Starting /dee2/code/volunteer_pipeline.sh SRR7170119 current disk space = 3051329675264 free memory = 1581908352 SRR7170119 SRAfilesize 4be856852cb05fa8ce436b7380e05a9e SRR7170119.sra SRR7170119.sra file validated SRR7170119 is paired end SRR7170119 is conventional basespace SRR7170119 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170119_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7695 34.0 33.0 34.0 33.0 34.0 2 33.42525 34.0 34.0 34.0 33.0 34.0 3 33.546 34.0 34.0 34.0 33.0 34.0 4 33.5945 34.0 34.0 34.0 33.0 34.0 5 33.6345 34.0 34.0 34.0 33.0 34.0 6 37.35675 38.0 38.0 38.0 37.0 38.0 7 37.51475 38.0 38.0 38.0 37.0 38.0 8 37.54425 38.0 38.0 38.0 38.0 38.0 9 37.64475 38.0 38.0 38.0 38.0 38.0 10-14 37.3164 38.0 38.0 38.0 37.2 38.0 15-19 37.61065 38.0 38.0 38.0 38.0 38.0 20-24 37.652300000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.65115 38.0 38.0 38.0 38.0 38.0 30-34 37.60385 38.0 38.0 38.0 38.0 38.0 35-39 37.429500000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.4524 38.0 38.0 38.0 38.0 38.0 45-49 37.3887 38.0 38.0 38.0 37.6 38.0 50-54 37.33445 38.0 38.0 38.0 37.0 38.0 55-59 37.39275 38.0 38.0 38.0 37.2 38.0 60-64 37.36465 38.0 38.0 38.0 37.0 38.0 65-69 37.276349999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.235 38.0 38.0 38.0 37.0 38.0 75-79 36.91305 38.0 38.0 38.0 35.8 38.0 80-84 36.98825000000001 38.0 38.0 38.0 36.0 38.0 85-89 37.07565000000001 38.0 38.0 38.0 36.2 38.0 90-94 37.0057 38.0 38.0 38.0 36.0 38.0 95-99 36.89615 38.0 38.0 38.0 36.0 38.0 100-104 36.807300000000005 38.0 38.0 38.0 35.8 38.0 105-109 36.722 38.0 38.0 38.0 35.0 38.0 110-114 36.6909 38.0 38.0 38.0 35.0 38.0 115-119 36.602549999999994 38.0 38.0 38.0 35.0 38.0 120-124 36.442499999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.2776 38.0 38.0 38.0 34.0 38.0 130-134 36.01025 38.0 38.0 38.0 33.4 38.0 135-139 36.0039 38.0 38.0 38.0 33.4 38.0 140-144 35.68565 38.0 37.0 38.0 33.0 38.0 145-149 35.36775 38.0 36.0 38.0 32.4 38.0 150-151 32.484750000000005 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 1.0 14 1.0 15 3.0 16 3.0 17 1.0 18 4.0 19 5.0 20 4.0 21 3.0 22 5.0 23 7.0 24 7.0 25 9.0 26 13.0 27 10.0 28 14.0 29 13.0 30 33.0 31 33.0 32 38.0 33 50.0 34 99.0 35 170.0 36 421.0 37 3048.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.749808526933876 14.220066377329587 11.84580035741639 34.18432473832014 2 21.224999999999998 19.575 35.325 23.875 3 19.525000000000002 27.675 26.1 26.700000000000003 4 23.325000000000003 32.375 22.975 21.325 5 21.325 36.15 24.099999999999998 18.425 6 17.7 36.25 25.874999999999996 20.175 7 13.725000000000001 23.275000000000002 43.25 19.75 8 17.75 23.150000000000002 30.85 28.249999999999996 9 17.95 24.474999999999998 31.775 25.8 10-14 19.935 29.609999999999996 26.47 23.985 15-19 19.825 28.65 28.355000000000004 23.169999999999998 20-24 20.0 29.04 27.355 23.605 25-29 19.735 29.01 27.27 23.985 30-34 19.66 28.57 27.485 24.285 35-39 20.16 28.845 27.07 23.925 40-44 20.43 29.060000000000002 26.939999999999998 23.57 45-49 19.65196519651965 28.972897289728973 27.317731773177318 24.05740574057406 50-54 19.975 28.410000000000004 27.49 24.125 55-59 19.919999999999998 29.265 26.650000000000002 24.165 60-64 20.03 28.249999999999996 27.375 24.345 65-69 20.415 28.015 27.22 24.349999999999998 70-74 20.68 28.705000000000002 27.029999999999998 23.585 75-79 20.24 28.375 27.12 24.265 80-84 20.41 28.395 26.93 24.265 85-89 20.794999999999998 28.23 27.185 23.79 90-94 20.695 29.054999999999996 26.224999999999998 24.025 95-99 20.335 28.7 26.76 24.205 100-104 20.838125718857828 28.124218632794918 27.029054358153726 24.00860129019353 105-109 20.48 28.610000000000003 27.145000000000003 23.765 110-114 20.645 28.144999999999996 26.845000000000002 24.365000000000002 115-119 21.12 28.005000000000003 26.86 24.015 120-124 20.9 29.505 26.290000000000003 23.305 125-129 21.266063303165158 27.706385319265962 27.066353317665882 23.961198059902994 130-134 21.23 28.025 26.99 23.755000000000003 135-139 21.195 28.515 26.424999999999997 23.865 140-144 20.995 28.37 26.235000000000003 24.4 145-149 20.91 28.895 26.255 23.94 150-151 21.1375 28.6875 25.4875 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 3.0 24 3.0 25 2.0 26 3.5 27 5.0 28 9.0 29 11.5 30 14.5 31 27.0 32 36.5 33 39.5 34 46.5 35 58.5 36 84.5 37 113.0 38 146.0 39 174.5 40 182.5 41 203.0 42 226.0 43 239.0 44 262.0 45 273.0 46 259.0 47 243.5 48 234.5 49 216.0 50 183.0 51 157.0 52 132.5 53 105.5 54 86.5 55 59.0 56 40.0 57 36.0 58 22.5 59 15.0 60 14.5 61 9.0 62 4.5 63 2.5 64 1.5 65 2.5 66 3.0 67 1.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.4749999999999996 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.2 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.137499999999999 0.0 0.0 0.0 0.0 128-129 5.612500000000001 0.0 0.0 0.0 0.0 130-131 6.050000000000001 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 6.925000000000001 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138-139 7.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACCTG 10 0.0068343505 144.975 9 CCACTCT 10 0.0068343505 144.975 8 GATCCAT 10 0.0068343505 144.975 145 >>END_MODULE SRR7170119 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170119_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1135 34.0 33.0 34.0 32.0 34.0 2 33.1765 34.0 33.0 34.0 33.0 34.0 3 33.208 34.0 33.0 34.0 33.0 34.0 4 33.15725 34.0 33.0 34.0 33.0 34.0 5 33.19225 34.0 33.0 34.0 33.0 34.0 6 37.331 38.0 38.0 38.0 38.0 38.0 7 37.35875 38.0 38.0 38.0 38.0 38.0 8 37.33525 38.0 38.0 38.0 38.0 38.0 9 37.364 38.0 38.0 38.0 38.0 38.0 10-14 37.34205 38.0 38.0 38.0 38.0 38.0 15-19 37.3144 38.0 38.0 38.0 38.0 38.0 20-24 37.367900000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.2983 38.0 38.0 38.0 38.0 38.0 30-34 37.2563 38.0 38.0 38.0 38.0 38.0 35-39 37.17805 38.0 38.0 38.0 37.8 38.0 40-44 37.2457 38.0 38.0 38.0 38.0 38.0 45-49 37.1854 38.0 38.0 38.0 37.8 38.0 50-54 37.19655 38.0 38.0 38.0 38.0 38.0 55-59 37.17715 38.0 38.0 38.0 37.6 38.0 60-64 37.20485 38.0 38.0 38.0 37.8 38.0 65-69 37.096500000000006 38.0 38.0 38.0 37.0 38.0 70-74 37.054500000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.0733 38.0 38.0 38.0 37.0 38.0 80-84 37.0398 38.0 38.0 38.0 37.0 38.0 85-89 37.00845 38.0 38.0 38.0 37.0 38.0 90-94 36.91 38.0 38.0 38.0 36.8 38.0 95-99 36.91535 38.0 38.0 38.0 36.8 38.0 100-104 36.851600000000005 38.0 38.0 38.0 36.8 38.0 105-109 36.7892 38.0 38.0 38.0 36.0 38.0 110-114 36.654250000000005 38.0 38.0 38.0 35.8 38.0 115-119 36.511849999999995 38.0 38.0 38.0 35.0 38.0 120-124 36.434450000000005 38.0 38.0 38.0 35.0 38.0 125-129 36.234899999999996 38.0 38.0 38.0 34.6 38.0 130-134 36.09865 38.0 38.0 38.0 34.0 38.0 135-139 35.9555 38.0 38.0 38.0 33.8 38.0 140-144 35.63655 38.0 37.8 38.0 33.2 38.0 145-149 35.070949999999996 38.0 36.0 38.0 31.4 38.0 150-151 31.84225 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 0.0 5 3.0 6 4.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 2.0 14 0.0 15 3.0 16 4.0 17 6.0 18 1.0 19 3.0 20 6.0 21 7.0 22 9.0 23 6.0 24 8.0 25 11.0 26 8.0 27 11.0 28 16.0 29 22.0 30 24.0 31 25.0 32 35.0 33 57.0 34 70.0 35 133.0 36 300.0 37 3205.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.045522761380695 15.607803901950975 17.008504252126063 26.338169084542272 2 24.5311327831958 25.131282820705174 31.782945736434108 18.554638659664917 3 20.825 28.9 30.5 19.775000000000002 4 25.525 33.725 21.45 19.3 5 24.73736868434217 34.99249624812406 21.53576788394197 18.734367183591797 6 20.65 35.175 25.224999999999998 18.95 7 19.525000000000002 18.25 40.849999999999994 21.375 8 22.400000000000002 21.825 28.599999999999998 27.175 9 22.125 25.775 28.050000000000004 24.05 10-14 24.082408240824083 27.662766276627664 26.257625762576257 21.997199719971995 15-19 23.347334733473346 27.317731773177318 27.87778777877788 21.457145714571457 20-24 23.482348234823483 27.797779777977798 27.597759775977597 21.122112211221122 25-29 23.794999999999998 28.1 27.48 20.625 30-34 23.189999999999998 27.985 27.445000000000004 21.38 35-39 22.741137056852843 28.266413320666032 27.45137256862843 21.541077053852693 40-44 23.395 27.875 27.63 21.099999999999998 45-49 23.77 27.37 28.055000000000003 20.805 50-54 23.335 27.99 27.63 21.044999999999998 55-59 24.596229811490574 27.28636431821591 27.376368818440923 20.741037051852594 60-64 23.405 28.535 27.224999999999998 20.835 65-69 24.361218060903045 27.561378068903448 27.52637631881594 20.55102755137757 70-74 22.994999999999997 27.805000000000003 27.925 21.275 75-79 23.655 27.500000000000004 27.750000000000004 21.095 80-84 23.57 27.865000000000002 27.425 21.14 85-89 23.915 27.33 27.939999999999998 20.815 90-94 24.04 27.150000000000002 27.83 20.979999999999997 95-99 23.72737273727373 27.262726272627262 28.04280428042804 20.96709670967097 100-104 24.196209810490522 27.411370568528426 28.116405820291014 20.276013800690034 105-109 24.253638045706857 27.954193128969347 27.614142121318196 20.1780267040056 110-114 24.621079485768597 27.622430093542093 27.587414336451406 20.169076084237908 115-119 24.934960976585952 27.331398839303585 27.61656994196518 20.11707024214529 120-124 24.5999199839968 27.045409081816363 27.825565113022606 20.529105821164233 125-129 24.76247624762476 27.432743274327432 27.412741274127413 20.392039203920394 130-134 25.343801570235534 27.69415412311847 27.094064109616443 19.867980197029556 135-139 25.11376706505976 28.0892133820073 26.994049107366102 19.802970445566835 140-144 25.595000000000002 27.615000000000002 26.93 19.86 145-149 25.661415353838457 27.711927981995498 26.881720430107524 19.744936234058514 150-151 26.040755094386796 28.26603325415677 26.2782847855982 19.41492686585823 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 2.0 28 2.5 29 2.5 30 8.0 31 13.5 32 17.5 33 23.0 34 32.0 35 48.0 36 59.5 37 92.0 38 122.0 39 155.5 40 192.5 41 202.0 42 230.0 43 290.0 44 309.0 45 282.5 46 283.0 47 269.5 48 246.0 49 223.0 50 188.5 51 147.0 52 126.0 53 112.0 54 80.0 55 61.5 56 47.0 57 30.5 58 20.5 59 18.0 60 13.0 61 9.5 62 8.0 63 8.0 64 5.5 65 3.5 66 3.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.01 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.005 105-109 0.015 110-114 0.045 115-119 0.06 120-124 0.02 125-129 0.01 130-134 0.015 135-139 0.015 140-144 0.0 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.65 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.425000000000001 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.324999999999999 0.0 0.0 0.0 0.0 130-131 5.75 0.0 0.0 0.0 0.0 132-133 6.1375 0.0 0.0 0.0 0.0 134-135 6.637499999999999 0.0 0.0 0.0 0.0 136-137 7.1875 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAA 10 0.006830828 145.0 4 AATTGCC 10 0.006830828 145.0 5 >>END_MODULE Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566960 spots for SRR7170119.sra Written 566960 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra Read 566944 spots for SRR7170119.sra Written 566944 spots for SRR7170119.sra SRR ids: ['SRR7170119.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w7f7b4fe SRR7170119.sra spots: 11338896 blocks: [[1, 566944], [566945, 1133888], [1133889, 1700832], [1700833, 2267776], [2267777, 2834720], [2834721, 3401664], [3401665, 3968608], [3968609, 4535552], [4535553, 5102496], [5102497, 5669440], [5669441, 6236384], [6236385, 6803328], [6803329, 7370272], [7370273, 7937216], [7937217, 8504160], [8504161, 9071104], [9071105, 9638048], [9638049, 10204992], [10204993, 10771936], [10771937, 11338896]] SRR7170119 file size 3820679 SRR7170119 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170119 SRR7170119_1.fastq SRR7170119_2.fastq Input file: SRR7170119_1.fastq Paired file: SRR7170119_2.fastq trimmed: SRR7170119-trimmed-pair1.fastq, SRR7170119-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:28:48 2025 >> started Wed Feb 12 11:29:00 2025 >> done (12.561s) 11338896 read pairs processed; of these: 21911 ( 0.19%) short read pairs filtered out after trimming by size control 24575 ( 0.22%) empty read pairs filtered out after trimming by size control 11292410 (99.59%) read pairs available; of these: 4603837 (40.77%) trimmed read pairs available after processing 6688573 (59.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 7 0.00% 22 12 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 10 0.00% 27 10 0.00% 28 11 0.00% 29 9 0.00% 30 8 0.00% 31 9 0.00% 32 13 0.00% 33 8 0.00% 34 14 0.00% 35 17 0.00% 36 19 0.00% 37 8 0.00% 38 10 0.00% 39 16 0.00% 40 26 0.00% 41 29 0.00% 42 22 0.00% 43 36 0.00% 44 37 0.00% 45 36 0.00% 46 33 0.00% 47 37 0.00% 48 46 0.00% 49 57 0.00% 50 64 0.00% 51 70 0.00% 52 84 0.00% 53 85 0.00% 54 100 0.00% 55 106 0.00% 56 111 0.00% 57 110 0.00% 58 143 0.00% 59 171 0.00% 60 189 0.00% 61 216 0.00% 62 229 0.00% 63 242 0.00% 64 302 0.00% 65 354 0.00% 66 425 0.00% 67 438 0.00% 68 500 0.00% 69 867 0.01% 70 1603 0.01% 71 2163 0.02% 72 1825 0.02% 73 1401 0.01% 74 1208 0.01% 75 1254 0.01% 76 1311 0.01% 77 1400 0.01% 78 1514 0.01% 79 1672 0.01% 80 1923 0.02% 81 2271 0.02% 82 2569 0.02% 83 2866 0.03% 84 4200 0.04% 85 4964 0.04% 86 5129 0.05% 87 5290 0.05% 88 5717 0.05% 89 5954 0.05% 90 6422 0.06% 91 7003 0.06% 92 7494 0.07% 93 8119 0.07% 94 8485 0.08% 95 8977 0.08% 96 9604 0.09% 97 9940 0.09% 98 10184 0.09% 99 10508 0.09% 100 11414 0.10% 101 12089 0.11% 102 12869 0.11% 103 13704 0.12% 104 14564 0.13% 105 15331 0.14% 106 15574 0.14% 107 16083 0.14% 108 16553 0.15% 109 16972 0.15% 110 17781 0.16% 111 18485 0.16% 112 20079 0.18% 113 20834 0.18% 114 21953 0.19% 115 22700 0.20% 116 22810 0.20% 117 23644 0.21% 118 24098 0.21% 119 24387 0.22% 120 24961 0.22% 121 25669 0.23% 122 26815 0.24% 123 28442 0.25% 124 29629 0.26% 125 30770 0.27% 126 31852 0.28% 127 32395 0.29% 128 32618 0.29% 129 33358 0.30% 130 34152 0.30% 131 35086 0.31% 132 37090 0.33% 133 38899 0.34% 134 40561 0.36% 135 42487 0.38% 136 44434 0.39% 137 46145 0.41% 138 47467 0.42% 139 48948 0.43% 140 50804 0.45% 141 54040 0.48% 142 58675 0.52% 143 63584 0.56% 144 72149 0.64% 145 82565 0.73% 146 98394 0.87% 147 125116 1.11% 148 178776 1.58% 149 342179 3.03% 150 2255513 19.97% 151 6688573 59.23% 11292410 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=231.66 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.72 fanout-score-rank=29 prefix-density=0.32 prefix-fanout=3.9 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=39 fanout-score=104.10 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=12.4 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCTCGG SRR7170119 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:29:43 Started mapping on | Feb 12 11:29:44 Finished on | Feb 12 11:30:47 Mapping speed, Million of reads per hour | 645.28 Number of input reads | 11292410 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10647997 Uniquely mapped reads % | 94.29% Average mapped length | 293.43 Number of splices: Total | 9857027 Number of splices: Annotated (sjdb) | 9688130 Number of splices: GT/AG | 9715226 Number of splices: GC/AG | 113653 Number of splices: AT/AC | 8448 Number of splices: Non-canonical | 19700 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193284 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 14139 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471813 471813 471813 N_multimapping 193284 193284 193284 N_noFeature 224002 10534784 266026 N_ambiguous 113836 480 42394 UnstrandedReadsAssigned:10310159 PositiveStrandReadsAssigned:112733 NegativeStrandReadsAssigned:10339577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170119 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170119-trimmed-pair1.fastq SRR7170119-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,292,410 reads, 10,286,415 reads pseudoaligned [quant] estimated average fragment length: 231.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR7170119.ke.tsv 34699 SRR7170119.se.tsv 87100 total ==> SRR7170119.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.86 172 8.39676 Potri.005G024800.1.v4.1 1035 804.861 31 3.36169 Potri.004G059700.1.v4.1 961 730.907 1 0.119414 Potri.007G009000.2.v4.1 1416 1185.86 0 0 Potri.003G141000.2.v4.1 2943 2712.86 193 6.20936 Potri.016G087400.1.v4.1 270 85.3614 1418.57 1450.46 Potri.015G069301.1.v4.1 564 338.558 0 0 Potri.010G195200.1.v4.1 1773 1542.86 9 0.509135 Potri.012G127500.1.v4.1 977 746.884 4867 568.755 ==> SRR7170119.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 790 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 234 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170119 completed mapping pipeline successfully