Starting /dee2/code/volunteer_pipeline.sh SRR7170120 current disk space = 3051201773568 free memory = 1437553788 SRR7170120 SRAfilesize 9ebc61a97454b832045e3a3115781870 SRR7170120.sra SRR7170120.sra file validated SRR7170120 is paired end SRR7170120 is conventional basespace SRR7170120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4035 34.0 33.0 34.0 33.0 34.0 2 33.495 34.0 34.0 34.0 33.0 34.0 3 33.50675 34.0 34.0 34.0 33.0 34.0 4 33.51675 34.0 34.0 34.0 33.0 34.0 5 33.46925 34.0 34.0 34.0 33.0 34.0 6 36.92625 38.0 37.0 38.0 35.0 38.0 7 37.2565 38.0 38.0 38.0 36.0 38.0 8 37.415 38.0 38.0 38.0 37.0 38.0 9 37.41875 38.0 38.0 38.0 37.0 38.0 10-14 37.38465 38.0 38.0 38.0 37.0 38.0 15-19 37.39965 38.0 38.0 38.0 37.0 38.0 20-24 37.319849999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.235749999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.2036 38.0 38.0 38.0 36.4 38.0 35-39 37.131550000000004 38.0 38.0 38.0 36.2 38.0 40-44 36.68315 38.0 38.0 38.0 34.4 38.0 45-49 36.4996 38.0 37.6 38.0 34.0 38.0 50-54 36.44970000000001 38.0 37.2 38.0 34.0 38.0 55-59 36.28155 38.0 37.0 38.0 33.4 38.0 60-64 36.3481 38.0 37.0 38.0 33.6 38.0 65-69 36.226299999999995 38.0 37.0 38.0 33.0 38.0 70-74 36.094899999999996 38.0 37.0 38.0 33.0 38.0 75-79 35.8955 38.0 37.0 38.0 31.2 38.0 80-84 35.75885 38.0 37.0 38.0 31.0 38.0 85-89 35.517250000000004 38.0 36.0 38.0 29.4 38.0 90-94 35.428799999999995 38.0 36.0 38.0 29.0 38.0 95-99 35.129650000000005 38.0 36.0 38.0 28.6 38.0 100-104 34.975 38.0 35.2 38.0 28.0 38.0 105-109 34.64375 38.0 35.0 38.0 26.6 38.0 110-114 34.4034 38.0 34.6 38.0 25.0 38.0 115-119 34.15145 38.0 34.0 38.0 23.0 38.0 120-124 33.77204999999999 38.0 34.0 38.0 22.6 38.0 125-129 33.27105 37.8 33.6 38.0 16.2 38.0 130-134 32.615449999999996 37.0 32.4 38.0 15.0 38.0 135-139 31.939249999999998 36.2 31.0 38.0 14.4 38.0 140-144 31.209749999999996 36.0 30.6 38.0 13.8 38.0 145-149 30.052000000000003 35.6 28.6 38.0 6.4 38.0 150-151 25.374125 33.0 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 2.0 16 6.0 17 2.0 18 7.0 19 10.0 20 8.0 21 18.0 22 10.0 23 20.0 24 24.0 25 32.0 26 31.0 27 45.0 28 43.0 29 50.0 30 73.0 31 102.0 32 130.0 33 198.0 34 313.0 35 551.0 36 1065.0 37 1253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.180225281602006 15.018773466833544 7.9599499374217775 32.841051314142675 2 20.849999999999998 19.675 37.6 21.875 3 19.075 25.25 28.475 27.200000000000003 4 23.0 33.025 22.225 21.75 5 21.15 35.65 23.925 19.275000000000002 6 17.424999999999997 34.425 26.700000000000003 21.45 7 13.825000000000001 23.0 44.15 19.025 8 17.175 23.125 31.2 28.499999999999996 9 18.6 23.0 31.85 26.55 10-14 20.36 29.830000000000002 27.105 22.705000000000002 15-19 20.185 28.360000000000003 27.52 23.935000000000002 20-24 20.345 28.845 26.935 23.875 25-29 20.025000000000002 28.77 28.095 23.11 30-34 20.169999999999998 28.33 28.125 23.375 35-39 20.380000000000003 28.499999999999996 27.215 23.905 40-44 20.82 28.294999999999998 26.924999999999997 23.96 45-49 20.185 28.249999999999996 28.04 23.525 50-54 20.055 28.175 28.205000000000002 23.565 55-59 20.09 28.000000000000004 28.015 23.895 60-64 20.26 28.439999999999998 27.439999999999998 23.86 65-69 20.275000000000002 28.505000000000003 27.32 23.9 70-74 20.01 28.685 27.48 23.825 75-79 21.025 27.915 27.26 23.799999999999997 80-84 20.415 28.360000000000003 27.3 23.925 85-89 20.974999999999998 28.475 27.67 22.88 90-94 20.705000000000002 27.99 28.325 22.98 95-99 21.014202840568114 28.205641128225643 27.410482096419287 23.36967393478696 100-104 20.565 28.4 27.54 23.494999999999997 105-109 20.91 28.515 26.865 23.71 110-114 20.630000000000003 29.110000000000003 26.99 23.27 115-119 20.405 28.439999999999998 27.065 24.09 120-124 21.145 28.244999999999997 27.345000000000002 23.265 125-129 21.044999999999998 28.005000000000003 27.025 23.925 130-134 21.11 28.585 26.790000000000003 23.515 135-139 20.855 28.32 27.310000000000002 23.515 140-144 21.605 28.165000000000003 26.474999999999998 23.755000000000003 145-149 20.93 28.444999999999997 26.66 23.965 150-151 21.177647205900737 28.6160770096262 26.440805100637583 23.76547068383548 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 1.5 23 2.0 24 3.5 25 3.0 26 2.0 27 4.5 28 10.0 29 14.0 30 18.5 31 23.0 32 33.5 33 38.5 34 44.0 35 68.0 36 91.0 37 113.0 38 131.0 39 153.5 40 189.0 41 220.0 42 251.5 43 278.0 44 274.0 45 258.0 46 266.0 47 255.0 48 229.0 49 206.0 50 166.0 51 135.0 52 118.5 53 100.5 54 73.0 55 54.0 56 41.5 57 32.0 58 24.0 59 18.5 60 14.0 61 6.0 62 7.0 63 7.0 64 3.0 65 2.5 66 2.0 67 3.5 68 3.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.725 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.925 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.425 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAAATA 10 0.006830828 145.0 2 >>END_MODULE SRR7170120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79 33.0 33.0 34.0 32.0 34.0 2 32.93875 34.0 33.0 34.0 32.0 34.0 3 32.61675 34.0 33.0 34.0 32.0 34.0 4 32.43475 34.0 33.0 34.0 32.0 34.0 5 32.4215 34.0 33.0 34.0 32.0 34.0 6 36.81125 38.0 38.0 38.0 36.0 38.0 7 36.85875 38.0 38.0 38.0 37.0 38.0 8 36.8435 38.0 38.0 38.0 36.0 38.0 9 36.79075 38.0 38.0 38.0 37.0 38.0 10-14 36.706199999999995 38.0 38.0 38.0 36.4 38.0 15-19 36.508649999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.584900000000005 38.0 38.0 38.0 36.2 38.0 25-29 36.601299999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.58195 38.0 38.0 38.0 36.0 38.0 35-39 36.42255 38.0 38.0 38.0 36.0 38.0 40-44 36.36905 38.0 38.0 38.0 35.6 38.0 45-49 36.3172 38.0 38.0 38.0 35.2 38.0 50-54 36.427249999999994 38.0 38.0 38.0 35.8 38.0 55-59 36.427099999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.322449999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.2247 38.0 38.0 38.0 34.6 38.0 70-74 36.24405 38.0 38.0 38.0 34.4 38.0 75-79 36.0793 38.0 38.0 38.0 34.0 38.0 80-84 36.09085 38.0 38.0 38.0 34.0 38.0 85-89 35.5976 38.0 38.0 38.0 32.4 38.0 90-94 35.3021 38.0 38.0 38.0 29.8 38.0 95-99 35.641000000000005 38.0 38.0 38.0 31.8 38.0 100-104 35.593050000000005 38.0 37.8 38.0 31.8 38.0 105-109 35.36149999999999 38.0 37.0 38.0 30.4 38.0 110-114 35.1518 38.0 37.0 38.0 29.0 38.0 115-119 35.0726 38.0 37.0 38.0 28.4 38.0 120-124 34.7693 38.0 36.2 38.0 27.4 38.0 125-129 34.34715 38.0 36.0 38.0 25.0 38.0 130-134 33.2664 38.0 35.2 38.0 16.2 38.0 135-139 32.0641 38.0 34.0 38.0 6.4 38.0 140-144 31.29835 38.0 33.2 38.0 2.0 38.0 145-149 30.682849999999995 38.0 31.6 38.0 2.0 38.0 150-151 26.843125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 14.0 4 3.0 5 4.0 6 0.0 7 0.0 8 2.0 9 1.0 10 3.0 11 3.0 12 3.0 13 7.0 14 1.0 15 7.0 16 6.0 17 7.0 18 7.0 19 10.0 20 7.0 21 8.0 22 17.0 23 11.0 24 22.0 25 24.0 26 25.0 27 30.0 28 41.0 29 48.0 30 65.0 31 70.0 32 126.0 33 136.0 34 150.0 35 234.0 36 530.0 37 2337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.540310465698546 21.031547320981474 10.540811216825238 24.887330996494743 2 24.061091637456183 24.962443665498245 34.05107661492238 16.925388082123185 3 20.78481012658228 27.26582278481013 30.683544303797465 21.265822784810126 4 23.824052885837784 37.02008644800407 20.671243325705568 18.48461734045258 5 23.678861788617887 37.77947154471545 20.78252032520325 17.759146341463413 6 18.93729539158902 37.32057416267943 23.621254092168222 20.120876353563332 7 17.188674517664744 18.667000751691308 42.245051365572536 21.899273365071412 8 20.576441102756892 23.884711779448622 27.39348370927318 28.145363408521302 9 21.964150467053773 23.80711941428932 28.957334006564 25.2713961120929 10-14 22.743152245455928 28.201103741582706 27.28975748063389 21.765986532327478 15-19 22.8796343321483 27.66378872524124 28.156424581005584 21.300152361604876 20-24 22.821681864235053 28.991894630192505 27.22391084093212 20.96251266464032 25-29 22.570880839471293 28.387650085763294 27.70154373927959 21.339925335485823 30-34 22.89833080424886 27.587253414264033 28.42185128983308 21.09256449165402 35-39 22.970025866003958 28.112796064309986 28.04179134756809 20.87538672211797 40-44 23.075358486728366 27.900945794772703 27.906030712905523 21.117665005593413 45-49 23.27673851159008 28.044936966246443 27.623017486783247 21.055307035380235 50-54 22.651040614265508 27.88947262073146 28.35421297231764 21.10527379268539 55-59 23.533583223584237 27.889778137979942 27.99108499645426 20.585553641981562 60-64 22.55730405302839 28.229519809745483 28.65961645499165 20.55355968223448 65-69 23.118035597236926 27.580295467150705 28.225684465285134 21.07598447032723 70-74 23.589538029862712 27.953702775829242 27.893576510672414 20.563182683635635 75-79 23.219829744616927 27.44616925388082 28.16725087631447 21.16675012518778 80-84 23.27607918198761 27.320807938346846 28.479323024228076 20.923789855437466 85-89 23.879759109931612 27.636011023782793 27.96264162498724 20.521588241298357 90-94 23.751153964509182 27.500256436557596 27.638732177659247 21.10985742127398 95-99 23.546877358965325 27.960344220220424 27.970409138946202 20.52236928186805 100-104 24.139663401155488 27.872393870886714 27.786988193921125 20.200954534036676 105-109 23.65792129162462 27.83047426841574 27.98183652875883 20.529767911200807 110-114 24.228963707031447 27.595780122154355 27.767401948412495 20.407854222401696 115-119 23.796133567662565 27.86844087371328 27.81320612603565 20.5222194325885 120-124 24.03085244916358 27.3464890313533 27.882400080136232 20.74025843934689 125-129 24.07632351452576 27.83682558963458 27.755845733373825 20.331005162465836 130-134 24.293755863650578 28.510372146356715 27.01448973209632 20.18138225789638 135-139 24.321736354931375 27.465687839131824 28.013618470050005 20.198957335886796 140-144 24.922051392323404 27.335770347274487 27.41640683797441 20.325771422427696 145-149 24.860623580425354 28.102415857939295 26.646706586826348 20.390253974809003 150-151 24.77471760375682 29.089986038837417 26.65312856961543 19.482167787790328 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 1.0 4 2.0 5 1.5 6 2.0 7 2.0 8 1.0 9 2.5 10 4.5 11 4.5 12 4.0 13 4.0 14 4.5 15 3.5 16 2.0 17 3.0 18 2.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 2.5 25 3.0 26 3.0 27 4.0 28 6.5 29 7.0 30 9.0 31 21.5 32 32.5 33 35.0 34 46.5 35 66.5 36 86.5 37 114.0 38 138.0 39 166.0 40 193.5 41 212.0 42 247.5 43 266.0 44 270.0 45 281.0 46 275.0 47 261.5 48 227.5 49 186.5 50 166.0 51 141.5 52 118.0 53 104.0 54 75.0 55 44.5 56 30.5 57 24.0 58 20.5 59 14.5 60 9.5 61 6.5 62 8.0 63 8.5 64 4.5 65 3.0 66 2.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.15 3 1.25 4 1.675 5 1.6 6 0.7250000000000001 7 0.22499999999999998 8 0.25 9 0.975 10-14 1.2449999999999999 15-19 1.55 20-24 1.3 25-29 0.89 30-34 1.15 35-39 1.415 40-44 1.67 45-49 1.6400000000000001 50-54 1.02 55-59 1.29 60-64 1.185 65-69 0.835 70-74 0.21 75-79 0.15 80-84 0.735 85-89 2.03 90-94 2.5100000000000002 95-99 0.645 100-104 0.475 105-109 0.8999999999999999 110-114 0.9450000000000001 115-119 0.42500000000000004 120-124 0.16999999999999998 125-129 1.21 130-134 4.07 135-139 6.01 140-144 6.99 145-149 3.1399999999999997 150-151 1.5125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5285678328718851 1.05 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACTGCACGCAAAGAGCAGAGAGAGAGAGAGAGTATCAAAACTAGCAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 6.074999999999999 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGCT 10 0.0070926235 143.16457 7 >>END_MODULE Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857625 spots for SRR7170120.sra Written 857625 spots for SRR7170120.sra Read 857631 spots for SRR7170120.sra Written 857631 spots for SRR7170120.sra SRR ids: ['SRR7170120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iyjbapma SRR7170120.sra spots: 17152506 blocks: [[1, 857625], [857626, 1715250], [1715251, 2572875], [2572876, 3430500], [3430501, 4288125], [4288126, 5145750], [5145751, 6003375], [6003376, 6861000], [6861001, 7718625], [7718626, 8576250], [8576251, 9433875], [9433876, 10291500], [10291501, 11149125], [11149126, 12006750], [12006751, 12864375], [12864376, 13722000], [13722001, 14579625], [14579626, 15437250], [15437251, 16294875], [16294876, 17152506]] SRR7170120 file size 5790721 SRR7170120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170120 SRR7170120_1.fastq SRR7170120_2.fastq Input file: SRR7170120_1.fastq Paired file: SRR7170120_2.fastq trimmed: SRR7170120-trimmed-pair1.fastq, SRR7170120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:56:02 2025 >> started Wed Feb 12 10:56:20 2025 >> done (18.669s) 17152506 read pairs processed; of these: 28597 ( 0.17%) short read pairs filtered out after trimming by size control 28810 ( 0.17%) empty read pairs filtered out after trimming by size control 17095099 (99.67%) read pairs available; of these: 10049536 (58.79%) trimmed read pairs available after processing 7045563 (41.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 6 0.00% 21 5 0.00% 22 9 0.00% 23 7 0.00% 24 8 0.00% 25 9 0.00% 26 9 0.00% 27 8 0.00% 28 4 0.00% 29 9 0.00% 30 9 0.00% 31 12 0.00% 32 8 0.00% 33 12 0.00% 34 11 0.00% 35 12 0.00% 36 16 0.00% 37 17 0.00% 38 15 0.00% 39 24 0.00% 40 31 0.00% 41 23 0.00% 42 27 0.00% 43 37 0.00% 44 42 0.00% 45 50 0.00% 46 45 0.00% 47 57 0.00% 48 63 0.00% 49 71 0.00% 50 88 0.00% 51 86 0.00% 52 122 0.00% 53 105 0.00% 54 115 0.00% 55 137 0.00% 56 147 0.00% 57 162 0.00% 58 207 0.00% 59 231 0.00% 60 283 0.00% 61 289 0.00% 62 329 0.00% 63 398 0.00% 64 441 0.00% 65 427 0.00% 66 529 0.00% 67 630 0.00% 68 763 0.00% 69 866 0.01% 70 956 0.01% 71 1057 0.01% 72 1143 0.01% 73 1251 0.01% 74 1412 0.01% 75 1635 0.01% 76 1708 0.01% 77 1962 0.01% 78 2199 0.01% 79 2516 0.01% 80 2820 0.02% 81 3318 0.02% 82 3802 0.02% 83 4372 0.03% 84 5550 0.03% 85 6311 0.04% 86 6520 0.04% 87 6737 0.04% 88 7340 0.04% 89 7796 0.05% 90 8515 0.05% 91 9057 0.05% 92 10013 0.06% 93 10701 0.06% 94 11538 0.07% 95 12220 0.07% 96 13195 0.08% 97 13682 0.08% 98 14434 0.08% 99 15471 0.09% 100 16157 0.09% 101 17244 0.10% 102 18351 0.11% 103 19828 0.12% 104 21111 0.12% 105 22703 0.13% 106 23542 0.14% 107 24263 0.14% 108 25920 0.15% 109 26286 0.15% 110 27723 0.16% 111 29281 0.17% 112 31063 0.18% 113 32807 0.19% 114 34166 0.20% 115 36356 0.21% 116 37398 0.22% 117 39067 0.23% 118 40670 0.24% 119 41718 0.24% 120 43541 0.25% 121 46202 0.27% 122 48752 0.29% 123 51408 0.30% 124 54272 0.32% 125 56176 0.33% 126 59663 0.35% 127 61894 0.36% 128 64177 0.38% 129 68032 0.40% 130 70965 0.42% 131 74235 0.43% 132 79854 0.47% 133 84763 0.50% 134 89879 0.53% 135 95658 0.56% 136 101550 0.59% 137 109960 0.64% 138 119146 0.70% 139 128257 0.75% 140 139725 0.82% 141 152690 0.89% 142 170388 1.00% 143 189510 1.11% 144 219300 1.28% 145 264003 1.54% 146 325891 1.91% 147 428566 2.51% 148 635620 3.72% 149 1157828 6.77% 150 4095726 23.96% 151 7045563 41.21% 17095099 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGCTA criterion=fanout-score sequence-density=0.15 sequence-density-rank=5 fanout-score=83.43 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=18.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=20 prefix-density=0.42 prefix-fanout=3.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=76.80 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=8.5 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGGCGGCCTCGCTTGGGCCACCACTGACCAAGTCCTCCAAGAGGCTTTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA SRR7170120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:57:01 Started mapping on | Feb 12 10:57:01 Finished on | Feb 12 10:58:28 Mapping speed, Million of reads per hour | 707.38 Number of input reads | 17095099 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16299524 Uniquely mapped reads % | 95.35% Average mapped length | 291.54 Number of splices: Total | 15385329 Number of splices: Annotated (sjdb) | 15134846 Number of splices: GT/AG | 15161406 Number of splices: GC/AG | 178953 Number of splices: AT/AC | 12453 Number of splices: Non-canonical | 32517 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285346 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 86313 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 529659 529659 529659 N_multimapping 285346 285346 285346 N_noFeature 388362 16144945 460187 N_ambiguous 150762 1055 67179 UnstrandedReadsAssigned:15760400 PositiveStrandReadsAssigned:153524 NegativeStrandReadsAssigned:15772158 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170120-trimmed-pair1.fastq SRR7170120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,095,099 reads, 15,710,473 reads pseudoaligned [quant] estimated average fragment length: 235.341 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7170120.ke.tsv 34699 SRR7170120.se.tsv 87100 total ==> SRR7170120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.66 275 10.1504 Potri.005G024800.1.v4.1 1035 800.659 23 1.89123 Potri.004G059700.1.v4.1 961 726.712 0 0 Potri.007G009000.2.v4.1 1416 1181.66 0 0 Potri.003G141000.2.v4.1 2943 2708.66 245.025 5.95552 Potri.016G087400.1.v4.1 270 85.6163 1511 1161.91 Potri.015G069301.1.v4.1 564 335.785 0 0 Potri.010G195200.1.v4.1 1773 1538.66 29 1.24085 Potri.012G127500.1.v4.1 977 742.691 6208 550.309 ==> SRR7170120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1150 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170120 completed mapping pipeline successfully