Starting /dee2/code/volunteer_pipeline.sh SRR7170121 current disk space = 3051297746944 free memory = 1579409824 SRR7170121 SRAfilesize 52b6ed57e44176bea702d95402c90b8d SRR7170121.sra SRR7170121.sra file validated SRR7170121 is paired end SRR7170121 is conventional basespace SRR7170121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28725 34.0 33.0 34.0 33.0 34.0 2 33.45475 34.0 33.0 34.0 33.0 34.0 3 33.46875 34.0 34.0 34.0 33.0 34.0 4 33.4525 34.0 34.0 34.0 33.0 34.0 5 33.46375 34.0 34.0 34.0 33.0 34.0 6 36.89825 38.0 37.0 38.0 35.0 38.0 7 37.135 38.0 38.0 38.0 36.0 38.0 8 37.2905 38.0 38.0 38.0 37.0 38.0 9 37.3375 38.0 38.0 38.0 37.0 38.0 10-14 37.3444 38.0 38.0 38.0 37.0 38.0 15-19 37.28985 38.0 38.0 38.0 36.8 38.0 20-24 37.263850000000005 38.0 38.0 38.0 36.6 38.0 25-29 37.2296 38.0 38.0 38.0 36.6 38.0 30-34 37.1793 38.0 38.0 38.0 36.2 38.0 35-39 37.03975 38.0 38.0 38.0 35.8 38.0 40-44 36.496249999999996 38.0 37.8 38.0 34.0 38.0 45-49 36.4301 38.0 37.0 38.0 33.8 38.0 50-54 36.25555000000001 38.0 37.0 38.0 33.0 38.0 55-59 36.113 38.0 37.0 38.0 32.6 38.0 60-64 35.9628 38.0 37.0 38.0 32.0 38.0 65-69 35.97255 38.0 37.0 38.0 32.0 38.0 70-74 35.8169 38.0 36.8 38.0 30.6 38.0 75-79 35.64235 38.0 36.2 38.0 29.6 38.0 80-84 35.5247 38.0 36.0 38.0 29.4 38.0 85-89 35.34335 38.0 36.0 38.0 29.0 38.0 90-94 35.073699999999995 38.0 35.6 38.0 28.6 38.0 95-99 34.76475 38.0 35.0 38.0 27.4 38.0 100-104 34.60245 38.0 34.8 38.0 26.2 38.0 105-109 34.24595 38.0 34.2 38.0 24.0 38.0 110-114 33.7036 38.0 34.0 38.0 19.4 38.0 115-119 33.3949 37.6 33.6 38.0 17.4 38.0 120-124 33.1366 37.4 33.2 38.0 15.0 38.0 125-129 32.47325 37.0 31.8 38.0 15.0 38.0 130-134 31.658950000000004 36.2 30.4 38.0 14.8 38.0 135-139 31.1601 36.0 28.8 38.0 14.0 38.0 140-144 30.189149999999994 35.4 27.4 38.0 13.2 38.0 145-149 28.77115 34.6 23.8 38.0 2.0 38.0 150-151 23.800874999999998 31.5 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 3.0 14 2.0 15 2.0 16 1.0 17 3.0 18 6.0 19 12.0 20 16.0 21 14.0 22 23.0 23 21.0 24 25.0 25 28.0 26 41.0 27 46.0 28 51.0 29 76.0 30 101.0 31 123.0 32 160.0 33 225.0 34 381.0 35 618.0 36 1103.0 37 916.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.53996983408748 13.398692810457517 13.147310206133737 38.91402714932127 2 20.8 20.025000000000002 37.65 21.525 3 20.3 26.375 25.15 28.175 4 23.225 34.8 20.549999999999997 21.425 5 20.4801200300075 39.53488372093023 22.80570142535634 17.179294823705927 6 17.175 36.9 26.450000000000003 19.475 7 13.600000000000001 23.45 44.55 18.4 8 18.15 23.1 29.525000000000002 29.225 9 18.15 22.25 33.025 26.575 10-14 19.775000000000002 30.17 26.66 23.395 15-19 19.555 29.189999999999998 27.639999999999997 23.615 20-24 20.23 28.235 27.810000000000002 23.724999999999998 25-29 19.915 29.425 27.029999999999998 23.630000000000003 30-34 20.305 28.99 27.255000000000003 23.45 35-39 20.465 28.875 27.295 23.365 40-44 19.925 29.095 27.22 23.76 45-49 20.085 28.96 26.735 24.22 50-54 19.825 29.044999999999998 27.195000000000004 23.935000000000002 55-59 20.315 28.194999999999997 27.224999999999998 24.265 60-64 19.89 28.88 27.235 23.995 65-69 20.345 29.165000000000003 26.68 23.810000000000002 70-74 20.76 28.694999999999997 27.16 23.385 75-79 20.71 27.894999999999996 27.315 24.08 80-84 20.705000000000002 28.29 27.034999999999997 23.97 85-89 20.5 28.4 27.839999999999996 23.26 90-94 20.275000000000002 28.82 26.650000000000002 24.255 95-99 20.86 28.325 27.43 23.385 100-104 21.09 28.199999999999996 27.439999999999998 23.27 105-109 20.794999999999998 28.389999999999997 27.279999999999998 23.535 110-114 21.0 28.625 26.939999999999998 23.435 115-119 21.12 28.689999999999998 26.47 23.72 120-124 20.630000000000003 28.77 27.21 23.39 125-129 20.3 28.849999999999998 27.529999999999998 23.32 130-134 20.974999999999998 28.060000000000002 27.01 23.955000000000002 135-139 20.71 28.525 27.345000000000002 23.419999999999998 140-144 20.895 27.855 27.584999999999997 23.665 145-149 21.29 28.895 26.58 23.235 150-151 20.580145036259065 28.707176794198553 27.019254813703427 23.69342335583896 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 2.5 22 2.0 23 1.0 24 2.5 25 4.5 26 5.0 27 8.5 28 9.5 29 12.5 30 19.0 31 24.0 32 34.0 33 43.0 34 45.0 35 53.0 36 76.0 37 117.0 38 137.5 39 144.5 40 170.5 41 199.5 42 248.5 43 294.0 44 286.5 45 273.0 46 286.5 47 274.0 48 237.0 49 191.5 50 155.5 51 136.5 52 117.0 53 97.5 54 78.5 55 58.0 56 37.0 57 24.5 58 22.0 59 17.5 60 10.0 61 8.0 62 6.5 63 3.5 64 4.5 65 6.0 66 3.0 67 1.5 68 1.5 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 3.8625 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAACA 10 0.006830828 145.0 7 >>END_MODULE SRR7170121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87575 33.0 33.0 34.0 32.0 34.0 2 33.03625 34.0 33.0 34.0 32.0 34.0 3 32.9395 34.0 33.0 34.0 32.0 34.0 4 32.7185 34.0 33.0 34.0 32.0 34.0 5 32.8565 34.0 33.0 34.0 32.0 34.0 6 37.12 38.0 38.0 38.0 37.0 38.0 7 37.21 38.0 38.0 38.0 37.0 38.0 8 37.14375 38.0 38.0 38.0 37.0 38.0 9 37.09975 38.0 38.0 38.0 37.0 38.0 10-14 37.08215 38.0 38.0 38.0 36.8 38.0 15-19 36.9507 38.0 38.0 38.0 36.4 38.0 20-24 36.99804999999999 38.0 38.0 38.0 36.4 38.0 25-29 37.041799999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.060050000000004 38.0 38.0 38.0 36.8 38.0 35-39 36.8675 38.0 38.0 38.0 36.0 38.0 40-44 36.69375 38.0 38.0 38.0 36.0 38.0 45-49 36.65025 38.0 38.0 38.0 35.8 38.0 50-54 36.88235 38.0 38.0 38.0 36.0 38.0 55-59 36.846250000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.755900000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.71365 38.0 38.0 38.0 35.6 38.0 70-74 36.70185000000001 38.0 38.0 38.0 35.4 38.0 75-79 36.56355 38.0 38.0 38.0 34.6 38.0 80-84 36.498400000000004 38.0 38.0 38.0 34.4 38.0 85-89 36.0904 38.0 38.0 38.0 33.8 38.0 90-94 35.76584999999999 38.0 38.0 38.0 33.0 38.0 95-99 36.1261 38.0 38.0 38.0 33.2 38.0 100-104 36.0525 38.0 38.0 38.0 33.0 38.0 105-109 35.9917 38.0 37.6 38.0 33.2 38.0 110-114 35.77015 38.0 37.0 38.0 31.6 38.0 115-119 35.4829 38.0 37.0 38.0 30.2 38.0 120-124 35.32505 38.0 36.4 38.0 30.2 38.0 125-129 34.689499999999995 38.0 35.8 38.0 27.0 38.0 130-134 33.4723 38.0 34.8 38.0 16.4 38.0 135-139 32.244749999999996 38.0 34.0 38.0 11.0 38.0 140-144 31.227250000000005 38.0 32.8 38.0 2.0 38.0 145-149 30.686650000000004 38.0 31.8 38.0 2.0 38.0 150-151 27.183500000000002 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 4.0 17 3.0 18 7.0 19 8.0 20 14.0 21 13.0 22 17.0 23 22.0 24 17.0 25 22.0 26 38.0 27 38.0 28 37.0 29 41.0 30 57.0 31 76.0 32 140.0 33 158.0 34 175.0 35 246.0 36 547.0 37 2297.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.08640120210369 15.20160280490859 17.831204608064112 31.88079138492362 2 24.731182795698924 23.1807951987997 34.358589647411854 17.72943235808952 3 21.2707182320442 27.49874434957308 29.95981918633852 21.2707182320442 4 25.239536056480084 33.91326273323247 21.608673726676752 19.23852748361069 5 24.510296333500754 36.91612255148166 20.894023103967854 17.67955801104972 6 17.325 38.125 24.075 20.474999999999998 7 17.675 17.150000000000002 42.025 23.150000000000002 8 21.05 22.1 29.099999999999998 27.750000000000004 9 23.375 23.05 29.075 24.5 10-14 22.65124198717949 28.690905448717945 26.352163461538463 22.305689102564102 15-19 22.868897697054837 27.896242035020823 27.374441824293815 21.860418443630525 20-24 22.803504380475594 27.579474342928663 28.340425531914892 21.27659574468085 25-29 22.875 28.000000000000004 27.22 21.905 30-34 23.35 27.865000000000002 27.589999999999996 21.195 35-39 23.025589563472153 27.947817360762667 27.41093828399398 21.6156547917712 40-44 23.087383530596828 27.615210274490053 28.103752203475196 21.193653991437923 45-49 23.56905743888945 27.356402776380644 28.060557287999195 21.01398249673071 50-54 22.89759367652209 28.02541397768773 27.785281905047775 21.29171044074241 55-59 23.205000000000002 27.47 27.779999999999998 21.545 60-64 23.365841460365093 28.00200050012503 27.911977994498628 20.72018004501125 65-69 23.273618895116094 27.66212970376301 28.09747798238591 20.966773418734988 70-74 23.799999999999997 27.765 27.245 21.19 75-79 23.595 27.63 27.68 21.095 80-84 23.325000000000003 27.975 27.72 20.979999999999997 85-89 23.357590458863957 27.602587426723268 28.21912270062664 20.820699413786134 90-94 24.153853960521644 28.157507484650125 26.975186481960723 20.713452072867508 95-99 23.7221166349905 27.403220966289886 28.04341302390717 20.831249374812444 100-104 23.445 27.725 27.76 21.07 105-109 23.93 27.35 27.77 20.95 110-114 24.02 27.584999999999997 27.875 20.52 115-119 24.97 27.275 27.41 20.345 120-124 24.395 27.560000000000002 27.894999999999996 20.150000000000002 125-129 24.532287266143634 27.625226312613155 27.212834439750555 20.629651981492657 130-134 24.672024889810736 28.18771065595022 27.15063520871143 19.989629245527613 135-139 24.290120174412422 27.480591300648726 27.719876635116453 20.509411889822395 140-144 24.698957827096496 27.98747232571953 27.09109563151358 20.222474215670392 145-149 25.100071846453865 28.312634712100998 26.72174894796264 19.865544493482503 150-151 24.53067909789593 27.47889630842888 28.13405568854731 19.856368905127884 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 2.0 24 1.5 25 6.0 26 6.0 27 4.5 28 5.0 29 9.0 30 11.0 31 15.5 32 21.0 33 25.5 34 41.0 35 56.5 36 73.0 37 102.5 38 136.5 39 156.5 40 180.0 41 218.0 42 246.0 43 257.5 44 262.5 45 276.0 46 276.0 47 266.0 48 255.0 49 208.5 50 168.5 51 152.0 52 134.5 53 110.0 54 80.5 55 58.5 56 55.5 57 42.0 58 17.5 59 13.0 60 13.5 61 11.0 62 6.0 63 3.5 64 4.0 65 3.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.025 3 0.44999999999999996 4 0.8500000000000001 5 0.44999999999999996 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.16 15-19 0.345 20-24 0.125 25-29 0.0 30-34 0.0 35-39 0.35000000000000003 40-44 0.7250000000000001 45-49 0.59 50-54 0.055 55-59 0.0 60-64 0.025 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.06 90-94 1.465 95-99 0.03 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.58 130-134 3.5749999999999997 135-139 5.970000000000001 140-144 7.405 145-149 2.5700000000000003 150-151 0.7875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.4781077000503271 0.95 3 0.050327126321087066 0.15 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.275 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 4.875 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCAG 10 0.0070355474 143.57501 7 >>END_MODULE Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921390 spots for SRR7170121.sra Written 921390 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra Read 921371 spots for SRR7170121.sra Written 921371 spots for SRR7170121.sra SRR ids: ['SRR7170121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o6ul1qn3 SRR7170121.sra spots: 18427439 blocks: [[1, 921371], [921372, 1842742], [1842743, 2764113], [2764114, 3685484], [3685485, 4606855], [4606856, 5528226], [5528227, 6449597], [6449598, 7370968], [7370969, 8292339], [8292340, 9213710], [9213711, 10135081], [10135082, 11056452], [11056453, 11977823], [11977824, 12899194], [12899195, 13820565], [13820566, 14741936], [14741937, 15663307], [15663308, 16584678], [16584679, 17506049], [17506050, 18427439]] SRR7170121 file size 6222754 SRR7170121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170121 SRR7170121_1.fastq SRR7170121_2.fastq Input file: SRR7170121_1.fastq Paired file: SRR7170121_2.fastq trimmed: SRR7170121-trimmed-pair1.fastq, SRR7170121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:54:28 2025 >> started Wed Feb 12 11:54:48 2025 >> done (19.711s) 18427439 read pairs processed; of these: 20685 ( 0.11%) short read pairs filtered out after trimming by size control 21048 ( 0.11%) empty read pairs filtered out after trimming by size control 18385706 (99.77%) read pairs available; of these: 11040281 (60.05%) trimmed read pairs available after processing 7345425 (39.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 1 0.00% 27 6 0.00% 28 2 0.00% 29 7 0.00% 30 16 0.00% 31 15 0.00% 32 4 0.00% 33 6 0.00% 34 8 0.00% 35 15 0.00% 36 8 0.00% 37 16 0.00% 38 19 0.00% 39 22 0.00% 40 28 0.00% 41 23 0.00% 42 38 0.00% 43 34 0.00% 44 30 0.00% 45 51 0.00% 46 46 0.00% 47 57 0.00% 48 50 0.00% 49 82 0.00% 50 114 0.00% 51 101 0.00% 52 130 0.00% 53 116 0.00% 54 141 0.00% 55 163 0.00% 56 189 0.00% 57 196 0.00% 58 251 0.00% 59 267 0.00% 60 309 0.00% 61 362 0.00% 62 386 0.00% 63 430 0.00% 64 523 0.00% 65 581 0.00% 66 669 0.00% 67 788 0.00% 68 886 0.00% 69 1103 0.01% 70 1382 0.01% 71 1492 0.01% 72 1527 0.01% 73 1783 0.01% 74 1839 0.01% 75 2083 0.01% 76 2323 0.01% 77 2541 0.01% 78 2875 0.02% 79 3280 0.02% 80 3767 0.02% 81 4192 0.02% 82 4737 0.03% 83 5188 0.03% 84 6327 0.03% 85 6975 0.04% 86 7518 0.04% 87 8031 0.04% 88 8499 0.05% 89 9068 0.05% 90 9743 0.05% 91 10600 0.06% 92 11300 0.06% 93 12187 0.07% 94 12835 0.07% 95 13409 0.07% 96 14445 0.08% 97 14753 0.08% 98 15589 0.08% 99 16577 0.09% 100 17303 0.09% 101 18177 0.10% 102 19141 0.10% 103 20368 0.11% 104 21048 0.11% 105 22066 0.12% 106 23004 0.13% 107 23988 0.13% 108 24944 0.14% 109 26147 0.14% 110 27149 0.15% 111 28450 0.15% 112 29935 0.16% 113 31109 0.17% 114 32639 0.18% 115 34289 0.19% 116 35386 0.19% 117 36850 0.20% 118 38354 0.21% 119 39954 0.22% 120 41515 0.23% 121 43723 0.24% 122 45583 0.25% 123 47908 0.26% 124 51072 0.28% 125 53017 0.29% 126 55609 0.30% 127 58807 0.32% 128 61453 0.33% 129 64636 0.35% 130 68398 0.37% 131 72146 0.39% 132 77200 0.42% 133 82471 0.45% 134 88316 0.48% 135 94988 0.52% 136 101968 0.55% 137 110418 0.60% 138 121585 0.66% 139 133706 0.73% 140 148085 0.81% 141 163951 0.89% 142 188544 1.03% 143 214539 1.17% 144 245530 1.34% 145 297187 1.62% 146 374555 2.04% 147 509542 2.77% 148 758564 4.13% 149 1355523 7.37% 150 4534269 24.66% 151 7345425 39.95% 18385706 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=45 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=109.43 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=19.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=26 prefix-density=0.43 prefix-fanout=3.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=265.15 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7170121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:55:32 Started mapping on | Feb 12 11:55:32 Finished on | Feb 12 11:57:11 Mapping speed, Million of reads per hour | 668.57 Number of input reads | 18385706 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17505436 Uniquely mapped reads % | 95.21% Average mapped length | 292.02 Number of splices: Total | 17046816 Number of splices: Annotated (sjdb) | 16766456 Number of splices: GT/AG | 16796283 Number of splices: GC/AG | 199510 Number of splices: AT/AC | 13099 Number of splices: Non-canonical | 37924 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351566 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 25750 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.71% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 545368 545368 545368 N_multimapping 351566 351566 351566 N_noFeature 415714 17323903 501037 N_ambiguous 168181 1065 71303 UnstrandedReadsAssigned:16921541 PositiveStrandReadsAssigned:180468 NegativeStrandReadsAssigned:16933096 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170121-trimmed-pair1.fastq SRR7170121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,385,706 reads, 16,848,717 reads pseudoaligned [quant] estimated average fragment length: 252.275 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7170121.ke.tsv 34699 SRR7170121.se.tsv 87100 total ==> SRR7170121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.73 302 9.75099 Potri.005G024800.1.v4.1 1035 783.725 49 3.56651 Potri.004G059700.1.v4.1 961 709.867 6 0.482153 Potri.007G009000.2.v4.1 1416 1164.73 0 0 Potri.003G141000.2.v4.1 2943 2691.73 376.072 7.96986 Potri.016G087400.1.v4.1 270 80.707 2255 1593.85 Potri.015G069301.1.v4.1 564 320.695 0 0 Potri.010G195200.1.v4.1 1773 1521.73 5 0.187432 Potri.012G127500.1.v4.1 977 725.788 5045 396.518 ==> SRR7170121.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 744 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170121 completed mapping pipeline successfully