75 1609 0.01% 76 1722 0.01% 77 1786 0.01% 78 2069 0.02% 79 2314 0.02% 80 2516 0.02% 81 2978 0.02% 82 3438 0.03% 83 3861 0.03% 84 5034 0.04% 85 6120 0.05% 86 6143 0.05% 87 6669 0.05% 88 7098 0.05% 89 7471 0.06% 90 7995 0.06% 91 8577 0.06% 92 9126 0.07% 93 10217 0.08% 94 10880 0.08% 95 11613 0.09% 96 12334 0.09% 97 12936 0.10% 98 13706 0.10% 99 13909 0.10% 100 14959 0.11% 101 15891 0.12% 102 16712 0.12% 103 18010 0.13% 104 18963 0.14% 105 19961 0.15% 106 20681 0.15% 107 21397 0.16% 108 22482 0.17% 109 23070 0.17% 110 23785 0.18% 111 24892 0.19% 112 25863 0.19% 113 27497 0.20% 114 28737 0.21% 115 30180 0.22% 116 31272 0.23% 117 32008 0.24% 118 32608 0.24% 119 33224 0.25% 120 34210 0.25% 121 35180 0.26% 122 36615 0.27% 123 38511 0.29% 124 40547 0.30% 125 41861 0.31% 126 43091 0.32% 127 44978 0.33% 128 46406 0.35% 129 47275 0.35% 130 49254 0.37% 131 50331 0.37% 132 53076 0.39% 133 56226 0.42% 134 59147 0.44% 135 62656 0.47% 136 66196 0.49% 137 69865 0.52% 138 75427 0.56% 139 80302 0.60% 140 85663 0.64% 141 91642 0.68% 142 97618 0.73% 143 107098 0.80% 144 119023 0.88% 145 136038 1.01% 146 163344 1.21% 147 211478 1.57% 148 299125 2.22% 149 576290 4.28% 150 3102650 23.07% 151 6762226 50.27% 13450637 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAATCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=233.25 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=27 prefix-density=0.37 prefix-fanout=3.4 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=152.28 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7170017 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:27:40 Started mapping on | Feb 12 11:27:40 Finished on | Feb 12 11:29:13 Mapping speed, Million of reads per hour | 520.67 Number of input reads | 13450637 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12669171 Uniquely mapped reads % | 94.19% Average mapped length | 292.09 Number of splices: Total | 11979979 Number of splices: Annotated (sjdb) | 11777214 Number of splices: GT/AG | 11810287 Number of splices: GC/AG | 137652 Number of splices: AT/AC | 9692 Number of splices: Non-canonical | 22348 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221711 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 27982 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576272 576272 576272 N_multimapping 221711 221711 221711 N_noFeature 256527 12526795 319227 N_ambiguous 129275 669 49200 UnstrandedReadsAssigned:12283369 PositiveStrandReadsAssigned:141707 NegativeStrandReadsAssigned:12300744 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170017 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170017-trimmed-pair1.fastq SRR7170017-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,450,637 reads, 12,226,748 reads pseudoaligned [quant] estimated average fragment length: 228.608 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR7170017.ke.tsv 34699 SRR7170017.se.tsv 87100 total ==> SRR7170017.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.39 226 10.0252 Potri.005G024800.1.v4.1 1035 807.392 29 2.85264 Potri.004G059700.1.v4.1 961 733.438 3 0.324857 Potri.007G009000.2.v4.1 1416 1188.39 0 0 Potri.003G141000.2.v4.1 2943 2715.39 208.059 6.08538 Potri.016G087400.1.v4.1 270 86.6193 1420.56 1302.51 Potri.015G069301.1.v4.1 564 341.043 0 0 Potri.010G195200.1.v4.1 1773 1545.39 6 0.308352 Potri.012G127500.1.v4.1 977 749.421 4710 499.148 ==> SRR7170017.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1005 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 191 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170017 completed mapping pipeline successfully