Starting /dee2/code/volunteer_pipeline.sh SRR7170118 current disk space = 3051257311232 free memory = 1581422316 SRR7170118 SRAfilesize d46b8ea23793d83d0f9930c55ae08978 SRR7170118.sra SRR7170118.sra file validated SRR7170118 is paired end SRR7170118 is conventional basespace SRR7170118 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25675 34.0 33.0 34.0 33.0 34.0 2 33.422 34.0 34.0 34.0 33.0 34.0 3 33.40375 34.0 34.0 34.0 33.0 34.0 4 33.391 34.0 34.0 34.0 33.0 34.0 5 33.402 34.0 34.0 34.0 33.0 34.0 6 36.8935 38.0 37.0 38.0 35.0 38.0 7 37.09975 38.0 38.0 38.0 36.0 38.0 8 37.3195 38.0 38.0 38.0 37.0 38.0 9 37.2825 38.0 38.0 38.0 37.0 38.0 10-14 37.3246 38.0 38.0 38.0 37.0 38.0 15-19 37.2802 38.0 38.0 38.0 36.2 38.0 20-24 37.2397 38.0 38.0 38.0 36.6 38.0 25-29 37.193799999999996 38.0 38.0 38.0 36.4 38.0 30-34 37.13565 38.0 38.0 38.0 36.0 38.0 35-39 36.998 38.0 38.0 38.0 35.6 38.0 40-44 36.516 38.0 38.0 38.0 34.0 38.0 45-49 36.25935 38.0 37.0 38.0 33.4 38.0 50-54 36.18545 38.0 37.0 38.0 33.0 38.0 55-59 36.109350000000006 38.0 37.0 38.0 32.6 38.0 60-64 36.045100000000005 38.0 37.0 38.0 32.6 38.0 65-69 35.91445 38.0 37.0 38.0 31.4 38.0 70-74 35.7962 38.0 37.0 38.0 31.0 38.0 75-79 35.658699999999996 38.0 36.4 38.0 29.6 38.0 80-84 35.6103 38.0 36.0 38.0 29.6 38.0 85-89 35.4208 38.0 36.0 38.0 29.0 38.0 90-94 35.07575 38.0 36.0 38.0 28.6 38.0 95-99 34.878750000000004 38.0 35.2 38.0 28.0 38.0 100-104 34.5951 38.0 35.0 38.0 26.0 38.0 105-109 34.2863 38.0 34.4 38.0 24.2 38.0 110-114 33.84635 38.0 34.0 38.0 19.4 38.0 115-119 33.53055 38.0 34.0 38.0 17.4 38.0 120-124 33.286 37.6 33.6 38.0 15.0 38.0 125-129 32.61575 37.0 32.2 38.0 15.0 38.0 130-134 31.892850000000003 36.4 30.6 38.0 15.0 38.0 135-139 31.395050000000005 36.0 30.6 38.0 14.0 38.0 140-144 30.55355 35.4 28.2 38.0 13.4 38.0 145-149 29.06785 34.8 25.4 38.0 4.2 38.0 150-151 24.554499999999997 33.0 8.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 0.0 10 0.0 11 2.0 12 4.0 13 2.0 14 1.0 15 3.0 16 7.0 17 7.0 18 7.0 19 5.0 20 11.0 21 6.0 22 21.0 23 26.0 24 22.0 25 33.0 26 43.0 27 38.0 28 63.0 29 60.0 30 93.0 31 121.0 32 176.0 33 219.0 34 317.0 35 607.0 36 1051.0 37 1051.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.87945755901557 15.544952285283777 11.627322953289804 32.94826720241085 2 22.55 19.55 34.5 23.400000000000002 3 19.0 27.025 26.474999999999998 27.500000000000004 4 21.2 35.475 22.1 21.224999999999998 5 19.984992496248125 37.11855927963982 24.562281140570285 18.33416708354177 6 17.2 36.35 25.35 21.099999999999998 7 14.249999999999998 23.625 41.625 20.5 8 17.2 24.025 29.75 29.025000000000002 9 18.375 23.625 32.175 25.825 10-14 20.02 29.475 26.47 24.035 15-19 20.349999999999998 28.744999999999997 27.834999999999997 23.07 20-24 19.365 28.595 27.55 24.490000000000002 25-29 19.71 28.360000000000003 28.46 23.47 30-34 20.575 28.655 27.1 23.669999999999998 35-39 19.985 28.615000000000002 27.425 23.974999999999998 40-44 20.195 29.220000000000002 27.075 23.51 45-49 20.485 28.43 27.36 23.724999999999998 50-54 20.385 29.34 26.950000000000003 23.325000000000003 55-59 20.78 28.54 27.005000000000003 23.674999999999997 60-64 20.03 28.849999999999998 27.32 23.799999999999997 65-69 20.565 28.505000000000003 26.974999999999998 23.955000000000002 70-74 20.735 28.28 27.389999999999997 23.595 75-79 20.005 29.25 26.939999999999998 23.805 80-84 20.665 28.470000000000002 26.974999999999998 23.89 85-89 20.345 28.515 27.095000000000002 24.044999999999998 90-94 20.445 28.37 27.485 23.7 95-99 19.975 28.605000000000004 27.555000000000003 23.865 100-104 20.48 27.83 27.575 24.115000000000002 105-109 20.395 28.165000000000003 27.534999999999997 23.905 110-114 20.52 28.565 27.21 23.705000000000002 115-119 20.72 28.29 27.07 23.919999999999998 120-124 21.25 27.99 27.065 23.695 125-129 21.154999999999998 27.875 27.155 23.815 130-134 21.04 28.67 26.57 23.72 135-139 21.08 28.275 27.415 23.23 140-144 21.154999999999998 28.725 26.69 23.43 145-149 21.065 28.634999999999998 26.205000000000002 24.095 150-151 20.967741935483872 27.86946736684171 27.11927981995499 24.043510877719427 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.5 22 1.0 23 2.5 24 3.0 25 4.5 26 6.0 27 3.0 28 4.0 29 10.0 30 15.5 31 26.5 32 34.0 33 36.0 34 49.5 35 71.5 36 88.0 37 110.5 38 144.5 39 155.5 40 179.5 41 211.5 42 238.5 43 259.0 44 271.5 45 280.0 46 264.5 47 254.5 48 239.5 49 202.5 50 165.0 51 143.0 52 127.5 53 106.0 54 83.5 55 62.0 56 42.0 57 29.0 58 18.5 59 15.5 60 12.0 61 7.0 62 4.5 63 2.5 64 1.5 65 1.0 66 2.0 67 2.0 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.3625 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACATT 10 0.006830828 145.0 2 TACATTA 10 0.006830828 145.0 3 TCAGCCA 10 0.006830828 145.0 7 >>END_MODULE SRR7170118 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.781 33.0 33.0 34.0 32.0 34.0 2 32.95775 34.0 33.0 34.0 32.0 34.0 3 32.85275 34.0 33.0 34.0 32.0 34.0 4 32.72525 34.0 33.0 34.0 32.0 34.0 5 32.83675 34.0 33.0 34.0 32.0 34.0 6 36.99475 38.0 38.0 38.0 36.0 38.0 7 37.105 38.0 38.0 38.0 37.0 38.0 8 37.08925 38.0 38.0 38.0 36.0 38.0 9 37.07075 38.0 38.0 38.0 37.0 38.0 10-14 37.05555 38.0 38.0 38.0 37.0 38.0 15-19 36.97645 38.0 38.0 38.0 36.8 38.0 20-24 37.007799999999996 38.0 38.0 38.0 36.4 38.0 25-29 37.02589999999999 38.0 38.0 38.0 36.8 38.0 30-34 37.01735 38.0 38.0 38.0 36.4 38.0 35-39 36.896499999999996 38.0 38.0 38.0 36.2 38.0 40-44 36.727199999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.735400000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.81175 38.0 38.0 38.0 35.8 38.0 55-59 36.7544 38.0 38.0 38.0 35.6 38.0 60-64 36.759100000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.671 38.0 38.0 38.0 35.0 38.0 70-74 36.654599999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.57295 38.0 38.0 38.0 34.6 38.0 80-84 36.511649999999996 38.0 38.0 38.0 34.4 38.0 85-89 36.1177 38.0 38.0 38.0 34.0 38.0 90-94 35.89035 38.0 38.0 38.0 33.2 38.0 95-99 36.077299999999994 38.0 38.0 38.0 33.2 38.0 100-104 35.9809 38.0 37.8 38.0 33.0 38.0 105-109 35.92045 38.0 37.2 38.0 33.0 38.0 110-114 35.6802 38.0 37.0 38.0 31.4 38.0 115-119 35.334649999999996 38.0 36.4 38.0 29.2 38.0 120-124 35.241 38.0 36.2 38.0 29.0 38.0 125-129 34.7105 38.0 35.8 38.0 26.8 38.0 130-134 33.6152 38.0 34.8 38.0 18.2 38.0 135-139 32.4649 38.0 34.0 38.0 13.6 38.0 140-144 31.389400000000002 38.0 32.6 38.0 2.0 38.0 145-149 30.870449999999998 38.0 31.8 38.0 2.0 38.0 150-151 27.074125000000002 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 3.0 11 6.0 12 4.0 13 1.0 14 3.0 15 3.0 16 3.0 17 1.0 18 7.0 19 9.0 20 7.0 21 14.0 22 14.0 23 11.0 24 23.0 25 27.0 26 29.0 27 35.0 28 41.0 29 54.0 30 62.0 31 81.0 32 106.0 33 180.0 34 144.0 35 248.0 36 636.0 37 2236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65948923385078 17.250876314471707 15.097646469704557 27.99198798197296 2 24.312156078039017 25.162581290645324 33.81690845422711 16.708354177088545 3 20.37129954841947 28.399397892624183 30.88309081786252 20.34621174109383 4 24.3202416918429 35.07049345417925 21.90332326283988 18.705941591137965 5 23.64457831325301 36.77208835341366 22.063253012048193 17.520080321285143 6 19.55 36.025 25.525 18.9 7 19.725 18.975 40.699999999999996 20.599999999999998 8 22.925 22.225 27.450000000000003 27.400000000000002 9 22.45 24.224999999999998 27.950000000000003 25.374999999999996 10-14 23.486403926085433 28.35895638239271 26.445991286494063 21.70864840502779 15-19 23.330324909747294 27.93321299638989 27.60228640192539 21.134175691937422 20-24 22.86243492190629 28.088706447737284 27.758309971966362 21.29054865839007 25-29 23.305 27.92 27.785 20.990000000000002 30-34 23.28 27.534999999999997 28.335 20.849999999999998 35-39 23.46304282419015 27.173804031691905 27.956072610570654 21.407080533547287 40-44 22.95774647887324 27.74144869215292 28.13883299798793 21.161971830985916 45-49 23.646408839779006 27.40331491712707 28.111501757910595 20.838774485183325 50-54 23.310489720374168 27.51238057125707 27.947576409384222 21.229553298984545 55-59 23.855 27.445000000000004 27.71 20.990000000000002 60-64 23.542062618785636 27.788336500950283 28.06842052615785 20.601180354106233 65-69 24.21953171903142 27.326395837502503 27.571542925755455 20.882529517710626 70-74 23.45 27.185 28.405 20.96 75-79 23.265 27.265 28.63 20.84 80-84 23.255 27.82 28.075 20.849999999999998 85-89 23.20294384514568 27.472527472527474 28.087508821453778 21.237019860873072 90-94 23.6947182208744 27.682587819054838 28.137477887288348 20.48521607278241 95-99 22.789115646258505 27.721088435374146 27.936174469787918 21.55362144857943 100-104 24.52 27.55 27.615000000000002 20.315 105-109 23.880000000000003 27.389999999999997 27.925 20.805 110-114 23.715 27.815 27.54 20.93 115-119 24.295 27.655 27.665 20.385 120-124 24.765 28.025 27.389999999999997 19.82 125-129 24.418779814210396 27.36128546321868 27.682651267888524 20.537283454682402 130-134 24.952449493651365 27.810620469850413 27.24515498894772 19.991775047550504 135-139 24.70044145469834 27.611940298507463 27.18099642631911 20.50662182047509 140-144 24.794929157345262 27.92159369340577 27.325023969319272 19.958453179929688 145-149 24.784449772970767 28.55466557828682 27.080251007601653 19.580633641140757 150-151 25.49660548151873 27.910485290419913 27.432738244908222 19.16017098315313 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 2.0 26 2.5 27 3.5 28 8.0 29 13.5 30 11.0 31 9.0 32 18.5 33 27.5 34 43.0 35 64.0 36 78.5 37 100.0 38 129.0 39 152.5 40 182.5 41 218.0 42 251.0 43 258.0 44 260.0 45 289.5 46 294.0 47 272.0 48 260.5 49 236.5 50 184.0 51 159.5 52 129.0 53 87.0 54 67.0 55 46.5 56 32.0 57 30.5 58 26.0 59 16.0 60 9.5 61 4.5 62 4.5 63 3.5 64 4.0 65 2.5 66 1.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.05 3 0.35000000000000003 4 0.7000000000000001 5 0.4 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.155 15-19 0.27999999999999997 20-24 0.12 25-29 0.0 30-34 0.0 35-39 0.29 40-44 0.6 45-49 0.44999999999999996 50-54 0.045 55-59 0.0 60-64 0.03 65-69 0.06 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.8099999999999999 90-94 1.075 95-99 0.04 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.42500000000000004 130-134 2.735 135-139 4.859999999999999 140-144 6.13 145-149 1.9949999999999999 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.775 0.0 0.0 0.0 0.0 120-121 3.2125000000000004 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 5.0875 0.0 0.0 0.0 0.0 136-137 5.612500000000001 0.0 0.0 0.0 0.0 138-139 6.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGTTG 10 0.0069990456 143.82501 2 TACTCTC 10 0.0069990456 143.82501 3 >>END_MODULE Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884097 spots for SRR7170118.sra Written 884097 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra Read 884080 spots for SRR7170118.sra Written 884080 spots for SRR7170118.sra SRR ids: ['SRR7170118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vbl85brp SRR7170118.sra spots: 17681617 blocks: [[1, 884080], [884081, 1768160], [1768161, 2652240], [2652241, 3536320], [3536321, 4420400], [4420401, 5304480], [5304481, 6188560], [6188561, 7072640], [7072641, 7956720], [7956721, 8840800], [8840801, 9724880], [9724881, 10608960], [10608961, 11493040], [11493041, 12377120], [12377121, 13261200], [13261201, 14145280], [14145281, 15029360], [15029361, 15913440], [15913441, 16797520], [16797521, 17681617]] SRR7170118 file size 5970019 SRR7170118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170118 SRR7170118_1.fastq SRR7170118_2.fastq Input file: SRR7170118_1.fastq Paired file: SRR7170118_2.fastq trimmed: SRR7170118-trimmed-pair1.fastq, SRR7170118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:50:17 2025 >> started Wed Feb 12 11:50:38 2025 >> done (21.377s) 17681617 read pairs processed; of these: 28964 ( 0.16%) short read pairs filtered out after trimming by size control 26516 ( 0.15%) empty read pairs filtered out after trimming by size control 17626137 (99.69%) read pairs available; of these: 10616738 (60.23%) trimmed read pairs available after processing 7009399 (39.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 8 0.00% 22 2 0.00% 23 7 0.00% 24 5 0.00% 25 11 0.00% 26 4 0.00% 27 9 0.00% 28 7 0.00% 29 10 0.00% 30 2 0.00% 31 11 0.00% 32 11 0.00% 33 17 0.00% 34 15 0.00% 35 9 0.00% 36 21 0.00% 37 17 0.00% 38 23 0.00% 39 36 0.00% 40 22 0.00% 41 36 0.00% 42 36 0.00% 43 49 0.00% 44 42 0.00% 45 48 0.00% 46 58 0.00% 47 55 0.00% 48 69 0.00% 49 84 0.00% 50 106 0.00% 51 117 0.00% 52 129 0.00% 53 142 0.00% 54 154 0.00% 55 169 0.00% 56 200 0.00% 57 220 0.00% 58 255 0.00% 59 269 0.00% 60 308 0.00% 61 354 0.00% 62 433 0.00% 63 482 0.00% 64 551 0.00% 65 624 0.00% 66 723 0.00% 67 835 0.00% 68 1031 0.01% 69 1319 0.01% 70 1475 0.01% 71 1534 0.01% 72 1553 0.01% 73 1787 0.01% 74 1942 0.01% 75 2056 0.01% 76 2217 0.01% 77 2475 0.01% 78 2770 0.02% 79 3177 0.02% 80 3572 0.02% 81 4088 0.02% 82 4799 0.03% 83 5446 0.03% 84 6634 0.04% 85 7830 0.04% 86 8079 0.05% 87 8338 0.05% 88 8812 0.05% 89 9583 0.05% 90 10102 0.06% 91 10962 0.06% 92 11883 0.07% 93 12888 0.07% 94 13994 0.08% 95 14698 0.08% 96 15370 0.09% 97 16031 0.09% 98 16679 0.09% 99 17504 0.10% 100 18664 0.11% 101 19823 0.11% 102 21211 0.12% 103 22188 0.13% 104 23608 0.13% 105 25325 0.14% 106 26144 0.15% 107 26730 0.15% 108 27836 0.16% 109 28487 0.16% 110 29605 0.17% 111 31446 0.18% 112 33317 0.19% 113 35182 0.20% 114 37248 0.21% 115 38746 0.22% 116 40226 0.23% 117 40943 0.23% 118 42357 0.24% 119 43441 0.25% 120 44971 0.26% 121 47139 0.27% 122 49737 0.28% 123 52792 0.30% 124 55367 0.31% 125 58465 0.33% 126 61888 0.35% 127 63792 0.36% 128 65993 0.37% 129 69137 0.39% 130 72701 0.41% 131 75785 0.43% 132 80965 0.46% 133 86724 0.49% 134 93480 0.53% 135 99956 0.57% 136 106934 0.61% 137 115184 0.65% 138 125894 0.71% 139 136048 0.77% 140 148500 0.84% 141 163269 0.93% 142 185230 1.05% 143 210652 1.20% 144 239098 1.36% 145 286354 1.62% 146 355710 2.02% 147 476583 2.70% 148 701982 3.98% 149 1246916 7.07% 150 4189534 23.77% 151 7009399 39.77% 17626137 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=6 fanout-score=72.46 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=15.6 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=4.3 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=47.43 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=11.5 sequence=TCAAGGAAGCTTTCAG SRR7170118 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:51:22 Started mapping on | Feb 12 11:51:22 Finished on | Feb 12 11:53:07 Mapping speed, Million of reads per hour | 604.32 Number of input reads | 17626137 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16599848 Uniquely mapped reads % | 94.18% Average mapped length | 291.15 Number of splices: Total | 15165623 Number of splices: Annotated (sjdb) | 14914032 Number of splices: GT/AG | 14950869 Number of splices: GC/AG | 171432 Number of splices: AT/AC | 12569 Number of splices: Non-canonical | 30753 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282521 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 20866 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 767519 767519 767519 N_multimapping 282521 282521 282521 N_noFeature 370233 16410081 447652 N_ambiguous 180702 1257 67396 UnstrandedReadsAssigned:16048913 PositiveStrandReadsAssigned:188510 NegativeStrandReadsAssigned:16084800 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170118-trimmed-pair1.fastq SRR7170118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,626,137 reads, 16,000,697 reads pseudoaligned [quant] estimated average fragment length: 241.713 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR7170118.ke.tsv 34699 SRR7170118.se.tsv 87100 total ==> SRR7170118.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.29 329 12.0418 Potri.005G024800.1.v4.1 1035 794.287 38 3.11213 Potri.004G059700.1.v4.1 961 720.42 2 0.180591 Potri.007G009000.2.v4.1 1416 1175.29 0 0 Potri.003G141000.2.v4.1 2943 2702.29 303.062 7.29544 Potri.016G087400.1.v4.1 270 83.7337 1679.61 1304.84 Potri.015G069301.1.v4.1 564 330.629 0 0 Potri.010G195200.1.v4.1 1773 1532.29 35 1.48587 Potri.012G127500.1.v4.1 977 736.365 6231 550.448 ==> SRR7170118.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2074 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7170118 completed mapping pipeline successfully